ID: 933666595

View in Genome Browser
Species Human (GRCh38)
Location 2:84970432-84970454
Sequence GAGGGAAGCCAGGAGGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 875
Summary {0: 1, 1: 0, 2: 9, 3: 105, 4: 760}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933666595_933666612 22 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666612 2:84970477-84970499 GGAAACACTGGCGAAGACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 79
933666595_933666606 10 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666606 2:84970465-84970487 GTAACCCGGCCGGGAAACACTGG 0: 1
1: 0
2: 0
3: 2
4: 31
933666595_933666602 0 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666602 2:84970455-84970477 CTGACCACCAGTAACCCGGCCGG 0: 1
1: 0
2: 1
3: 12
4: 108
933666595_933666600 -4 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666600 2:84970451-84970473 CCTCCTGACCACCAGTAACCCGG 0: 1
1: 0
2: 1
3: 12
4: 151
933666595_933666613 23 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666613 2:84970478-84970500 GAAACACTGGCGAAGACCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 72
933666595_933666611 21 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666611 2:84970476-84970498 GGGAAACACTGGCGAAGACCGGG 0: 1
1: 0
2: 0
3: 10
4: 107
933666595_933666603 1 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666603 2:84970456-84970478 TGACCACCAGTAACCCGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 77
933666595_933666610 20 Left 933666595 2:84970432-84970454 CCGGCAGCCTCCTGGCTTCCCTC 0: 1
1: 0
2: 9
3: 105
4: 760
Right 933666610 2:84970475-84970497 CGGGAAACACTGGCGAAGACCGG 0: 1
1: 0
2: 1
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933666595 Original CRISPR GAGGGAAGCCAGGAGGCTGC CGG (reversed) Intergenic
900230543 1:1554809-1554831 CAGGGAACCCAGGATGGTGCTGG - Intronic
900239831 1:1610829-1610851 GCGTGAAGCAAGCAGGCTGCAGG + Intergenic
900352318 1:2241072-2241094 GAGGGAGCCCAGGATGCTGTGGG + Intronic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
900798446 1:4723493-4723515 GGAGGTGGCCAGGAGGCTGCAGG + Intronic
900971304 1:5993613-5993635 GAGGGACACCAGGATGCGGCTGG - Intronic
901019665 1:6249395-6249417 GGGGGAACTCAGGAAGCTGCTGG + Exonic
901229040 1:7631782-7631804 GAGGGTAGCCAGGAGGCAGGGGG - Intronic
901233070 1:7652012-7652034 GAGGGATGGCAGGGGGCTGAGGG - Intronic
901462869 1:9401930-9401952 GAGGGAGGCCGGCAGGCGGCTGG + Intergenic
901941171 1:12663070-12663092 AAGGGCTTCCAGGAGGCTGCAGG + Intronic
902377993 1:16039208-16039230 AAGAGAAGCCAGCAGGCAGCGGG - Intergenic
902383082 1:16061704-16061726 AAGAGAAGCCAGCAGGCAGCGGG - Intronic
902451439 1:16499188-16499210 GAGCGAAGGTAGGAGGCTGGGGG - Intergenic
902632684 1:17714861-17714883 GAAGGAAGACAGGGAGCTGCCGG + Intergenic
902663446 1:17921379-17921401 GAGGGAACTGGGGAGGCTGCTGG + Intergenic
902828512 1:18994506-18994528 AAGCCAAGCCAGGAGGCTGTAGG - Intergenic
902955577 1:19922519-19922541 GAGGGAAGCCTGGGGGCACCTGG - Intronic
903778199 1:25806450-25806472 AAGGGCAGCCTGGAGGATGCTGG + Intronic
903978263 1:27166338-27166360 GAGGAAAGCCAGAAGGTTGCGGG - Intronic
904039335 1:27575298-27575320 GAGGGAAACCAGGCGGCTGGGGG + Intronic
904494757 1:30880341-30880363 GAGGGAGGCCAGGGGGCAGAGGG + Intronic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
904830532 1:33303703-33303725 GAGGGGTTCCAGGAAGCTGCAGG - Intergenic
905106317 1:35565576-35565598 CCGGGAGGCCATGAGGCTGCAGG + Exonic
905179141 1:36155987-36156009 GAGAGGCGCCGGGAGGCTGCGGG + Intronic
905530586 1:38675559-38675581 GAGGGACACCAGGATGGTGCAGG - Intergenic
905626293 1:39492181-39492203 GCGGGCAGCCGGGAGGCGGCGGG - Exonic
905670604 1:39788274-39788296 GCGGGCAGCCGGGAGGCGGCGGG + Exonic
905734714 1:40317153-40317175 GAGGAGAACAAGGAGGCTGCGGG + Exonic
906138635 1:43519544-43519566 GAAGGAATCCAGGAGACTGGTGG + Intergenic
906202198 1:43967422-43967444 AGGGGAAACCAGGTGGCTGCAGG - Exonic
906262914 1:44406954-44406976 TAGGGCAGCCAGGAGGCAGGGGG + Intronic
906678695 1:47710575-47710597 GAGCGAAGCCTGGAAGCTGCGGG + Intergenic
906923431 1:50089232-50089254 AAAGGAAGCAAGGAGGCTACAGG + Intronic
907044279 1:51290310-51290332 GAAGGAAGCCCCAAGGCTGCGGG + Intronic
907045240 1:51296566-51296588 GAGCAAAGCCAGGAGGTGGCAGG + Intronic
907415785 1:54312927-54312949 GAGGGAGGCCAGGAGGGGGTGGG + Intronic
907724470 1:57006267-57006289 TAGAGATGCCAGTAGGCTGCTGG - Intronic
909352760 1:74673687-74673709 GTGGGAGCCCGGGAGGCTGCGGG - Exonic
909481508 1:76132321-76132343 GAGGGAAGGCAAGCTGCTGCTGG - Intronic
910189818 1:84583941-84583963 GAGTGAAGCCAAGAGGCTGAAGG - Intergenic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911085913 1:93977318-93977340 GAGTGGACCCAGGAGTCTGCAGG - Intergenic
911091778 1:94022900-94022922 GAGGGAGGCTGGGAGGCAGCAGG + Intronic
911102513 1:94105660-94105682 GAGGGAAGCCAGGAGAATGTAGG + Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
912431989 1:109632853-109632875 GGGGGAGGCTGGGAGGCTGCTGG + Intergenic
912459649 1:109822222-109822244 GAGGGAGGTCAGGAGACTTCTGG + Intergenic
913247029 1:116879080-116879102 GAGGGAGGGCAGGCAGCTGCTGG - Intergenic
914341761 1:146765994-146766016 GAGGGAAGCAACGAGGAGGCTGG + Intergenic
914392775 1:147237045-147237067 GAGGGAGGCCAAGGGGGTGCTGG - Intronic
915102022 1:153507612-153507634 GAGGGATGGCAGGGGGCAGCAGG - Intergenic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915556844 1:156665470-156665492 GAGCAAAACCAGGAGACTGCGGG - Intergenic
915977029 1:160398237-160398259 GAGGGAGGCCAAGAGCCTGAGGG - Intergenic
916502857 1:165401414-165401436 CAGGGAAGCCAAGAGGCATCAGG + Intronic
917163916 1:172090285-172090307 GCAGGAAGCCTGGAGGGTGCTGG + Intronic
918089324 1:181275567-181275589 GCTTGAAGCCAGGAGGCTGAGGG - Intergenic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
919298773 1:195734825-195734847 GAGGGCAACCAGGAGGGCGCTGG - Intergenic
919712061 1:200738816-200738838 GAGGGAAGCGGGGAGGGGGCGGG + Intergenic
919772638 1:201172414-201172436 GAGGCAAGGCAGGAGGTTTCGGG + Intergenic
919883824 1:201918327-201918349 GAAGGAAGACAGGAGGCAGGGGG - Intronic
920547002 1:206826569-206826591 GAGGGTGGACTGGAGGCTGCTGG - Intronic
920672918 1:208018247-208018269 GAGGGGAGCAAAGAGGCTGGAGG - Intergenic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
920807146 1:209245638-209245660 GAGGGCAGGCAGGGGCCTGCTGG + Intergenic
921261610 1:213389427-213389449 CAGGGAAGCGTGGAGTCTGCGGG + Intergenic
922419093 1:225447503-225447525 GATGGAGGCCAGGCGCCTGCAGG + Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
923108083 1:230869125-230869147 CAGGGCAGCCCGGAGGCTGGAGG + Intronic
923766356 1:236895550-236895572 GGTAGGAGCCAGGAGGCTGCGGG + Exonic
924083064 1:240419853-240419875 GTGGGAAAACAGGAGGCTACAGG - Intronic
924094485 1:240537109-240537131 AAGGGAGGCAAGGAGGCTACAGG - Intronic
924124873 1:240839993-240840015 GAGGGAAGCCAGTAGGTTCGGGG - Intronic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
924862082 1:247935877-247935899 GAAGGAAGGCAGGAGCCTGCGGG - Intergenic
1062792366 10:316617-316639 GAGGGTAGCCAGGGCTCTGCTGG + Intronic
1062905710 10:1178282-1178304 AAGGGAAGCGAAGAGGCTGAGGG + Exonic
1062939026 10:1407891-1407913 GAGAGAAGTGAGGAGGCTGGAGG + Intronic
1063588310 10:7372880-7372902 TAGGGCAGGCAGGGGGCTGCAGG - Intronic
1064143176 10:12807135-12807157 GAAGGTAGCCAGCAGGCAGCTGG - Intronic
1065487209 10:26247114-26247136 CAGAGCAGCCTGGAGGCTGCTGG + Intronic
1066263240 10:33749425-33749447 AAAAGCAGCCAGGAGGCTGCAGG + Intergenic
1067083765 10:43227629-43227651 CAGGGCAGCAAGGAGCCTGCAGG + Intronic
