ID: 933666712

View in Genome Browser
Species Human (GRCh38)
Location 2:84970826-84970848
Sequence TACGCGCGGCGCGGCGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933666703_933666712 -1 Left 933666703 2:84970804-84970826 CCGGGCATTTCCTCTTCCTCCCT 0: 1
1: 0
2: 7
3: 100
4: 883
Right 933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 44
4: 327
933666697_933666712 27 Left 933666697 2:84970776-84970798 CCGCGCCGGTGAGCAGCGGGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 44
4: 327
933666699_933666712 22 Left 933666699 2:84970781-84970803 CCGGTGAGCAGCGGGAGCCGGCG 0: 1
1: 0
2: 9
3: 49
4: 313
Right 933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 44
4: 327
933666702_933666712 5 Left 933666702 2:84970798-84970820 CCGGCGCCGGGCATTTCCTCTTC 0: 1
1: 0
2: 1
3: 5
4: 117
Right 933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 44
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933666712 Original CRISPR TACGCGCGGCGCGGCGGCGG CGG Intergenic
900237479 1:1599707-1599729 CACGCGGCGCGCGGCGGCCGGGG + Exonic
900307791 1:2019506-2019528 TCCGCGCGGCGCGGGGTCGGGGG + Intronic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
901022177 1:6261043-6261065 TGAGCGAAGCGCGGCGGCGGCGG - Intergenic
901050698 1:6424663-6424685 TCCCCGCGTCGCGGCGGGGGCGG + Intronic
901629022 1:10639239-10639261 CTCGCGCGGCCCGGGGGCGGCGG + Exonic
902823256 1:18956265-18956287 TGCCCGCCGGGCGGCGGCGGCGG - Exonic
903072200 1:20732054-20732076 CAGGCGCGGGGCTGCGGCGGCGG - Intronic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
903324738 1:22563446-22563468 CCCGCCCGGGGCGGCGGCGGCGG + Intergenic
903501013 1:23800277-23800299 CAGGCGCGGGGCGGGGGCGGGGG - Intronic
903526622 1:23995652-23995674 TTCTCGGGGCGCGGGGGCGGGGG + Intergenic
904500203 1:30908792-30908814 TGGGGGCGGCCCGGCGGCGGCGG - Intergenic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
905107559 1:35573539-35573561 GGCGCGAGGCGTGGCGGCGGCGG - Exonic
905414386 1:37794396-37794418 TCCGCGGTGCGGGGCGGCGGCGG - Exonic
905449166 1:38046232-38046254 TACCCGGGGGGCGGCGGCGGCGG - Exonic
906214605 1:44031420-44031442 TGCGAGCGGCGCGGCGGGGCGGG - Intronic
910251205 1:85200950-85200972 GGCGCGCGGCGGGGCGGCAGGGG - Exonic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
911527541 1:99004752-99004774 CACCGGGGGCGCGGCGGCGGAGG + Exonic
912993508 1:114511229-114511251 AACGCGCGACGCGAGGGCGGGGG - Intergenic
918064406 1:181089553-181089575 GAAGCGCTGCGCGGCGGGGGTGG + Exonic
921172100 1:212558982-212559004 TGCGCGCGGCCCGGCGGGGGCGG + Intergenic
921432766 1:215082941-215082963 ACGGCGCGGCGCGGGGGCGGTGG - Intronic
921432791 1:215082995-215083017 TGAGCGCGTGGCGGCGGCGGCGG + Intronic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
922851165 1:228735335-228735357 GGCGCGCGGCGCGCAGGCGGGGG + Exonic
924957677 1:248944959-248944981 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
924957682 1:248944988-248945010 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1063995088 10:11611518-11611540 GCGGCGCGGCGCGGCGGCGGCGG + Intronic
1065712863 10:28533638-28533660 TTCGGGCCGGGCGGCGGCGGGGG + Intronic
1066080713 10:31928544-31928566 TGCGGGAGGCGCGGCGGCGGCGG - Intronic
1066464552 10:35640906-35640928 TGCTCGCCGGGCGGCGGCGGCGG + Exonic
