ID: 933665737

View in Genome Browser
Species Human (GRCh38)
Location 2:84963461-84963483
Sequence GTGGTATCCCAGAAAATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933665735_933665737 27 Left 933665735 2:84963411-84963433 CCAATAGGGGATACAAAAACAGC No data
Right 933665737 2:84963461-84963483 GTGGTATCCCAGAAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933665737 Original CRISPR GTGGTATCCCAGAAAATGAG AGG Intergenic
No off target data available for this crispr