1067459393 10:46446153-46446175 GATGGGAGCAATGAGGCTGCTGG + Intergenic
1067627801 10:47938477-47938499 GATGGGAGCAATGAGGCTGCTGG - Intergenic
1067718019 10:48704481-48704503 GCAAGAGGCCAGGAGGCTGCAGG - Intronic
1068451189 10:57191137-57191159 TAGTGAAGCCAGTGGGCTGCAGG + Intergenic
1068946074 10:62730030-62730052 GAAGGAAACAAGGAGGCTGTGGG - Intergenic
1069749542 10:70736492-70736514 GAGGGGTCCCTGGAGGCTGCCGG + Intronic
1069785613 10:70986115-70986137 GAGGGAAGGCCTGAGGCTGAGGG + Intergenic
1070287202 10:75092756-75092778 GAAGGAAGCCATGAGGAGGCAGG - Intergenic
1070736275 10:78865833-78865855 GGGGGAAGGCAGAAGGCTGAGGG - Intergenic
1070760504 10:79021429-79021451 GCGGAAAGACTGGAGGCTGCAGG + Intergenic
1070976494 10:80609690-80609712 GTGGGAGTCCAGGAGGCTGCAGG + Intronic
1071290387 10:84184824-84184846 AAGGGGAGACAGGAGGCTGCTGG - Exonic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072805072 10:98418959-98418981 GAGGAAAGCTGGGAGCCTGCAGG + Intronic
1073047126 10:100646128-100646150 GAGGGAGGGGAGGAGGCTGGGGG + Intergenic
1073054137 10:100688357-100688379 GAGGGCAGGCAGGAGGCCTCCGG + Intergenic
1073189843 10:101643492-101643514 GAGGGCACCCAGGATGCCGCAGG + Intronic
1073432114 10:103493749-103493771 GAGGGAATCCTGGAGACTGCCGG + Intergenic
1073642138 10:105263606-105263628 GAGTAAAGCGAGGAGGCTGTGGG - Exonic
1073788298 10:106914184-106914206 GAAGGAAGGGAGGAGGATGCTGG + Intronic
1073845036 10:107544962-107544984 GAGGGAGGCCAAGGGGCTGAGGG + Intergenic
1074110995 10:110422841-110422863 GAGGGAAGGAAGGAGGCTATAGG + Intergenic
1074185729 10:111098217-111098239 GAGTGTGGGCAGGAGGCTGCAGG - Intergenic
1074855441 10:117469708-117469730 CAGTGAAGCCAGGAGGGAGCAGG - Intergenic
1075249388 10:120851798-120851820 GAGAGAAGCCTGGAAGCTGGAGG - Intronic
1075361345 10:121838131-121838153 GAGTGGAAACAGGAGGCTGCTGG - Intronic
1075597616 10:123743621-123743643 GTGGGAACCGAGGAGGATGCAGG + Intronic
1075616447 10:123893481-123893503 GAGGGAGAGGAGGAGGCTGCTGG + Intronic
1075659337 10:124182479-124182501 GTGGGAAGCCAGTGGCCTGCGGG - Intergenic
1075674919 10:124289748-124289770 GAGGGAGGCAAGGAGGCACCGGG - Intergenic
1076103021 10:127797798-127797820 GAGGGATGAGGGGAGGCTGCGGG - Intergenic
1076132841 10:128025800-128025822 GGGGTGACCCAGGAGGCTGCTGG - Intronic
1076348039 10:129794136-129794158 GAGGGAAGCCCGGGGCCTGGCGG + Intergenic
1076550974 10:131278023-131278045 GAGGAAACCCAGCAGGCTGTGGG + Intronic
1076815993 10:132914852-132914874 GAGCGAAGCCAGGAGGCTCAAGG - Intronic
1076839780 10:133040338-133040360 GAGTCAGGCCAGGCGGCTGCAGG + Intergenic
1076855925 10:133115625-133115647 GAGGGAGGCCAGGACCCCGCCGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1076993451 11:287618-287640 CAGGGAACCCAGGAAGGTGCAGG + Intergenic
1077010487 11:377107-377129 GAGGACAGCGAGGAGGCCGCGGG + Exonic
1077050815 11:565992-566014 CAGGGAAGCCAGGCAGCAGCAGG + Intergenic
1077101727 11:825472-825494 AGGGTCAGCCAGGAGGCTGCTGG - Exonic
1077259300 11:1607298-1607320 GGGAGGAGCCAGGAGGTTGCGGG + Intergenic
1077382485 11:2250682-2250704 AAGGGAAGGCAGGCGCCTGCAGG + Intergenic
1077498865 11:2899930-2899952 CAGGGAACCCAGGAGGCGTCTGG + Intronic
1077530537 11:3092778-3092800 GAGGGAAGCCAGGAGCCCCTGGG + Intronic
1077897366 11:6463591-6463613 CAGGGAGGCCAGGACGCAGCTGG + Intronic
1077938726 11:6817830-6817852 GAGGCATGGCAGAAGGCTGCAGG + Intergenic
1077953791 11:6991287-6991309 GAGGGAAGCAGGGAGGCTAGGGG - Intergenic
1078442539 11:11379296-11379318 GAGGGAGGTCAGGAGGCAGAGGG + Intronic
1078551819 11:12286305-12286327 GATTGAAGCCAGGAAGCTGCAGG - Intronic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1079331297 11:19535193-19535215 CAGGGAAAACAGGAAGCTGCTGG + Intronic
1080012234 11:27471624-27471646 GCTGGAACCCAGGAGGCTCCAGG + Intronic
1080485680 11:32704494-32704516 GAGGGAGGCCAGAGGGCTGAGGG + Intronic
1080641047 11:34158536-34158558 GACTGAGGCCAGGAGGCAGCTGG - Intronic
1083271206 11:61573491-61573513 GTGGGAAGTCAGGAGGCAGGTGG - Intronic
1083407084 11:62465001-62465023 GAGGAAAGCCAGGAGGATGTGGG - Intronic
1083554378 11:63614227-63614249 GCGGGCGCCCAGGAGGCTGCAGG + Exonic
1083669320 11:64291545-64291567 GTGGGGAGCCAGGCGGCCGCAGG + Intronic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1083707433 11:64526017-64526039 GAGAGCTGCCAAGAGGCTGCTGG - Intergenic
1083899846 11:65638298-65638320 GAGGGAAGTTGGGAGGGTGCTGG - Intronic
1083941636 11:65899490-65899512 GGGGGCACCCGGGAGGCTGCAGG - Intronic
1084004271 11:66314963-66314985 GAGGGATGACCGGTGGCTGCTGG - Exonic
1084256519 11:67946640-67946662 GAGGGAAGAGAGGGGGCTGTGGG - Intergenic
1084406464 11:68976803-68976825 GAGGGAACCCAGAAGGCAGAGGG + Intergenic
1084739790 11:71132172-71132194 GAGGGAAGGGTGGAGGCTGGCGG + Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085011219 11:73142635-73142657 GAGGGAGGGCAGGAGGCGTCTGG - Intergenic
1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG + Intronic
1085337380 11:75706487-75706509 GAGGGAGGAGAGGAGGCAGCGGG - Intergenic
1085439250 11:76543420-76543442 GAGGGAAGCCAACTGGCTGGAGG + Intronic
1086210285 11:84310080-84310102 AAGGGAATCCAGGATTCTGCAGG + Intronic
1086380158 11:86244555-86244577 GGGGGAAGCCAGGGGGAAGCAGG + Exonic
1086934276 11:92727808-92727830 GAGAGAAGACTGGAGCCTGCAGG - Intronic
1088648902 11:111940128-111940150 GAGGGAAGCCAGGATTCAGAGGG - Intronic
1089279891 11:117366502-117366524 GAGCAAATCCAGGAGGCTGAAGG + Intronic
1089308032 11:117538911-117538933 GTGGCCAGTCAGGAGGCTGCTGG - Intronic
1089752369 11:120660815-120660837 GGAAGAAGCCAGGAGTCTGCTGG + Intronic
1089877691 11:121741512-121741534 GGTGCAAGCCAGGAGGCTGCTGG - Intergenic
1090039320 11:123276480-123276502 AAGGGAAGGGAGAAGGCTGCAGG - Intergenic
1090116646 11:123980145-123980167 GAGGGAAGCCAAGGGGCTGAGGG - Intergenic
1090231674 11:125111514-125111536 GAGGAAAGCGGGGCGGCTGCGGG - Intronic
1090570605 11:128040697-128040719 GAGAGAAGCCAGGTTGATGCTGG - Intergenic
1091665332 12:2414817-2414839 GAGGGCAGTCAGGTGTCTGCCGG + Intronic
1091758240 12:3070022-3070044 GAGGATAGCCAGGAGTCTGAAGG + Intergenic
1091769563 12:3142210-3142232 GAGGGAGGACAGCAGGCAGCGGG - Intronic
1091776869 12:3190377-3190399 CAAGGAAGGCAGGTGGCTGCGGG - Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092124431 12:6065581-6065603 GAGGGAGGAGGGGAGGCTGCAGG - Intronic
1092125917 12:6075074-6075096 GAGGGAAGTCAGGGGGCGCCAGG + Intronic
1094025916 12:25959211-25959233 GAGGGCAGCTCCGAGGCTGCAGG - Intronic
1094849241 12:34374994-34375016 CAGGGATGCCAAGAGTCTGCTGG + Intergenic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1096215275 12:49794973-49794995 GATGGAAGCCCGGAAGCTGGAGG - Exonic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1096692112 12:53327746-53327768 GACTGAAGCCTGGAGGCTGAGGG + Exonic
1097196973 12:57248183-57248205 GATGGAAACCAGGTGGCTGTAGG + Exonic
1097806344 12:63968826-63968848 GAGGCAAGCGAGCAGTCTGCAGG - Intronic
1098123968 12:67270236-67270258 GCGGGCAGAGAGGAGGCTGCCGG - Intronic
1098974915 12:76892483-76892505 GAGGAAAGCCAGGAAGATCCTGG + Intergenic
1099606374 12:84806849-84806871 GAGGAAATCCAGGAAGCTGGTGG + Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1100329818 12:93572127-93572149 GAGGGGAGCGAGGAGCCTCCCGG + Exonic
1100406629 12:94277608-94277630 GATGAAAGCCAGGAGTCTACTGG + Intronic
1101036927 12:100716165-100716187 GAGGGCAGCCAGGCGGCGGCGGG - Intergenic
1102181823 12:110918423-110918445 GGGGAAAGGCACGAGGCTGCTGG + Intronic
1102248072 12:111367732-111367754 CTGGGAAGACAGGAAGCTGCAGG + Intronic