1068989128 10:63133286-63133308 GGCCCGCGGCGCGGCGCCGGAGG + Exonic
1069019131 10:63465950-63465972 TGGCCGCGGCGCGGTGGCGGCGG - Intergenic
1070032612 10:72692191-72692213 TCCTCTCGGGGCGGCGGCGGCGG + Exonic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1071695290 10:87863512-87863534 GGCTCCCGGCGCGGCGGCGGAGG + Exonic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1072915485 10:99535284-99535306 GCCACGCGGCGCGGCGGCGGCGG - Exonic
1072915539 10:99535509-99535531 TACCCGGCGGGCGGCGGCGGCGG + Exonic
1073099529 10:100999565-100999587 TCGGCTCGACGCGGCGGCGGCGG - Exonic
1073139166 10:101236483-101236505 TGGGCGCCGCGCGGCGGCGGCGG - Intergenic
1073196440 10:101695150-101695172 TCCTCCCGGGGCGGCGGCGGTGG - Exonic
1074814502 10:117134305-117134327 TGGGCCCGGGGCGGCGGCGGCGG + Exonic
1075048619 10:119165667-119165689 CACGCGCGGCCTGGCGGCGGCGG - Exonic
1075748534 10:124744410-124744432 GACTCGCGGCGCGCCGCCGGCGG + Intronic
1075999787 10:126905574-126905596 GGCGAGAGGCGCGGCGGCGGCGG - Intronic
1075999827 10:126905690-126905712 TGCGAGCGGGGCGGCGGCGCGGG - Intronic
1076116967 10:127907451-127907473 TGGGCGCGCCGCGGGGGCGGCGG - Intronic
1077214582 11:1390113-1390135 GACGCGGGGGGCGGCGGCGCGGG + Intronic
1077491496 11:2862906-2862928 GACGCGCGGCGCGGTGGGGGCGG + Intergenic
1079408174 11:20163161-20163183 GCTGCGCGGCGCGGCGGCTGCGG + Intergenic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1081969147 11:47186309-47186331 GACGCGCGGGTAGGCGGCGGCGG - Intronic
1082028690 11:47589842-47589864 GAGGCCCGGCGGGGCGGCGGGGG + Exonic
1083623646 11:64060928-64060950 CATGCGCACCGCGGCGGCGGCGG + Intronic
1083659800 11:64246771-64246793 TCCGCGCGGCTCCGCGGCGAGGG + Exonic
1083883041 11:65557896-65557918 GATGCGCGGGGCGGGGGCGGCGG - Exonic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084526910 11:69703604-69703626 TGCGCGCGGCGGGGCGGGCGGGG + Intronic
1085561097 11:77473669-77473691 CACGGGCAGCGCGGCGGCGGCGG - Exonic
1087014627 11:93543247-93543269 TGGGAGCGGCGCGGCGGCGGCGG - Intronic
1089499888 11:118925728-118925750 CCCGGGCGGCGCGGCGCCGGGGG + Intronic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1090238286 11:125165159-125165181 CAAGCGCGGCGAGGCGGCGGCGG - Intronic
1091823260 12:3491760-3491782 TCGGCGCTGAGCGGCGGCGGCGG - Intronic
1092219123 12:6700759-6700781 GGGGCGCGGGGCGGCGGCGGTGG + Intronic
1092256236 12:6928064-6928086 GCCGGGCGGCGCGGCGGGGGCGG + Intronic
1094041108 12:26122614-26122636 GGGGGGCGGCGCGGCGGCGGCGG - Exonic
1096102975 12:48980528-48980550 TACCGGCGGCGCGGCCCCGGGGG + Exonic
1096502093 12:52070244-52070266 TTCGCGCGTAGTGGCGGCGGGGG + Intronic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG + Exonic
1097648165 12:62260718-62260740 TATCCGGGGAGCGGCGGCGGCGG + Intronic
1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG + Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100632203 12:96400227-96400249 TCCGCGCGGCTCGTCGGCGCGGG - Exonic
1101340891 12:103841175-103841197 GCAGAGCGGCGCGGCGGCGGTGG - Exonic
1101705976 12:107221619-107221641 GGCGGGCGGCGGGGCGGCGGGGG + Intergenic
1101716661 12:107318523-107318545 TGCCCGCGGAGCTGCGGCGGCGG + Exonic
1102453265 12:113056803-113056825 AAAGCTCGGCGCGGCGGCCGAGG + Intronic