1102433057 12:112898552-112898574 GATGGCAGCCAGGAAGCTGTTGG - Exonic
1102535526 12:113577775-113577797 GAGGGGAGCCAGGTGGGTGGGGG - Intergenic
1102540601 12:113616499-113616521 GGGAGGAGCCAGAAGGCTGCTGG + Intergenic
1103361784 12:120358944-120358966 GTGGTCAGCCAGGGGGCTGCAGG - Intronic
1103420056 12:120773459-120773481 GACGGGAGACAGGAGTCTGCGGG + Intronic
1103706792 12:122879280-122879302 TAGGTCAGCCAGGTGGCTGCTGG - Intronic
1104439983 12:128786663-128786685 CAGGGGATCCCGGAGGCTGCTGG + Intergenic
1104715433 12:131013098-131013120 GAGGGAAGCCAGGTACCTGAAGG - Intronic
1104950825 12:132439156-132439178 GAAGGCAGCCATGAGGCTGGAGG + Intergenic
1105821475 13:24084776-24084798 GTGAGAAGCCAAGAGGCAGCAGG + Intronic
1105891726 13:24686926-24686948 CAGGGAAGGCAGGAGGGTGGAGG + Intronic
1106419315 13:29572409-29572431 GAGGCCACCCAGGAGGATGCTGG + Intronic
1106590861 13:31097351-31097373 ATAGGAAGCCATGAGGCTGCAGG - Intergenic
1106865367 13:33958778-33958800 GAGGGCAGCCAGGATGCTCATGG - Intronic
1107229010 13:38086144-38086166 GAAGGAGGCCAGGGGGCTGAGGG + Intergenic
1107528943 13:41263436-41263458 GAGGCAATACAGGAGGCGGCGGG + Intronic
1107690451 13:42948075-42948097 GTGGGAAGCCTGGCAGCTGCGGG - Intronic
1108389925 13:49937125-49937147 ACGGGAACCCAGGAGGCTGCGGG + Intergenic
1109559244 13:64025304-64025326 GAGGAAAGCCAGCAGGCAGTGGG - Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1113420213 13:110165266-110165288 GAGGGCTGGCATGAGGCTGCAGG - Intronic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1113628587 13:111864695-111864717 CATGGAAGCCTGGAGGATGCGGG + Intergenic
1113791585 13:113031648-113031670 GTGGGAAGCCTGGAGCTTGCTGG + Intronic
1113890138 13:113731336-113731358 GAGAGAAGGTAGGAGGCGGCCGG + Exonic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114587273 14:23826319-23826341 TGGGGAAGCCAGGAGGGGGCAGG - Intergenic
1117063933 14:51989810-51989832 GAGAGGGGCCCGGAGGCTGCCGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117771024 14:59134773-59134795 TAGGAAGGGCAGGAGGCTGCTGG + Intergenic
1117799141 14:59425718-59425740 GAGGGAAGCAGTGAGGTTGCAGG + Intergenic
1117937797 14:60926784-60926806 TAGGGAAGGGAGGAGGCTGAAGG - Intronic
1117955937 14:61123758-61123780 GGGGGAAGCCAGGAGCCTGGAGG - Intergenic
1118885062 14:69859463-69859485 GAGGGGAGCCTGGGGACTGCGGG - Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119348436 14:73944790-73944812 GAGGGAGGCCGGGAGCCTGAGGG + Exonic
1119401455 14:74365423-74365445 GAGGGCAGCCAGGAGGAGACTGG + Intergenic
1119658758 14:76436030-76436052 GAGGGAAGCAAAGAAGATGCTGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1120224841 14:81779031-81779053 GAGGGAAGCAAGGAGCATGGTGG - Intergenic
1120592274 14:86390380-86390402 GAGGGAGGCCAGTGGGCTGAGGG + Intergenic
1120780070 14:88479189-88479211 GAGGGCAGCCAGGTGGGTCCTGG + Exonic
1120853701 14:89194592-89194614 GAGGAGAGACAGGAGGCTGTTGG - Intronic
1120929860 14:89837361-89837383 GAAGGAAGCAGGGAGGCTACAGG - Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121691943 14:95884303-95884325 GAGGGAAGCAAGGGGGCAGGTGG - Intergenic
1121794427 14:96723614-96723636 GAGGGATGACAGGAGACTGAGGG + Intergenic
1122070003 14:99200185-99200207 TTGGGAATCCAGGATGCTGCAGG + Intronic
1122114038 14:99518791-99518813 GAGGGAAGCCAGGAGCGTGGGGG + Intronic
1122122471 14:99561786-99561808 GAGGGATGCCAGGTGGGAGCAGG + Intronic
1122289821 14:100674563-100674585 CAGGGGAGCTGGGAGGCTGCTGG + Intergenic
1122797384 14:104212804-104212826 CAGGGCAGCAAGGTGGCTGCAGG + Intergenic
1122811524 14:104291736-104291758 GAGCGAGGCCTGGAGGGTGCTGG - Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122849964 14:104522789-104522811 GAGGGAGGCCAGCACACTGCAGG - Intronic
1122940586 14:104979251-104979273 CAGGGCAGCAAGGAGGCTGAGGG + Intergenic
1123053387 14:105558693-105558715 CTGGGAGCCCAGGAGGCTGCCGG + Intergenic
1123077964 14:105679107-105679129 CTGGGAGCCCAGGAGGCTGCCGG + Intergenic
1202929388 14_KI270725v1_random:25352-25374 GAGGCAAGCCAGTGGGCTGCAGG - Intergenic
1123898931 15:24856592-24856614 GAGGGAAGACAGGGGGCGGCTGG - Intronic
1123922452 15:25080009-25080031 CAGAGAAGCCAGGAAGCTCCTGG + Intergenic
1124210086 15:27755869-27755891 GAGGGACTTCAGGAGCCTGCTGG - Intronic
1124215973 15:27807285-27807307 GAGGGAAGTCAGGAGAGTGGGGG - Intronic
1125897252 15:43312921-43312943 AAGGGAGGACAGGAGGATGCTGG + Intergenic
1126135507 15:45386512-45386534 GAGAGGAGCCAGGTGGCTGTGGG - Intronic
1126144818 15:45464518-45464540 GAGGAGAGCCAGGAGAGTGCAGG + Intergenic
1126427671 15:48546864-48546886 GAGGGAAACCGGAAGGCTCCCGG + Intronic
1126432701 15:48603288-48603310 GGGGGAAGCCAGGAGGAGGCAGG + Intronic
1127259828 15:57319657-57319679 GATGGAAGCCAGGAGGCGGCGGG + Intergenic
1127810190 15:62559145-62559167 GAGGGAAGTCAGGCTGCTGGAGG - Intronic
1127958498 15:63873263-63873285 GAAGGAAGCAAGGAAGCTGTGGG - Intergenic
1127963560 15:63907757-63907779 TAGGGAAGCAAGGAGGAGGCAGG + Exonic
1128080760 15:64855525-64855547 GAGGAAAGCTGGGGGGCTGCAGG - Intronic
1128181666 15:65610702-65610724 GAGGGACTCCCGGAGGCTGACGG - Intronic
1129105614 15:73305360-73305382 CAGGTGAGCCAGGAGGCTGCAGG + Intergenic
1129247132 15:74286445-74286467 GAGGGCACCCAGGATGCTGTGGG - Intronic
1129274208 15:74434522-74434544 GAGGCAGCCCAGAAGGCTGCTGG - Intergenic
1129301851 15:74629999-74630021 GAAGGAAGGCAGGAGCCTGCAGG + Exonic
1129661717 15:77556464-77556486 GAGGGCAGCCAGGGGGCTCTGGG - Intergenic
1129827153 15:78641351-78641373 TAGGGAAGCCAGGCGGCAGGTGG - Intronic
1129888795 15:79057367-79057389 GAGTCAAGTCAGGAGGCTGTGGG + Intronic
1131111552 15:89767783-89767805 GTGGGCAGCCAGGTGGCTGCAGG + Intronic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1131696148 15:94880242-94880264 GAGGGAAGCCGGAAGTCTGATGG + Intergenic
1132019875 15:98351648-98351670 CAGGGAAGCCCAGAGGCTGAAGG + Intergenic
1132150766 15:99456513-99456535 GGGACAAGCCAGGAGGTTGCCGG - Intergenic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1132636552 16:952632-952654 GACGGGAGACAGGAGGCAGCTGG - Intronic
1132911844 16:2317770-2317792 GAGAGAAGCCATCACGCTGCTGG + Intronic
1134452787 16:14373669-14373691 GGGGGAAGGCAGGGAGCTGCTGG - Intergenic
1134459796 16:14421275-14421297 GAGGCAAGCCTGGAGGCCTCTGG - Intergenic
1135144735 16:19951311-19951333 GAGAGAAGCCAGGAACCTGGAGG - Intergenic
1135469925 16:22721299-22721321 GAAGGAGGCCAGGTGGCCGCAGG + Intergenic
1135597756 16:23756313-23756335 GGGGGAAGGAAGGTGGCTGCTGG + Intronic
1135669104 16:24360051-24360073 GAGAGAATTCAGGAGGCTCCTGG + Intronic
1136085484 16:27881926-27881948 GAGGCCAACCAGGAGGCTGCAGG - Intronic
1136580802 16:31149801-31149823 GACGGAGGCTAGGAGGCTGGGGG - Intronic
1136614963 16:31393122-31393144 GAAGGAAGCCAGGTCCCTGCAGG + Intergenic
1136861842 16:33709470-33709492 GAGGCAAGCCAGCTGGCCGCAGG - Intergenic
1137572285 16:49574737-49574759 GAGGGAAAGCAGGAGGGAGCAGG - Intronic
1137674639 16:50298245-50298267 CGAGGTAGCCAGGAGGCTGCAGG - Intronic
1137726087 16:50657675-50657697 GAGATAAGGGAGGAGGCTGCAGG - Intergenic
1137728788 16:50674650-50674672 GAGGGACCCCAGCAGCCTGCAGG - Intronic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1138226408 16:55299279-55299301 CAGGGAAGACAGGAGCCAGCAGG - Intergenic
1138529729 16:57628483-57628505 GAGGGAGACCAGGAGGGGGCAGG - Intronic
1138591401 16:58001249-58001271 GCGGGGTGCCGGGAGGCTGCAGG + Intronic
1138999363 16:62490472-62490494 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1139690809 16:68640921-68640943 AAGGGAAGCAGGGAGGCTGGTGG - Intronic
1141382507 16:83588879-83588901 ACGTGGAGCCAGGAGGCTGCTGG + Intronic
1141440281 16:84025630-84025652 GAGGGAGGCCTGGTGGCTGCTGG - Intronic
1141510647 16:84509766-84509788 GGGGGAAGACAGGAGGCTCAGGG + Intronic
1141611139 16:85181798-85181820 AAGGGAGGCCAGGAGGCACCTGG + Intronic
1141762686 16:86039017-86039039 GAAGGAGGCCTGGAGGATGCTGG + Intergenic
1142154870 16:88528320-88528342 GTGGGAAGCTCGGGGGCTGCAGG + Intronic
1142164891 16:88581035-88581057 GGGGTAGGCCACGAGGCTGCAGG - Intronic
1142231932 16:88904014-88904036 GAGGGTGGCCAGGAGACCGCTGG + Intronic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1142474467 17:181029-181051 GAGGGAAGCCGCGAGGCCGTGGG + Intronic
1142755648 17:2015070-2015092 AAGGCAAGACAGGAGGCTGCTGG + Intronic
1142848836 17:2694682-2694704 GAGGGCAGCCGGGAGGCTCCCGG - Intronic
1142941748 17:3385881-3385903 GAGGGGAGGGAGGAGGCAGCCGG - Intergenic
1142977742 17:3655826-3655848 GAGGGGAGTCAGGAGGCCCCCGG - Intronic
1143148146 17:4789752-4789774 GAGGGGAGTCAGGAACCTGCGGG - Exonic
1143243734 17:5465934-5465956 GAGGAAGGCTAAGAGGCTGCAGG - Intronic
1143246133 17:5486838-5486860 GACGGAAGCCGGGAGCCGGCCGG + Intronic
1143269645 17:5666155-5666177 GCGGGGAGCCATGAGGCTGGAGG - Intergenic
1143544359 17:7587892-7587914 AAGGGAAGCAGGGAGGCTGGAGG - Exonic
1144009619 17:11134247-11134269 GATGAAAGCCAGGGTGCTGCTGG + Intergenic
1144848229 17:18231052-18231074 GAGGGACACCTGAAGGCTGCAGG - Intronic
1145007185 17:19344472-19344494 GCGGGAGGCCAGGAGGCCGGGGG + Intronic
1145013407 17:19382282-19382304 CTGGGCAGCCAGGAGGCTGGTGG - Exonic
1145288164 17:21522002-21522024 CAGGAAAGCCAGGAGGCAGCAGG + Intergenic
1146270244 17:31480343-31480365 GAGGCAAGCAGGGAGGCAGCAGG + Intronic
1146624293 17:34424169-34424191 GAGAGAAGCGGGCAGGCTGCAGG - Intergenic
1146635373 17:34500224-34500246 GAGGGTAGCCATGTGGATGCTGG - Intergenic
1147168311 17:38604830-38604852 TAGGGAAGGCAGGCGGCTGAGGG - Intronic
1147910376 17:43852714-43852736 GCGCGAGGCCAGGGGGCTGCAGG + Intronic
1147938709 17:44029727-44029749 AGCGGAAGCAAGGAGGCTGCTGG - Intergenic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1148038700 17:44689354-44689376 GTGGGAAGCCTGAAAGCTGCAGG - Intronic
1148072441 17:44916185-44916207 GAAGGACTCCAGGAGTCTGCTGG - Intronic
1148127027 17:45242243-45242265 TGGGGCAGCCAGGAGGCAGCAGG - Intronic
1148217008 17:45838827-45838849 GAGGGCAGCAAGGAGGCCTCAGG + Intergenic
1148244560 17:46021932-46021954 AAAGGAACCCAGGAGGCTGGTGG - Intronic
1148461763 17:47843203-47843225 GTGGGAAGCCGGGAAACTGCAGG - Intergenic
1148577565 17:48722645-48722667 CGGGGAGGCGAGGAGGCTGCTGG - Intergenic
1148749499 17:49936395-49936417 GAGGGCAGTGAGGAGGCTGGGGG - Intergenic
1148862905 17:50613861-50613883 AAGGGAGGACAGGAGGCTACGGG - Intronic
1148901663 17:50883216-50883238 CAGGGAAACCAGTAGGCGGCTGG - Intergenic
1149518072 17:57295309-57295331 GAGGGGAGCTAGAAGGGTGCTGG + Intronic
1149658392 17:58322272-58322294 GAGGGAAGCTGGCAGGCTGCTGG - Intronic
1151440029 17:74122539-74122561 GATGGAAGCAGGGAGACTGCTGG - Intergenic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1152241517 17:79163694-79163716 GAGGGAAGCAAGTGGGGTGCGGG - Intronic
1152436242 17:80278159-80278181 TCGGCAGGCCAGGAGGCTGCTGG + Intronic
1152456226 17:80417896-80417918 GAGTGACGCCAAGAGGCTTCCGG - Intronic
1152732390 17:81978655-81978677 GGGCGCAGCCAGGAGGCTGTTGG + Intronic
1152784506 17:82240885-82240907 GAGGGAAGCCATGGGGCAGTGGG + Intronic
1152890554 17:82879322-82879344 AAGGGAGGCCAGGAGGAAGCTGG - Intronic
1153083639 18:1257674-1257696 GAAAGAAGCCAGGAGGTTGAGGG + Intergenic
1153268758 18:3297402-3297424 GAGCAAAGCCAGGTGGCGGCTGG - Intergenic
1155229268 18:23757300-23757322 GATGGGAGCCACGAGGCAGCCGG - Intronic
1156483017 18:37447952-37447974 GATGGAAGCAAGGGAGCTGCAGG - Intronic
1156812899 18:41274038-41274060 GCGGGAAACCAGCAGGCAGCAGG + Intergenic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157290984 18:46409539-46409561 GGGGGAAGCTAAGAGGCTGTGGG + Intronic
1157598201 18:48876505-48876527 GAGGGAAGCAAGGAGGTTTTTGG - Intergenic
1157598618 18:48879039-48879061 GAAAGGAGACAGGAGGCTGCCGG - Intergenic
1157845493 18:51000282-51000304 GAGAGCCTCCAGGAGGCTGCCGG - Intronic
1158344719 18:56504649-56504671 GATGTAAGGCAGGAGGCTGTTGG - Intergenic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1158850925 18:61495504-61495526 GAGGGAGCCCAGGAGGCAGGAGG + Intronic
1159276757 18:66232051-66232073 GAGAGTCCCCAGGAGGCTGCTGG - Intergenic
1159348787 18:67242825-67242847 GTGTGAAGCCATGAGGCTGAAGG - Intergenic
1159594802 18:70372321-70372343 CAAGGAAGAGAGGAGGCTGCAGG + Intergenic
1159716239 18:71827167-71827189 TAGGGAGGCCAGGAGCCTGGCGG - Intergenic
1159973218 18:74678485-74678507 GAGGACAGCCAGCAGGCTGATGG - Intronic
1160312697 18:77810705-77810727 GAGGGAGACAAGGCGGCTGCAGG - Intergenic
1160671831 19:368807-368829 GTGGGAAGAGAGGAGGCTGGAGG - Intronic
1160695824 19:483823-483845 GAGGGAAGGAAGATGGCTGCAGG - Intergenic
1160814368 19:1028426-1028448 GCGGGAAGCCAGGGGGAAGCTGG - Intronic
1160875454 19:1294491-1294513 GAGGGAGACCAGGAGGCCGCCGG + Intronic
1161322346 19:3647064-3647086 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322368 19:3647136-3647158 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322377 19:3647170-3647192 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322393 19:3647220-3647242 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322404 19:3647258-3647280 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161487991 19:4546142-4546164 GAGGGGAGGGAGGAGGCTGGAGG - Intronic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1162369501 19:10270403-10270425 AGGGGAAGCGAGGAGGCCGCCGG + Intergenic
1162604850 19:11698766-11698788 GAGAAAACCCAGGAGTCTGCTGG - Intergenic
1162906227 19:13825716-13825738 GAGGGCTGCCAGGTGGATGCGGG + Intronic
1162970985 19:14181366-14181388 GGGTGAGGCCAGGAGCCTGCAGG + Intronic
1163248226 19:16110638-16110660 TTGGGAAGCCAGGAGGTTGAGGG - Intergenic
1163323084 19:16586016-16586038 GAGGCAAGCCAAGGGGCTGCTGG - Intronic
1163429432 19:17258264-17258286 AAAGGAAGCATGGAGGCTGCTGG - Exonic
1163446785 19:17351676-17351698 CTGGGAGGCCAGGAGGCTGGAGG + Exonic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163561601 19:18022528-18022550 GAGGGAAGGCTGAAGGCTGGAGG + Intergenic
1164524663 19:29004513-29004535 GTAGGAAGCCAGCAGCCTGCTGG + Intergenic
1164564896 19:29318731-29318753 GAGGGAAGCCAGATTTCTGCTGG - Intergenic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165143747 19:33718718-33718740 GGGAGAAGCCAGGAGGATTCTGG - Intronic
1165245753 19:34497616-34497638 CAGGAGAACCAGGAGGCTGCCGG + Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165325851 19:35114435-35114457 GAGGGAAACTGGGAGGCTGGAGG - Intergenic
1165739473 19:38196750-38196772 GGGGGGAGCCAGGAGGCCGAGGG + Intronic
1165739482 19:38196770-38196792 GGGGGGAGCAAGGAGGCTGAGGG + Intronic
1165886639 19:39083913-39083935 GAAGGAAGCCGGAAGGCTGGAGG + Intronic
1165952618 19:39482741-39482763 GAGTCAAGCCAGGAGGGGGCTGG - Intronic
1166102152 19:40577145-40577167 GAGGGAACCCTGGATCCTGCGGG + Intronic
1166349885 19:42191645-42191667 GAGAGAAGCCAGGAGGGGTCTGG + Intronic
1166365453 19:42275992-42276014 GGAGGAAGCCAGGAGGCCGTGGG + Intronic
1166559284 19:43720985-43721007 GAGGGAGGCCAGGCGGCCACAGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166673036 19:44722874-44722896 GGAGGAGCCCAGGAGGCTGCAGG + Intergenic