1102853962 12:116277522-116277544 TTCGCGCTCCGCGGCGGCGGCGG - Intergenic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1103604792 12:122078726-122078748 AGCGCGCGGCGCGGCGGGAGGGG - Exonic
1106516974 13:30464814-30464836 TGCGGGCGCGGCGGCGGCGGCGG + Intronic
1106517161 13:30465389-30465411 CCGGCGCGGCTCGGCGGCGGCGG - Intronic
1107086903 13:36434827-36434849 TACGCATGGCGCGGGGGGGGGGG - Intronic
1107133547 13:36920423-36920445 AACTCGCGGCGCGGGGGTGGCGG + Intronic
1107467642 13:40665137-40665159 TCCGCCGGGCGCGGCGGGGGAGG - Intronic
1108541988 13:51453351-51453373 CGCGCGCGGGGCGGCCGCGGCGG + Intronic
1112461443 13:99606722-99606744 GGCGCGCGGAGCTGCGGCGGCGG + Exonic
1113541773 13:111115150-111115172 CGTGCGCGGGGCGGCGGCGGCGG - Intronic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1113874219 13:113584680-113584702 TGCGCGCGGCGCGGTGACGTGGG - Intergenic
1113914872 13:113864094-113864116 TGCGCGCGGGGAGGCGGCGGGGG + Intergenic
1113989951 13:114353294-114353316 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989956 13:114353323-114353345 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989961 13:114353352-114353374 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989966 13:114353381-114353403 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1115474485 14:33800384-33800406 TCCCCGCAGGGCGGCGGCGGTGG + Exonic
1118836822 14:69484086-69484108 TGCGCGCTAGGCGGCGGCGGCGG + Intergenic
1121645753 14:95516429-95516451 CGCGCCCGGCGCGGGGGCGGGGG - Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122486763 14:102087146-102087168 TAGGCGCGCGGCCGCGGCGGCGG - Intronic
1122602938 14:102930296-102930318 CCCGCGCGGCGCAGCAGCGGCGG - Exonic
1122602953 14:102930329-102930351 TACGCGGGGCGGGGGCGCGGAGG + Intronic
1122649919 14:103220643-103220665 AACGCGCCGCGAGGCTGCGGGGG - Intergenic
1122690324 14:103529203-103529225 TCCGCGACGCGCGGCGGCGGCGG - Exonic
1122779155 14:104136364-104136386 GGTGCGGGGCGCGGCGGCGGCGG + Intergenic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1126766910 15:52019074-52019096 TGCGCGCGCCGCGGAGGCGGTGG - Intronic
1130115302 15:81000951-81000973 TACGGCCGAGGCGGCGGCGGCGG + Exonic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1130370918 15:83284704-83284726 CACGCGGTGCGCGGCGGGGGCGG - Exonic
1130564497 15:84981974-84981996 TGCGGGCGCTGCGGCGGCGGCGG - Exonic
1131180145 15:90233879-90233901 TGCGCGCGGCGGGGCGATGGGGG - Exonic
1131475385 15:92734218-92734240 GGCGCGCGGCGGGGCGGAGGCGG - Intronic
1132552930 16:560716-560738 GACGCGGGGCGCGGGGGCAGCGG + Intronic
1132719709 16:1309707-1309729 ACCGAGCGGGGCGGCGGCGGCGG - Intronic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1135766222 16:25179854-25179876 TACAGGCGGCGGGGCGGTGGGGG - Intergenic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136399791 16:30011062-30011084 TGCAGCCGGCGCGGCGGCGGGGG + Exonic
1136550491 16:30980008-30980030 TAGGCGCGGGGCGGTGGCGGCGG - Exonic
1137426575 16:48385388-48385410 GACGCGCGAAACGGCGGCGGCGG - Intronic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG + Exonic
1140033849 16:71358606-71358628 GGGGCGCGGCGCGGCGGGGGCGG - Intergenic
1141608500 16:85169022-85169044 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1141840026 16:86568246-86568268 GGCGGGCGGCGCGGCGGCGTAGG - Exonic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1142671950 17:1491572-1491594 TACTCGGGGCGCGGGGACGGCGG - Intronic