1166688675 19:44810339-44810361 GAGGGGGGCCAAGAGGCGGCTGG + Intronic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG + Intronic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167251379 19:48400064-48400086 GATCAAAGCCAGGAGCCTGCTGG + Intronic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1167502840 19:49857249-49857271 CAGGGGAGCCCGGAGGATGCCGG + Intronic
1167606749 19:50485376-50485398 GAAGGAGCCCAGGAGGCAGCTGG - Exonic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1168695490 19:58401633-58401655 GATGGGGGACAGGAGGCTGCGGG + Intronic
925219045 2:2123012-2123034 GAGAGAAGCCAGGAGATTGAGGG + Intronic
925242436 2:2343746-2343768 CAGAGAAGCCAGGAGGCCTCAGG - Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925333239 2:3074882-3074904 GAGGGACACCTGGAGGCTGAGGG - Intergenic
925415264 2:3665904-3665926 GAGTGAAGTGTGGAGGCTGCTGG + Intronic
925429607 2:3779798-3779820 GGTGGCAGCCAGGAAGCTGCAGG - Intronic
925610363 2:5696724-5696746 GAGGGAAGCCTCGGGGCTGCGGG + Exonic
925658282 2:6173908-6173930 GAGAGAAGTGAGGAGACTGCAGG + Intergenic
925769724 2:7270116-7270138 GTTGCAAGCCAGGTGGCTGCTGG + Intergenic
926131705 2:10307068-10307090 GCAGGAAGCCAGGAGCCTGGGGG + Intronic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926466370 2:13194057-13194079 GCAGGAAGACAAGAGGCTGCTGG - Intergenic
926625824 2:15088997-15089019 CAAGCAGGCCAGGAGGCTGCAGG - Intergenic
926687335 2:15708469-15708491 GAGGGAAGCATGGAGTGTGCTGG - Intronic
927078720 2:19606706-19606728 GAGGCAAGACAGGTGGCTGGAGG + Intergenic
927109795 2:19856404-19856426 GAGTGAGGTCAGGAGGCTGGTGG - Intergenic
927253583 2:21019987-21020009 GAGGGAAGACAGGAGGATAAGGG - Intronic
927256894 2:21047536-21047558 GAGAGAAGCCAGAAGTCAGCAGG + Intergenic
927285831 2:21355958-21355980 GAGAGAACCCAGGAGACTACAGG + Intergenic
928065770 2:28163190-28163212 GGGGGAAGCAGGGTGGCTGCCGG - Intronic
928120574 2:28581001-28581023 GAGGGGAGCCTTGGGGCTGCTGG + Intronic
928181607 2:29072252-29072274 GAGGGATGCCTTGAGCCTGCTGG + Exonic
930089272 2:47520161-47520183 GAGGGGAGCGGTGAGGCTGCAGG - Exonic
931008815 2:57883477-57883499 GAGGCAGGCCAGGAGTCTGAAGG - Intergenic
931387566 2:61810919-61810941 GAGGTAGGCCAGGAGGATGCAGG + Intergenic
931636056 2:64341596-64341618 AATGGAAGCCAGCTGGCTGCAGG - Intergenic
932177778 2:69618675-69618697 GAGGGAAGCCAAGATGCTACAGG - Intronic
932586938 2:73036331-73036353 TGGGGGAGCCAGGAGGCTGGGGG + Intronic
932685992 2:73870707-73870729 GGGTGAAGAGAGGAGGCTGCTGG - Intronic
933610984 2:84435068-84435090 GAGGGAAGCTGGGACTCTGCTGG - Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933776088 2:85772137-85772159 GTGGGGAGCCAAGAGCCTGCTGG + Intronic
934460285 2:94210913-94210935 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
934731457 2:96661271-96661293 GGGAGAAGGAAGGAGGCTGCAGG + Intergenic
934745424 2:96756475-96756497 GAGGGAAGAAGGGAGGCTGAGGG - Intergenic
934784786 2:96997241-96997263 GAGGTGTGCCCGGAGGCTGCAGG + Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935317965 2:101855991-101856013 GCGGGAAGCTAGAAGGCAGCAGG + Exonic
935339961 2:102051116-102051138 GAAGGAAGCCAGCAGCCTGTTGG + Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
935523240 2:104135560-104135582 GAGAGAAGGCAGCAGGCTTCGGG + Intergenic
935593747 2:104863909-104863931 GAGGCAAGGCCGGAGGCGGCCGG + Intergenic
936622673 2:114116832-114116854 GAGGGAAGCCAGGCTGTGGCTGG + Intergenic
937121878 2:119446208-119446230 GTGGGGTGTCAGGAGGCTGCTGG - Intronic
937370874 2:121296436-121296458 GAGGGAGGCCAGGGGCCTGAGGG - Intergenic
937453238 2:122019662-122019684 GAGGGAATCAAAGGGGCTGCAGG + Intergenic
937470934 2:122173332-122173354 GGGGAAAGCCACGAGGCAGCAGG + Intergenic
937910770 2:127074466-127074488 GCGGGCTGCCAGGTGGCTGCTGG - Intronic
938269771 2:129959364-129959386 GAGGGAAGGCGGGAGGGTGGAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939084998 2:137708249-137708271 GAGGGAGCCCAGGGGGCTGAGGG - Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940775122 2:157876466-157876488 GAGGGGAGAGAGGAGGCGGCGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941211255 2:162642809-162642831 GTGGATAGCCAGGAGGCTGGAGG + Intronic
941764653 2:169283978-169284000 CAGGGAAGCGAGGAGGGTGAAGG - Intronic
941987079 2:171520550-171520572 GAGGGAAGACAGGAACCTCCTGG - Intergenic
942649211 2:178149350-178149372 GGACGAGGCCAGGAGGCTGCTGG + Intergenic
943060591 2:183038314-183038336 GGCGGAAGGCAGGAGGCTGCCGG - Exonic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
947161668 2:227221369-227221391 GAGGGAAGACAGGAGACTCCAGG - Intronic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
947533392 2:230926491-230926513 GGAGGAGGCCAGGAGCCTGCTGG + Intronic
947714233 2:232331850-232331872 GAGGCGAGCCAGGAGAATGCAGG - Intronic
947735797 2:232454758-232454780 CCGGGAAGCCAGGAGGGCGCAGG + Intergenic
948183067 2:235998406-235998428 GAGGTGAGCCAGCAGGCTCCAGG + Intronic
948263371 2:236620795-236620817 GATGGGAGCCCGGAGGCTGGGGG + Intergenic
948274163 2:236695402-236695424 GAGGGGAGCCACCAGCCTGCAGG - Intergenic
948338992 2:237233930-237233952 AAGGGAAGCCAGGAAGGTGCAGG + Intergenic
948423222 2:237873120-237873142 GAGGGGAGCAGGGAGGCTTCAGG + Intronic
948693766 2:239722557-239722579 GTGGGAAACAAGGAGGCAGCTGG - Intergenic
948725381 2:239930813-239930835 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948725413 2:239930899-239930921 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948825623 2:240572326-240572348 GAGAGAAGGCAGGAGGCTCTGGG - Intronic
948866441 2:240777456-240777478 CAGGAAACCCAGGGGGCTGCTGG - Intronic
1169254106 20:4084176-4084198 TAGGGATGGCAGGAGGCAGCAGG + Intergenic
1169262491 20:4148880-4148902 GGAGGAAGCCAGGCGGCTGGCGG + Exonic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169478132 20:5950574-5950596 GACGGAAGCCGAGAGGCTTCCGG - Intergenic
1170415693 20:16137277-16137299 CACGGAAGCCAGGAGGCAGTGGG + Intergenic
1170803736 20:19611904-19611926 ACGGGGAGCCTGGAGGCTGCGGG - Intronic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1172135042 20:32681165-32681187 CCTGGAAGCCAGGAGGCTCCTGG - Intergenic
1172175528 20:32969881-32969903 GTGGGAAGGCAGGGGGCGGCCGG + Intergenic
1172484660 20:35291100-35291122 GAAGGAGGAGAGGAGGCTGCTGG - Intronic
1172485587 20:35296116-35296138 GAGGGCAGACAGGTGGCTCCCGG + Intergenic
1173249695 20:41358007-41358029 GAGGGCAGAGAAGAGGCTGCTGG - Exonic
1173460754 20:43241463-43241485 GAGGTAAGCCTGCAGCCTGCTGG + Intergenic
1173617908 20:44414704-44414726 CGGGGCAGCCAGGGGGCTGCTGG + Intronic
1173667436 20:44772871-44772893 GAGGGAGGCCAGGAGAAGGCCGG - Intronic
1173684982 20:44916888-44916910 GAGGGAGGGGCGGAGGCTGCAGG + Intronic
1174050560 20:47764577-47764599 GAGGGAGTCCTGGAGGCTGGAGG + Intronic
1174189064 20:48727389-48727411 GAGAGAGGCAAGGGGGCTGCAGG - Intronic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1174413856 20:50353893-50353915 CAGGGAGGCCAGGTGACTGCGGG + Intergenic
1174520581 20:51127239-51127261 GAAGGCAGCCAGGATGATGCAGG + Intergenic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175310873 20:58010929-58010951 GAGGGACGGCTGAAGGCTGCAGG - Intergenic
1175985897 20:62764041-62764063 GGGGGCAGCCAGGTGGCAGCAGG + Intergenic
1176297040 21:5079281-5079303 GACGGAAGCCAGAAACCTGCTGG + Intergenic
1176591410 21:8653951-8653973 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1177296395 21:19181779-19181801 CAGGGAACCCAGGAGGGTGCTGG - Intergenic
1178358566 21:31929669-31929691 GAGAAAAGCCACGGGGCTGCAGG + Intronic
1178454244 21:32732554-32732576 GAGGGGAGCCTGGAGGAGGCTGG - Intergenic
1179233496 21:39525922-39525944 GCGGGAAGTCAGCAGCCTGCTGG + Intergenic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179859988 21:44182666-44182688 GACGGAAGCCAGAAACCTGCTGG - Intergenic