1142764327 17:2057102-2057124 CACCTGCGGGGCGGCGGCGGCGG + Exonic
1146058655 17:29593411-29593433 TCCTCGCGAGGCGGCGGCGGCGG - Intronic
1147200644 17:38799422-38799444 CATGCCCGGGGCGGCGGCGGCGG + Exonic
1147307406 17:39573640-39573662 CCGGCGCGGCCCGGCGGCGGCGG - Intergenic
1147719808 17:42532131-42532153 GACGCCCGGCCCGGCGGCGGCGG - Intergenic
1148323720 17:46771752-46771774 GCGGCGCGGCGCGGGGGCGGGGG - Intronic
1148549705 17:48543288-48543310 TGCGCGCTGCGCGGGGCCGGCGG - Exonic
1149626358 17:58083355-58083377 CGCGCGCGGCGGGGGGGCGGGGG + Intergenic
1150003658 17:61456657-61456679 TACCTGCTCCGCGGCGGCGGCGG - Exonic
1150168443 17:62966494-62966516 TCGGCTCGGCTCGGCGGCGGCGG - Intergenic
1150217117 17:63476994-63477016 GAAGCGCGGCGGGGCGGGGGCGG + Intergenic
1150643448 17:66964573-66964595 GACCCGGAGCGCGGCGGCGGCGG + Intergenic
1151153804 17:72110429-72110451 TATGCGCGCGGCGGCGGGGGAGG + Intergenic
1151558689 17:74859874-74859896 CACTCGCGATGCGGCGGCGGCGG + Exonic
1152721882 17:81927473-81927495 TGGGGGCGGCGCGGCGGGGGCGG - Intronic
1156036624 18:32772137-32772159 TCCGAGCCGGGCGGCGGCGGCGG - Exonic
1156213836 18:34976938-34976960 GACTCCCGGAGCGGCGGCGGCGG + Intronic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1156502113 18:37566509-37566531 GGCGGGCGGGGCGGCGGCGGAGG + Intergenic
1157279121 18:46334246-46334268 TCCTCGCGCGGCGGCGGCGGCGG - Exonic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1157464312 18:47930841-47930863 TACCCGCGCGGCCGCGGCGGCGG - Intronic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1160453597 18:78980676-78980698 GGGGGGCGGCGCGGCGGCGGAGG - Intronic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160745393 19:708996-709018 GCTGCGCGGCGCGGGGGCGGCGG - Intergenic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160853551 19:1206055-1206077 TCCGCGGGGCGGCGCGGCGGCGG - Intronic
1160887053 19:1354975-1354997 CCCGCGGGGAGCGGCGGCGGCGG + Intronic
1160930461 19:1567634-1567656 GACGGCCGGGGCGGCGGCGGCGG + Exonic
1160947907 19:1652113-1652135 TTCGCGCGGCGCCGGGGGGGCGG - Intronic
1161207197 19:3047263-3047285 TAAGCGCGGGGCGGCCGCGGCGG + Intronic
1161382153 19:3971092-3971114 CAGGCGCGTCGCGGCGGCAGGGG - Intronic
1161461885 19:4402644-4402666 TACGAGCGCGGCGGCCGCGGCGG + Exonic
1161620111 19:5293189-5293211 GACGCGGGGAGCGGCTGCGGCGG - Intronic
1162372957 19:10289955-10289977 TCCGCGCGGCGCGGCGGGTGGGG - Intergenic
1162959493 19:14117620-14117642 AGCGCGCTGGGCGGCGGCGGCGG + Exonic
1163480890 19:17555701-17555723 GACGCGTGGCGCGATGGCGGCGG + Exonic
1163480899 19:17555727-17555749 CACGCGCGGGCCGGCGGCGCGGG + Exonic
1163655677 19:18543539-18543561 TTCCCGAGGCGCGGCGGCCGCGG - Exonic
1163681167 19:18683525-18683547 GGCGCGCGGCGCGGGGGCGAAGG - Intergenic
1164834787 19:31349966-31349988 TGCGCACGGGGCGGAGGCGGAGG - Intergenic
1165204521 19:34172457-34172479 AAGCCGCGGCGCGGCGGCGGCGG - Intergenic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1166199362 19:41226392-41226414 TCCGGGCGGCGCGGGGGCTGCGG + Intronic
1166358630 19:42242380-42242402 TTCGCGGAGCCCGGCGGCGGAGG - Exonic
1166853411 19:45770925-45770947 AGCGCGGGGCGCGACGGCGGAGG + Intronic
1167134537 19:47609002-47609024 TGGGCGCGGGGCGGCGGCGGGGG + Intronic
1167134644 19:47609449-47609471 TAGGATCGGGGCGGCGGCGGTGG - Intronic
1167633491 19:50639823-50639845 GGCGCGCGGGGCTGCGGCGGCGG - Intronic
1167862542 19:52297128-52297150 TCCGAGCGGGGCGGGGGCGGGGG - Intergenic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
927606608 2:24491650-24491672 CACGAGCCGCGCGGCCGCGGAGG + Intergenic
927751456 2:25673715-25673737 TGGGCGGGGCGCGGCCGCGGGGG - Intergenic
929133504 2:38602166-38602188 GGGTCGCGGCGCGGCGGCGGCGG - Intronic
930136228 2:47906057-47906079 GAGGCGAAGCGCGGCGGCGGCGG + Intergenic
931021198 2:58046833-58046855 TGCGCGCGGCCCGGCGACGGGGG + Intronic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
931602614 2:64019282-64019304 TGGTCGTGGCGCGGCGGCGGCGG - Intergenic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
934079111 2:88452449-88452471 GGCGCCCGGGGCGGCGGCGGTGG + Exonic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
934993288 2:98936219-98936241 TCCGCTCGGCTCGGCGGGGGCGG + Exonic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
937045133 2:118847104-118847126 GGCCCTCGGCGCGGCGGCGGCGG - Exonic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
944579062 2:201116578-201116600 GACGCGGGGCGCGGCGGCGCAGG - Intronic
944743667 2:202635347-202635369 CCCACGCGGAGCGGCGGCGGCGG + Exonic
945225876 2:207530483-207530505 CGCGCCCGGCCCGGCGGCGGCGG - Intronic
945241560 2:207681470-207681492 TCCGCGCGGCTCCGCGGCGAGGG - Intergenic
946248569 2:218400236-218400258 GCCGCCCGGGGCGGCGGCGGCGG - Intronic
947418568 2:229921952-229921974 CCCCAGCGGCGCGGCGGCGGCGG + Exonic
947549751 2:231037760-231037782 GCCGGGCGGCGCGGCGGCAGAGG + Exonic
947992340 2:234497258-234497280 TCTGCGCGGCGCGGCGCGGGAGG - Intergenic
948116034 2:235494631-235494653 GGGGCGCGGGGCGGCGGCGGCGG + Exonic
1169093169 20:2873626-2873648 TCCGAGCCCCGCGGCGGCGGCGG - Intronic
1171473525 20:25390483-25390505 TTCGCGCGGAGCGGGGGGGGGGG - Intronic
1173672892 20:44810365-44810387 GGCGCGCGGCGTGGTGGCGGCGG + Intergenic
1173734305 20:45348481-45348503 TGCGGGCGGCGGGGCGGGGGCGG - Intergenic
1174317485 20:49713827-49713849 TGGGAGCGGCGAGGCGGCGGCGG - Exonic
1175399672 20:58693140-58693162 TGGGCCCGGCCCGGCGGCGGCGG - Intronic
1175429427 20:58891356-58891378 TTGGCTCGGGGCGGCGGCGGGGG + Intronic
1175927039 20:62476045-62476067 AAGGGGCGGCGCGGCGGGGGCGG - Intergenic
1176080986 20:63272924-63272946 AGCGCGCGGCTCGGCGGCGCGGG + Intronic
1176178636 20:63739780-63739802 TCCGGGCGGCGCGGCGCGGGCGG + Intronic
1176201550 20:63863043-63863065 GACGCGGGGCGGGGCGGGGGGGG + Exonic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176550162 21:8217354-8217376 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176550164 21:8217357-8217379 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176569090 21:8400389-8400411 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176569092 21:8400392-8400414 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176577004 21:8444624-8444646 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176577006 21:8444627-8444649 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1178707649 21:34888856-34888878 AGCGCGCGGCGCGGCGGCGGGGG - Intronic