1180039896 21:45270519-45270541 GTGGACAGCCAGGAGGTTGCAGG - Intronic
1180042784 21:45288479-45288501 GGGGGCACCCAGGAGGCCGCAGG - Intergenic
1180216323 21:46325332-46325354 AAGGGGAGCCCGGAGCCTGCAGG + Intronic
1180274258 22:10631062-10631084 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1181165555 22:20981157-20981179 GAGGGGAGCCAGGTGGCTGAAGG - Exonic
1181177562 22:21046241-21046263 AAGGGAAGGCAGGGGGCTGGAGG - Intronic
1181293806 22:21818929-21818951 GAGGGGAGGCTGAAGGCTGCAGG + Intronic
1181355964 22:22295843-22295865 GAGGCAAGCCAGTGGGCCGCAGG + Intergenic
1181466218 22:23112110-23112132 GGGTGAAGACAGGAGGCTGAGGG - Intronic
1181487688 22:23241829-23241851 GAGGGGAGCCTAGAGGCTGCAGG - Intronic
1181521650 22:23451884-23451906 GTGGGAAGCCTGGGGGCTCCGGG + Intergenic
1181796132 22:25312370-25312392 CAAGGAGGCCAGGGGGCTGCAGG + Intergenic
1181836678 22:25615980-25616002 CAAGGAGGCCAGGGGGCTGCAGG + Intronic
1181978752 22:26751512-26751534 CAGGGAAGCGGGGTGGCTGCTGG + Intergenic
1182098422 22:27641455-27641477 GGGGGTAGCCAGGAGTCTACTGG - Intergenic
1182302631 22:29346218-29346240 GAGGTAAGCCAAGAGTCTGGTGG - Intronic
1182567913 22:31213276-31213298 TGGGGAAGGCAGGAAGCTGCAGG - Intronic
1183092903 22:35535625-35535647 AAGGAAAGCTAGGAGCCTGCTGG + Intergenic
1183421439 22:37713826-37713848 GAGGAAAGGGAGCAGGCTGCGGG + Intronic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183541027 22:38429562-38429584 GAAGGAAGGCAGGAGGGTGATGG - Intronic
1183585566 22:38751117-38751139 GAGGGAATCCCGGGGACTGCAGG + Intronic
1183599059 22:38829569-38829591 GGGGGAATCCAGGAGGATGGTGG - Intronic
1183688600 22:39375837-39375859 GAGGGAAGCCAGCCAGATGCAGG - Intronic
1183751491 22:39723591-39723613 GAGGGAGGGCAGGAGGCAGAAGG - Intergenic
1183784171 22:40019764-40019786 TAGTGAAGACAGGAGCCTGCAGG + Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184037674 22:41926352-41926374 GAGGGAGGCCAGGGGGCCGAGGG + Intronic
1184168385 22:42743846-42743868 GAGGGAAGCCAGGAAGTGGCGGG + Intergenic
1184388073 22:44187571-44187593 GAGAGAAGCAGGGAGTCTGCAGG + Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1184865144 22:47198100-47198122 GAAGGAGGCCAGCAGGCTCCGGG - Intergenic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
1185082148 22:48715448-48715470 CAGGGAGGCGAGGAGGCTGGGGG + Intronic
1185235396 22:49709470-49709492 AAGGGAAGCCAGGAAGGGGCTGG + Intergenic
1185295276 22:50049950-50049972 CAGGGAGGCCAGGAGGGTGATGG + Intronic
1185316698 22:50182418-50182440 GCGGGATGCCGGGTGGCTGCTGG - Intergenic
949276587 3:2290273-2290295 GGGGGAAGCCAGGTGGATCCTGG + Intronic
950113845 3:10438037-10438059 GCAGGGAGCCAGGAGGTTGCAGG + Intronic
950122377 3:10490134-10490156 GGAGGAAGCCAGGGGGATGCAGG - Intronic
950163189 3:10775033-10775055 CAGGGAAGCCGGGTGGCTGGGGG + Intergenic
950639467 3:14339558-14339580 TAGGGAAGCCAGGGGGCAGTGGG + Intergenic
950647441 3:14385686-14385708 GAGGAATGGCAGGAGGCTGAAGG - Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950790679 3:15469305-15469327 GAAGGAAGCCAGGAAGCTTCTGG + Intronic
950907491 3:16552423-16552445 CAGAGAAGCCTGGAGGCTTCAGG - Intergenic
951227881 3:20142267-20142289 GAGGGAAGGCTGGAGGCAGAGGG - Intronic
953036647 3:39217347-39217369 GAGGCAAACCAGGAGAGTGCAGG - Intergenic
953174523 3:40537724-40537746 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
953340590 3:42131191-42131213 GAGGGGAGACAGGAGCCTCCAGG - Intronic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954139779 3:48598896-48598918 GTGGGAAGGCAGGAGGATCCAGG + Intergenic
954713036 3:52514330-52514352 GAGAGAACCCAGGGGACTGCAGG - Intronic
954993067 3:54857569-54857591 GAGGGCAGCCAACAGGGTGCAGG - Intronic
955148888 3:56347400-56347422 GAGGAAAGCTGGGAGGCTGGAGG + Intronic
955538706 3:59951794-59951816 GAGGTGAGCCAGGAGAATGCTGG - Intronic
958644268 3:96849520-96849542 GTGGGAAACCAGGAGAATGCAGG + Intronic
959977926 3:112482956-112482978 AAGGGAAGTTAGGAGGCTGAGGG - Intronic
960963690 3:123090137-123090159 CAGGGATGCCTGGAGGATGCAGG - Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961423696 3:126828462-126828484 GAGGGAACACGGGAGGCTCCCGG + Intronic
961554594 3:127689366-127689388 GAGGGAAGCTGGGTCGCTGCTGG + Exonic
961592326 3:127990324-127990346 GAGGGCAGACGCGAGGCTGCAGG - Intergenic
961656854 3:128447407-128447429 GAAGGAAGTGAGGAGGCTGATGG - Intergenic
961749265 3:129085948-129085970 CAGGGAAGCCAGGAGGCAGGGGG - Intergenic
961756132 3:129128337-129128359 CAGGGAAGCCAGGAGGCAGGGGG + Intronic
962240940 3:133750416-133750438 GAGGGAAGCCAGGCTGCATCTGG - Intronic
963049333 3:141128084-141128106 CAGGGAAACCTGGAGGCCGCAGG - Intronic
963604786 3:147405050-147405072 GAGGGGAGCCAGAAAGGTGCAGG - Intronic
964678000 3:159305087-159305109 GAGGCAGGACAGGGGGCTGCTGG - Intronic
966592725 3:181699652-181699674 GGGTGAAGGCAGGAGGCTGATGG + Intergenic
966724673 3:183099065-183099087 GAGGGGAGCCTGGAGGATGGCGG + Intronic
967270610 3:187729318-187729340 GAGGGGAGCCAGAAGCCTGGAGG + Exonic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
968454472 4:689909-689931 GGGGGAACCCAAGAGGCTCCAGG + Intergenic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
968728327 4:2258485-2258507 CAGGGAAGGCAGGTGGCTGGTGG - Intronic
968859427 4:3154646-3154668 GCTGGAAGCCTGGAGGCTGTAGG - Intronic
968919976 4:3517473-3517495 GAGTGAGGCCAGCAGGCTTCTGG + Intronic
969032611 4:4226770-4226792 GAGGGAGGCGAGCAGGCCGCTGG + Exonic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969120275 4:4903521-4903543 CAGGGAAGCCAAGGGGTTGCTGG + Intergenic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969182642 4:5454028-5454050 GAGGGAATCTATGGGGCTGCTGG - Intronic
969491473 4:7501533-7501555 GTGCTAAGCCAGGAGGCTGAGGG - Intronic
969518367 4:7661404-7661426 CAGGGAGGCCACGTGGCTGCAGG + Intronic
970152549 4:13104970-13104992 GAGGTAAGACAGGAGGATCCTGG + Intergenic
970441172 4:16082625-16082647 GCGGGAAGCCAAGAGACTCCAGG + Intronic
971216608 4:24667890-24667912 GAGTGCAGCCAGGAGGCACCCGG + Intergenic
972305178 4:37823977-37823999 GAGAGATGTCATGAGGCTGCAGG - Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975760631 4:77616326-77616348 GAGGGAAGTCAGGGGGGTGGGGG - Intergenic
975800974 4:78058717-78058739 GAGGAAAACCAGGAGGCGGAGGG - Intronic
976541089 4:86277284-86277306 GAGAGAAGCCATTAGGCAGCAGG - Intronic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
977974321 4:103246004-103246026 GTGGGAAGGCAGCAGGCTGTAGG + Intergenic
978061410 4:104344783-104344805 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
978370804 4:108027934-108027956 CAGGGAAGCCAGGAGGCCCTGGG - Intronic
979668792 4:123340987-123341009 TAGGAAAACCAGGATGCTGCTGG + Intergenic
980189425 4:129504449-129504471 GAGGTAAGCAAAGAGGCTGCAGG + Intergenic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
981147635 4:141343614-141343636 GAGGGAAGCCAGGATGCAGGTGG + Intergenic
981312151 4:143307787-143307809 GTGGGAAGACAGAAGGCTCCAGG - Intergenic
981822436 4:148901539-148901561 GAAGGAAGCAGGGAGGCTGTAGG - Intergenic
984041752 4:174743968-174743990 CAGGCAAGCCAGAGGGCTGCCGG + Intronic
984739786 4:183149961-183149983 TAGGGTACCCAGGAGGCTTCTGG + Intronic
984864787 4:184272195-184272217 GAGGGAAGCCAGAGGGTTGAGGG - Intergenic
984865278 4:184275489-184275511 GGCAGAAGTCAGGAGGCTGCGGG - Intergenic
985521913 5:377740-377762 CTGGGAAGCCTGGAGCCTGCGGG + Intronic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985759191 5:1736254-1736276 GGGGGAAGCCGGGTGGCTGCAGG - Intergenic