1179603397 21:42496244-42496266 GACGCGGGACGCGGCGGTGGAGG - Exonic
1179674989 21:42974970-42974992 CAGGCCCAGCGCGGCGGCGGCGG - Intronic
1180264139 21:46698846-46698868 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264144 21:46698875-46698897 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264149 21:46698904-46698926 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264154 21:46698933-46698955 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264164 21:46698991-46699013 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264169 21:46699020-46699042 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264174 21:46699049-46699071 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264179 21:46699078-46699100 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264184 21:46699107-46699129 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264189 21:46699136-46699158 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264194 21:46699165-46699187 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264199 21:46699194-46699216 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264204 21:46699223-46699245 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264209 21:46699252-46699274 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264214 21:46699281-46699303 GAGGCGCGGCGCGCCGGCGGAGG - Intergenic
1180960691 22:19761057-19761079 TAGGCGTGCGGCGGCGGCGGCGG - Exonic
1182429058 22:30289544-30289566 CACGGGAGGCGGGGCGGCGGGGG + Exonic
1182475526 22:30574599-30574621 CGGGCGCGGCGCGGCAGCGGCGG - Intergenic
1184164886 22:42721075-42721097 TACTGGCGGCGCGGAGGCCGGGG - Intronic
1185255239 22:49827918-49827940 TCCGCGCGTCATGGCGGCGGCGG - Intergenic
1185417951 22:50720354-50720376 TAGGCGCGGCCCGGCGGGGGCGG - Intergenic
1185430377 22:50807227-50807249 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1203255055 22_KI270733v1_random:133686-133708 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203255057 22_KI270733v1_random:133689-133711 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203263111 22_KI270733v1_random:178765-178787 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203263113 22_KI270733v1_random:178768-178790 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
949970001 3:9396755-9396777 TGCGCGGGGCGCGGGGGTGGCGG - Intergenic
950004483 3:9682939-9682961 TACTCGGGGGGCGGGGGCGGGGG - Intronic
950487781 3:13283018-13283040 AGCGGGCGGCGGGGCGGCGGCGG + Intergenic
952816663 3:37452689-37452711 TGCGCGCGGCTCGGCCGCCGGGG + Intronic
952889165 3:38029544-38029566 GACGGGCGGCGCGGCGGGAGGGG + Intronic
953246515 3:41199135-41199157 AACGCGCGGGGCGGGGGCGTCGG + Intronic
953627239 3:44581024-44581046 CATGGTCGGCGCGGCGGCGGCGG + Intronic
954202099 3:49029497-49029519 TACCCGCCTCGCTGCGGCGGGGG + Intergenic
954763977 3:52897569-52897591 TACGCGCGGCGCGGAGTCGGCGG - Exonic
955387635 3:58492154-58492176 CACTCACTGCGCGGCGGCGGCGG - Intronic
955916480 3:63912634-63912656 GCCGCGCCGCGCGGCGGCGGCGG + Exonic
956813596 3:72888213-72888235 ATGGTGCGGCGCGGCGGCGGCGG - Exonic
961028900 3:123585077-123585099 TACGCGAGGAGAGGGGGCGGAGG + Exonic
961349157 3:126287894-126287916 TCCCCGCGGCGCGGCGCCTGAGG - Intergenic
961698822 3:128726139-128726161 TCCGCTCGGGGCGGCGGCGGTGG + Exonic
965166224 3:165196485-165196507 GACGCTCGCGGCGGCGGCGGCGG + Intronic
966411773 3:179652900-179652922 TGGGCCGGGCGCGGCGGCGGGGG - Exonic
966743393 3:183254069-183254091 GAGGCGCGGCGGGGCGGGGGCGG - Intronic
968186962 3:196639637-196639659 GAAGCGCGGCGCGGGCGCGGGGG - Intergenic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
968583017 4:1403623-1403645 GAGGCGCGGGGAGGCGGCGGCGG - Exonic
968775434 4:2536958-2536980 AACAAGCGGGGCGGCGGCGGCGG + Intronic
971257885 4:25030725-25030747 AGCGCGCGGCGCGGCGGTGGGGG - Exonic
971406013 4:26321176-26321198 TGCGCCGAGCGCGGCGGCGGCGG + Intronic
973635941 4:52862203-52862225 CGCGCGCGGAGCGGCGCCGGGGG + Intergenic
973820551 4:54658400-54658422 TGCGCGGGGGGCGGAGGCGGGGG + Intronic
977231116 4:94452147-94452169 TGGGCGCGGAGCGGCGGAGGTGG + Intronic
977536569 4:98261392-98261414 TGCAGGCGGCGCGGCCGCGGCGG - Intronic
977809714 4:101346099-101346121 TCCGCGCGGGGCGGGGGCGGGGG - Intronic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
979785577 4:124712434-124712456 TAACCGGGGGGCGGCGGCGGCGG - Intronic
980990497 4:139735071-139735093 GACGCGCGGGGCGGGGGCCGCGG - Intronic
981081837 4:140644433-140644455 GACGCGCGGGGCGATGGCGGCGG + Intronic
981093425 4:140756152-140756174 TCCGCTAGGTGCGGCGGCGGCGG + Intergenic
985466744 4:190203771-190203793 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
985466749 4:190203800-190203822 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
986813599 5:11384951-11384973 GCCGCGCGGCGCGGCGTAGGTGG + Exonic
987132446 5:14871947-14871969 TGCGCTTGGCGCGGCCGCGGGGG + Intergenic
990955053 5:61332413-61332435 GGCGGGTGGCGCGGCGGCGGCGG + Exonic
992105784 5:73448198-73448220 TCCCCGCGCAGCGGCGGCGGCGG - Exonic
992105823 5:73448362-73448384 TAGCTGTGGCGCGGCGGCGGCGG + Exonic
992365411 5:76084560-76084582 TAGGCGGCGCGCGGGGGCGGGGG + Intronic
997584099 5:135034456-135034478 GAGGCGCGGCGAGGCCGCGGGGG - Intronic
998142732 5:139709339-139709361 TTGGCGCGGCGTGGCGGGGGCGG + Intergenic
998143230 5:139711334-139711356 GACGCGCTCGGCGGCGGCGGCGG - Intergenic
1001035095 5:168291805-168291827 AGCGCGCCGCGCGGCGGAGGAGG + Intronic
1002046319 5:176543452-176543474 TTCGCGCGGGGCCGGGGCGGGGG - Intronic
1002352140 5:178590463-178590485 CCCGCGCGGCGAGGGGGCGGGGG + Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1004396341 6:15248820-15248842 CAGGCGCGGCGGGGCGGCGGGGG + Intronic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1005327883 6:24720256-24720278 TGCGGGCGGAGCGGTGGCGGCGG + Exonic
1006477155 6:34263688-34263710 AGCGGGCGGCGCGGCGGCGTCGG - Intergenic
1007631701 6:43276464-43276486 CACGCGCGGCGCCGCCACGGGGG + Intronic
1007902063 6:45422094-45422116 GCGGCGCGGCGCGGCGGTGGCGG + Intronic
1008673316 6:53794981-53795003 GAAGCTCCGCGCGGCGGCGGGGG + Exonic
1010141918 6:72622243-72622265 GAAGAGCGGCGCAGCGGCGGCGG + Exonic
1011416248 6:87122758-87122780 GTCTCGCAGCGCGGCGGCGGCGG + Intergenic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1013117569 6:107114776-107114798 CGCGCGCCGCGCGGGGGCGGGGG - Intronic
1013170819 6:107635022-107635044 CACGCGCGGCGCCGCCGCCGAGG + Exonic
1014029118 6:116681133-116681155 TGCACTCGACGCGGCGGCGGCGG - Intergenic