985783194 5:1881445-1881467 GAGGGAGGCCAGGAGCCTGAAGG + Intronic
985892560 5:2726950-2726972 GGAGGTAGGCAGGAGGCTGCCGG - Intergenic
985904542 5:2823201-2823223 GAGGCAAGCCAGGGGCCTGCTGG + Intergenic
986010443 5:3709854-3709876 GAGGAAAGACAGGAGGGGGCCGG - Intergenic
986152427 5:5140096-5140118 GAGGGAAGGCGGGAGACAGCGGG - Intergenic
987377434 5:17249258-17249280 GATGAAAGCAAGAAGGCTGCAGG - Intronic
988792313 5:34620015-34620037 GAGGGCAGGGAAGAGGCTGCTGG + Intergenic
988943677 5:36172173-36172195 GGCGGAAGCCAGGATGCTGGTGG + Intronic
989351137 5:40488010-40488032 GATGGAACCAAGGGGGCTGCAGG - Intergenic
990338245 5:54796052-54796074 GAGAGAAGCCAGGTGACTGCTGG - Intergenic
990449692 5:55923191-55923213 CAGGGAAGCCTGGTGGCTGTGGG + Intergenic
990880130 5:60529966-60529988 CAGGGAGGCCAGGAGGCTCAGGG + Intergenic
991299859 5:65119825-65119847 GAGGGAAGGAAGGAGGTAGCAGG - Intergenic
991442937 5:66669997-66670019 CTGGGAAGCCAGGTGACTGCTGG + Intronic
991447730 5:66717897-66717919 GAGGGAAGGAAGGAGGCCGTGGG + Intronic
992083804 5:73259971-73259993 TAGGGAAGCCAGTAAGCTGAGGG + Intergenic
992700208 5:79334320-79334342 GAGGGCAGCCAGGAGTCTCACGG - Intergenic
995468078 5:112471232-112471254 GTGGGTAGCCATGAGGCTGGAGG - Intergenic
995478957 5:112576378-112576400 AAGGCAAGCCAGGAGGCTGCTGG + Intergenic
996843652 5:127875966-127875988 GAAGGAAGGCAGGTGCCTGCAGG + Intergenic
997246366 5:132353127-132353149 GAGAGAAGCCAGGACTGTGCTGG - Intergenic
997699316 5:135885354-135885376 CAGGGAAGCCTGGAGGGTGTTGG - Intronic
997721408 5:136080813-136080835 GAGGGGAGGCAGGAGGGTGCGGG + Intergenic
998364208 5:141618572-141618594 GAGGGAAGCCCCGAGGTGGCCGG + Intronic
998950430 5:147388372-147388394 GTGGGCAGCCAGCAAGCTGCTGG + Intergenic
1000104281 5:158044053-158044075 GAAGGAAGTCAGTAGGATGCAGG + Intergenic
1000649229 5:163795620-163795642 GAAGAAAGTCAGGATGCTGCAGG - Intergenic
1000885875 5:166746718-166746740 GTGGGTAGCCAGGAGGGAGCAGG - Intergenic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1001780226 5:174361840-174361862 GGGGCAGGCCAGGAGGCTGTGGG + Intergenic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1001849281 5:174949761-174949783 CTGGGAGGCCAGGAGGATGCAGG + Intergenic
1002181926 5:177435142-177435164 GAGGGAACCCAGGAGGCTAGTGG - Intronic
1002465720 5:179407478-179407500 GAGGGAATCCAGAAGCCTTCAGG - Intergenic
1002474091 5:179454116-179454138 GAGAGATGCCAGCAGGCAGCTGG - Intergenic
1002553829 5:180018838-180018860 GAGGGAAGCCAAGAGGGTGAGGG - Intronic
1003121421 6:3321880-3321902 GAGGGAAGACAGGGGCCTGCTGG + Intronic
1003203624 6:3987303-3987325 GAGGAAAGCCAGGATGCAGGAGG - Intergenic
1003424589 6:5989594-5989616 GAGGCCAGCCAGGAGGAAGCTGG + Intergenic
1004458089 6:15810192-15810214 GAGGGAAACAGGGAGGCAGCTGG + Intergenic
1005109864 6:22268881-22268903 GAGGTGAGCCAGGAGGGTGAGGG + Intergenic
1005824075 6:29622013-29622035 GAGGAAAGCCAGGCGGGGGCAGG - Intronic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1006255537 6:32829503-32829525 AAGGGAAGCCAGCTGGCTGCGGG - Exonic
1006296176 6:33171061-33171083 GAGGGAGGACCAGAGGCTGCTGG + Intronic
1006375622 6:33670269-33670291 GATGGCAGCCGGGAGGCTGCTGG - Intronic
1006595630 6:35191070-35191092 GGGGAAAGCCAGAAGGCAGCAGG + Intergenic
1007072862 6:39049287-39049309 GAGGGAGTCCGGGAGGATGCCGG - Intronic
1007227000 6:40322020-40322042 GATGGAAGCGGGGAGGCTGAAGG + Intergenic
1007237561 6:40401779-40401801 GAGGGGAGGCTGGAGGCTGGAGG - Intronic
1007398878 6:41592382-41592404 GAGAGAAGCTGGGAGGCTGTTGG + Intronic
1007967453 6:46015740-46015762 GAGCGAAGCCGGGAGGAGGCGGG + Intronic
1009508036 6:64510905-64510927 GTGGGAAGCCAAGTGGCTGTTGG - Intronic
1009684273 6:66936336-66936358 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
1011488599 6:87868585-87868607 GAAGGAATCCAGGAGGTTGGTGG - Intergenic
1012523651 6:100151043-100151065 GAGGAAAACCTGGAGGATGCTGG + Intergenic
1013619457 6:111873468-111873490 GAGGGGAGCGAGGAGGGGGCGGG + Intergenic
1013667514 6:112363542-112363564 AAAGGAAGCCAGGACGCTGTTGG - Intergenic
1014982857 6:127966008-127966030 GAGTGAAGCTAGAAGGCGGCTGG - Intergenic
1016322135 6:142857852-142857874 GGGGGAAGCCACGGGGCTGCGGG + Intronic
1016753686 6:147660395-147660417 TAGGGAAGCAGGGTGGCTGCAGG - Intronic
1016981711 6:149860733-149860755 TAGGGAAGGCGGGAGGATGCAGG - Intronic
1017017437 6:150113206-150113228 GGGGGAAGAAAGGAGGCTGGGGG - Intergenic
1017526664 6:155247122-155247144 GAGTGAAGGCTGTAGGCTGCAGG + Intronic
1018031531 6:159845372-159845394 GGCTGGAGCCAGGAGGCTGCAGG - Intergenic
1018188291 6:161286924-161286946 GGGAGCACCCAGGAGGCTGCGGG + Intergenic
1018613664 6:165664645-165664667 GCGTCAAGCCGGGAGGCTGCCGG - Intronic
1018725771 6:166612457-166612479 GAGGGGAGCCAGGGGTCTGCAGG - Intronic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1018910997 6:168101017-168101039 GAGGGCAGACAGGAGGCTAGGGG + Intergenic
1018945642 6:168345697-168345719 GAGGGAAGCTTGGGGGCAGCCGG + Intergenic
1018945714 6:168345856-168345878 GGGGGAAGCCGGGGGGCAGCCGG + Intergenic
1018945735 6:168345898-168345920 GGGGGAAGCCGGGGGGCAGCCGG + Intergenic
1018945759 6:168345951-168345973 GGGGGAAGCCGGGGGGCAGCCGG + Intergenic
1018945779 6:168345993-168346015 GGGGGAAGCCGGGGGGCAGCCGG + Intergenic
1019112077 6:169724461-169724483 GTGGGGAGCCAGGCGGCGGCGGG - Intronic
1019140172 6:169937863-169937885 CAGGGCAGGCAGGAGGCTTCAGG - Intergenic
1019338598 7:496706-496728 CAGGGCAGCCTGGAGGCTGGAGG - Intergenic
1019589687 7:1824599-1824621 GTGGGAAGCCTGGGGGCTCCGGG - Intronic
1019898291 7:4000051-4000073 GAAGGAAAGCAGGAGGCTGAGGG + Intronic
1019912206 7:4107310-4107332 CCCGGAAGGCAGGAGGCTGCCGG + Intronic
1020106387 7:5424056-5424078 GAGGGGAGCCTGGAAACTGCTGG - Intronic
1022519611 7:30997670-30997692 CAGGGAAGCCCGGGGGCTGTGGG + Intergenic
1023220391 7:37916050-37916072 GAGGGAGGCGAGGAGGCGCCCGG - Intronic
1023649269 7:42351605-42351627 GCGTGAACACAGGAGGCTGCTGG + Intergenic
1023759431 7:43450222-43450244 GAGGGGAGCCAAGGGGCTGAGGG - Intronic
1023842351 7:44104551-44104573 GAGGGAATCCAGGAAGGGGCGGG - Exonic
1024198416 7:47082500-47082522 TGAGGAAGCAAGGAGGCTGCAGG + Intergenic
1024584056 7:50825725-50825747 GAGTGAAAGCAGGAGGCTGAAGG + Intergenic
1025268249 7:57485350-57485372 CAGGCAAGCCCTGAGGCTGCGGG - Intergenic
1025280295 7:57621905-57621927 GCTGGAAACCAGGGGGCTGCTGG - Intergenic
1025301538 7:57822385-57822407 CAGGCAAGCCCTGAGGCTGCGGG - Intergenic
1025302185 7:57826691-57826713 GAGACAAGCCAGAGGGCTGCAGG + Intergenic
1025304438 7:57843596-57843618 GCTGGAAACCAGGGGGCTGCTGG + Intergenic
1026590163 7:71687442-71687464 TCTGGAAGCCAAGAGGCTGCTGG - Intronic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1027596093 7:80176280-80176302 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1028444418 7:90904041-90904063 AATGGAAGCCAGCAGGCTGCAGG - Intronic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1029736654 7:102469116-102469138 GAGGGGAGCGTGGAGGCTACTGG - Intronic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1031836797 7:126689175-126689197 GTGGGAGGCCAAGAGGCTTCAGG + Intronic
1032075428 7:128833632-128833654 GCAGGAAGCCTTGAGGCTGCAGG - Intronic
1032284204 7:130528566-130528588 GAGAGAATGCAGGAGGGTGCAGG + Intronic
1032781901 7:135170533-135170555 CAGGGAAGCCAGTAGCCGGCCGG - Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1034191345 7:149215745-149215767 GGGGGAAGCCAGGAAACTGGTGG + Intronic
1034491447 7:151395181-151395203 GACGGAGCCCAGGAGGCTGCCGG + Intronic
1034951025 7:155297455-155297477 GAGGGGAGCCAGGAGCCGGGAGG + Intergenic