1014724810 6:124962124-124962146 GACGCGCGGCCCGAGGGCGGTGG - Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1017696561 6:157021609-157021631 TGTGCGCGGCGCGGCGCCGTCGG - Intronic
1017842350 6:158232209-158232231 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1019562566 7:1665875-1665897 CGAGCGCGGGGCGGCGGCGGCGG - Intergenic
1019689667 7:2403610-2403632 TAGTCGCGGGGCGGCGGCGGCGG + Exonic
1021740349 7:23680239-23680261 TCTCGGCGGCGCGGCGGCGGTGG + Exonic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1025788381 7:64665509-64665531 TTAGCCCGGCGCGGTGGCGGGGG - Intergenic
1026471098 7:70694557-70694579 TAAGAGCGAGGCGGCGGCGGCGG - Intronic
1029550045 7:101232728-101232750 CAAGGGCGGCGCGGGGGCGGGGG + Intronic
1030176499 7:106660421-106660443 TCCTCGGGGGGCGGCGGCGGTGG + Exonic
1032525706 7:132577096-132577118 GAGGCGCGGGGCTGCGGCGGTGG + Exonic
1035512938 8:206280-206302 GAGGCGCGGCGCGCCGGCGCAGG + Intergenic
1037481925 8:19313632-19313654 TGGGCGCGGCGGGGCGGCGCGGG + Exonic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039843397 8:41309198-41309220 CGCGCGCGGGGAGGCGGCGGAGG - Exonic
1042785099 8:72537390-72537412 TGCCCGAGGCGCAGCGGCGGCGG - Exonic
1043053279 8:75407535-75407557 TGCGCGCGCCGAGGCGGTGGCGG + Intergenic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1046547420 8:115669079-115669101 GCCGGGCGGGGCGGCGGCGGCGG - Intronic
1047274717 8:123396732-123396754 TTGGCGCGGGACGGCGGCGGGGG + Intronic
1047381876 8:124372074-124372096 CGGGCGGGGCGCGGCGGCGGCGG + Exonic
1049405306 8:142449669-142449691 GAGGAGCGGAGCGGCGGCGGCGG + Exonic
1049659997 8:143815608-143815630 AGCGCGGGGAGCGGCGGCGGCGG + Intergenic
1049718217 8:144103720-144103742 AGCGGGCGGGGCGGCGGCGGCGG - Exonic
1049762751 8:144338381-144338403 CCCGCGCGGCGCGGCCGAGGGGG - Intergenic
1049801017 8:144517576-144517598 AGCGCGCGGCGGGGCGGCGGGGG - Intronic
1051897968 9:22008735-22008757 AACGCGGGGCGCGGCCTCGGCGG - Intronic
1051936474 9:22447617-22447639 CACGGGCGGCCCTGCGGCGGGGG + Exonic
1052888824 9:33676951-33676973 CACGGGGGGTGCGGCGGCGGCGG + Intergenic
1053239939 9:36487403-36487425 TCCGGCCGGGGCGGCGGCGGTGG + Intronic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1057600125 9:96450447-96450469 GAGGCGCGACGAGGCGGCGGCGG + Exonic
1059123372 9:111661828-111661850 TCGGCGGGGCGCGGGGGCGGTGG + Intronic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1061208510 9:129177629-129177651 CAGGGGCTGCGCGGCGGCGGCGG - Exonic
1061328123 9:129876240-129876262 TGCGTGCGGCGAGGCGGCGCGGG + Intronic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203471455 Un_GL000220v1:116826-116848 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203471457 Un_GL000220v1:116829-116851 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203479276 Un_GL000220v1:160798-160820 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203479278 Un_GL000220v1:160801-160823 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1187403649 X:18984129-18984151 TCCGCGCGGCGGGGAGGCGCGGG + Exonic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1197776329 X:130120879-130120901 CACGCGGAACGCGGCGGCGGCGG + Intergenic
1199772398 X:150983441-150983463 TGCGGGCGCTGCGGCGGCGGCGG - Intronic
1200173763 X:154097633-154097655 TCCGCTCGGCGCGGCGGCGGCGG + Exonic