1035073013 7:156158592-156158614 GCGAGAAGACAGAAGGCTGCAGG - Intergenic
1035105559 7:156439561-156439583 GAGCGGACCCAGGAGGCTGGAGG - Intergenic
1035154456 7:156900761-156900783 GAGTGAAGCCAGGATGGTGAGGG - Intergenic
1035290449 7:157834690-157834712 AGGGGAAGCCACGGGGCTGCGGG + Intronic
1035323566 7:158050568-158050590 GAGGGAAGCCGGGAGGCTGTGGG - Intronic
1035422545 7:158741624-158741646 TGGGGAGGCCAGGAGGCTGGAGG + Exonic
1036181147 8:6586414-6586436 CAGGGAAGCGTGGAGGCTGGAGG - Intronic
1037816298 8:22114551-22114573 GAGCGCCACCAGGAGGCTGCGGG + Exonic
1037910165 8:22739553-22739575 GATGGATGCTAGGGGGCTGCTGG - Intronic
1037916340 8:22775519-22775541 GGGGGAAGCCAGCTGGCTGTGGG + Intronic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1039006967 8:33050370-33050392 GAGGGCAATCAGGAAGCTGCAGG - Intergenic
1039273274 8:35906657-35906679 GAGGGGAGCCAGGACACAGCTGG - Intergenic
1039485086 8:37903951-37903973 GTGGGGAGCCAGGGGCCTGCAGG - Intergenic
1039579367 8:38651228-38651250 GAGGGAGGCCAGGAGGAGGCCGG - Intergenic
1039845262 8:41321438-41321460 GAGGGCAGCCTGGAGGCTAGGGG - Intergenic
1040286157 8:46101455-46101477 GAGGGAAGCAGCGAGACTGCAGG - Intergenic
1040300784 8:46186954-46186976 GGGACAAGCCAGGAGGCTTCTGG + Intergenic
1040301046 8:46188195-46188217 GGGGGAAACCACGAGACTGCAGG - Intergenic
1040330942 8:46385473-46385495 GGGAGAAGTCACGAGGCTGCAGG + Intergenic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1040935991 8:52782706-52782728 TAAGGAAGCCAGGCTGCTGCTGG - Intergenic
1040939179 8:52815370-52815392 AAGGGAAGCCTGCATGCTGCAGG + Intergenic
1044513733 8:93114289-93114311 GAGGAAATCCAGGAGGAAGCAGG - Intergenic
1044582713 8:93838048-93838070 TAGGGAAGTGAGGAGGCTGTGGG - Intergenic
1044999650 8:97868868-97868890 GAGTGGAGCCAGGTGGCAGCAGG + Intronic
1045761138 8:105609249-105609271 GAGGCAAGCCAGGAGCATGGAGG + Intronic
1046446778 8:114331470-114331492 GAGGAAAGCCAGGAGGATTTAGG - Intergenic
1047502412 8:125452398-125452420 GAGGGAAGCCAGGAGTCCTTGGG + Intergenic
1047755360 8:127913945-127913967 GTGTGAGGCCAGGGGGCTGCTGG - Intergenic
1047993747 8:130313931-130313953 GAGGGAAGCCAGCAGTCTGCAGG - Intronic
1048747233 8:137627588-137627610 GAGGGAGGCCAGGGGACTGCAGG - Intergenic
1048752492 8:137696021-137696043 GAGGGAGGCAAGGAGGTTTCTGG - Intergenic
1049219895 8:141424391-141424413 GATGGCAGCCAGGAGGAAGCTGG - Intronic
1049297866 8:141852768-141852790 GAAGGAAGCCAGGAAGCGGGCGG + Intergenic
1049347300 8:142145810-142145832 GAGGGAACTCTGGAGGCCGCTGG - Intergenic
1049347843 8:142148175-142148197 GAGGCAAAGCGGGAGGCTGCAGG + Intergenic
1049376884 8:142293616-142293638 GAGGGAAGCCTGCAGGCCTCAGG - Intronic
1049421055 8:142516918-142516940 CAGGGAAGTCAGGTGGCTGAAGG - Intronic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049765025 8:144351175-144351197 GGGAAAGGCCAGGAGGCTGCAGG - Intergenic
1051158662 9:14180847-14180869 TAGGCAAGCAAAGAGGCTGCTGG - Intronic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1051707440 9:19895659-19895681 GAAGGAAGGCAGGAGCCTGCAGG - Intergenic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1053690784 9:40586610-40586632 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1054274020 9:63050881-63050903 GAGGCAAGCCAGTGGGCCGCAGG + Intergenic
1054302042 9:63387581-63387603 GAGGCAAGCCAGTGGGCTGCAGG - Intergenic
1054400820 9:64714087-64714109 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1054434427 9:65198401-65198423 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1054458478 9:65449396-65449418 GAAGGAACCCAGGAAGCTTCTGG + Intergenic
1054495963 9:65823280-65823302 GAGGCAAGCCAGTGGGCCGCAGG + Intergenic
1054982276 9:71220854-71220876 GTGGGAGCCCAGGAGGCTGTTGG - Intronic
1055807361 9:80111441-80111463 GAGAGAAGTGAGGAAGCTGCAGG - Intergenic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1057081986 9:92180085-92180107 AAGGGAAGGCAGGAGGCAGAAGG + Intergenic
1057215112 9:93223689-93223711 AAGGGCAGGCAGGAGCCTGCTGG + Intronic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1057994832 9:99811729-99811751 GAGGAAAGCAGGGAGGCAGCAGG + Intergenic
1058765604 9:108180102-108180124 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG + Exonic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1059352268 9:113673832-113673854 TAGGGAAGCCCGCAGCCTGCGGG - Intergenic
1060020831 9:120129742-120129764 GGTGTACGCCAGGAGGCTGCAGG - Intergenic
1060423819 9:123488252-123488274 GAGGGAGGCTCGGAGGCAGCTGG - Intronic
1060529071 9:124337329-124337351 GAGGGAAGCCAGAGGGCTTCAGG - Intronic
1060827351 9:126694740-126694762 GGGGGAAGCGAGGAAGCAGCAGG - Intronic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061281813 9:129601957-129601979 GAGGGGAGCCAAGAGGCTCTGGG + Intergenic
1061486038 9:130920961-130920983 GTGGGAGGCCTGGAGGCTGCTGG + Intronic
1061627277 9:131848494-131848516 GAGGGAAGGCAGGCTGCCGCTGG + Intergenic
1061673217 9:132201002-132201024 AAGACAAGCCAGGAGCCTGCAGG - Intronic
1061711875 9:132493554-132493576 GGGGGAGGGCAGCAGGCTGCAGG + Intronic
1061884321 9:133583991-133584013 GAGGGGAGGCAGGAGGGTGGAGG - Intronic
1062174143 9:135151645-135151667 GAGGGCGGCCTGGAGGCTGGGGG - Intergenic
1062361579 9:136190755-136190777 CAGGGAAGCCCTGGGGCTGCAGG + Intergenic
1062413909 9:136438631-136438653 GATGGGCGCCAGGAGGCTGAAGG + Exonic
1062425855 9:136505890-136505912 GAGGGAAGACAGGACGGTGTCGG + Intronic
1062439763 9:136564457-136564479 GGGGCAAGGCAGGAGGCTGCGGG - Intergenic
1062480592 9:136749111-136749133 GAGGGGAGGCAGGAGGCAGCAGG - Intergenic
1062596600 9:137302480-137302502 GGGGGAGGCCAGGTGGCCGCCGG + Intergenic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1203621438 Un_KI270749v1:132715-132737 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1185569560 X:1123205-1123227 AAGGAAATCCAGAAGGCTGCCGG - Intergenic
1185959949 X:4538558-4538580 ATGGGAGGCCAGGGGGCTGCGGG + Intergenic
1186389422 X:9143993-9144015 GAAGGAAGGCAGGAGGCTCCCGG - Intronic
1186407393 X:9316189-9316211 GACAGAAGCCAGGAGGCTGTGGG + Intergenic
1186429242 X:9490286-9490308 GATGGAATCAAGGAAGCTGCAGG - Intronic
1186918485 X:14249561-14249583 GAGAGAAGCCAGGAGCATGCAGG - Intergenic
1187275568 X:17813961-17813983 GAGTGAAGAGAGGAGGCTGTTGG + Intronic
1187480291 X:19648869-19648891 GAGGGAAGCTGGAAGGCTGACGG - Intronic
1189337951 X:40182216-40182238 GAGGTGAGCCAGGAAGCAGCAGG - Intergenic
1192152252 X:68719517-68719539 GAGATATGCCAGGAGGCTGGAGG + Intronic
1192167369 X:68834436-68834458 CAGGGAAGCCAGGAGAGTCCTGG - Intronic
1193601157 X:83509413-83509435 GGAGGAAGCGAGGAGGCGGCCGG + Exonic
1194783911 X:98058311-98058333 AAGGGCAGCCAAGAGACTGCTGG - Intergenic
1198542710 X:137657017-137657039 ATGGGAAGGCAGGAGGGTGCTGG + Intergenic
1199819299 X:151428823-151428845 AAGAGTAGCCAGGAGGCTCCTGG - Intergenic
1200179059 X:154139342-154139364 AAAGGAAGACAGGAGGGTGCGGG - Intergenic
1200373651 X:155756151-155756173 AAGGGAGGCCAGCATGCTGCAGG - Intergenic
1201180039 Y:11334108-11334130 GGGGGCAGCTGGGAGGCTGCAGG - Intergenic
1201487285 Y:14507085-14507107 GAGGGAAGCCATGCAGCTCCAGG + Intergenic
1201564698 Y:15353894-15353916 CAGGGAAGCCTGGAGTCTCCAGG + Intergenic
1202273817 Y:23095659-23095681 AAGGGAAGCCTGGAGGCTTCAGG - Intergenic
1202292209 Y:23325018-23325040 AAGGGAAGCCTGGAGGCTTCAGG + Intergenic
1202426813 Y:24729404-24729426 AAGGGAAGCCTGGAGGCTTCAGG - Intergenic
1202443978 Y:24940690-24940712 AAGGGAAGCCTGGAGGCTTCAGG + Intergenic
1202584158 Y:26406665-26406687 GAGGCAAGCCAGTGGGTTGCAGG + Intergenic