ID: 933666908

View in Genome Browser
Species Human (GRCh38)
Location 2:84971402-84971424
Sequence CACTGCAGCCGGAGCCCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933666896_933666908 10 Left 933666896 2:84971369-84971391 CCGGCGCGGGCAGCGCCGGGACC 0: 1
1: 0
2: 3
3: 16
4: 190
Right 933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 216
933666901_933666908 -5 Left 933666901 2:84971384-84971406 CCGGGACCCCGCGGGGGACACTG 0: 1
1: 0
2: 1
3: 7
4: 103
Right 933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 216
933666893_933666908 14 Left 933666893 2:84971365-84971387 CCGGCCGGCGCGGGCAGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 352
Right 933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933666908 Original CRISPR CACTGCAGCCGGAGCCCGGG AGG Exonic
900087092 1:903959-903981 CCCAGCAGGCCGAGCCCGGGTGG + Intergenic
900584029 1:3423794-3423816 CACTGCAGCAGGATCCTGGCCGG - Intronic
901013788 1:6216138-6216160 CACTGCAGCCGAAGTCTGAGGGG - Intronic
901316759 1:8314987-8315009 CACAGCGGCCGCAGCCCGGCTGG - Intergenic
901632168 1:10653302-10653324 CTCTGCAGCCTGAGGCCAGGTGG + Intronic
902754100 1:18537725-18537747 AAGTGCAGCAGGAGCCCGGCTGG - Intergenic
908780389 1:67685327-67685349 CACAGGAGGAGGAGCCCGGGCGG + Exonic
912514824 1:110210947-110210969 CACGGCAGCCGGAGCTCCGTGGG - Intergenic
912782620 1:112565933-112565955 CACTGCAGCCTCAGCCTGGTGGG - Intronic
915513913 1:156401829-156401851 CCCTGCAGCTGGAGCCCAGAGGG + Intergenic
920040660 1:203093565-203093587 CACTGCACCCCCAGCCTGGGTGG + Intronic
920379387 1:205526913-205526935 CTCAGCAGCCGGATCCCTGGTGG - Intronic
922467730 1:225855806-225855828 CACTGCAGCCCCAGCCCCTGTGG + Intronic
922807679 1:228399057-228399079 CACAGCAGCCAGAGCCCCAGTGG + Intronic
923461654 1:234214324-234214346 CGCGGCAACCGGAGCCCGGCGGG + Intronic
924570998 1:245237539-245237561 TGCTGCAGCCGGGGCCCAGGGGG + Intronic
1064094970 10:12417526-12417548 CACCCCAGCCGGAGCCCCAGAGG - Intronic
1064277042 10:13915814-13915836 CTCTGCAGCGGGAGCACAGGTGG - Intronic
1067755227 10:49000098-49000120 CACTGCAGCAGGAGTCAGGCAGG - Intergenic
1069592173 10:69648919-69648941 CACTGCAGCCTGAGGGCCGGGGG - Intergenic
1069915019 10:71782065-71782087 CACTGCAGCCTGAGGCTGGAAGG + Intronic
1076341890 10:129754969-129754991 TACTACAGCCTGAGCCCTGGAGG - Intronic
1076615374 10:131751190-131751212 GGCTGCAGCCGGGTCCCGGGGGG - Intergenic
1076844290 10:133061464-133061486 CTCTGCAGCCGGCACCCGGGTGG - Intergenic
1077094388 11:793134-793156 CACTGCAGCAGCAGGCAGGGAGG + Intronic
1077152463 11:1078405-1078427 GACCGCTGCCGGTGCCCGGGCGG + Intergenic
1079121204 11:17686362-17686384 CACTACAGCCGCAGCCCTGGGGG + Intergenic
1081793303 11:45804156-45804178 AACTGAAGCCGGGTCCCGGGCGG + Intronic
1081860906 11:46332969-46332991 GAGCGGAGCCGGAGCCCGGGCGG - Intronic
1084520198 11:69658073-69658095 CACTGCAGCCAGGGCCAGCGAGG + Intronic
1084755638 11:71236927-71236949 CACTGCAGGCAGCGGCCGGGAGG + Intronic
1085814938 11:79727672-79727694 CACTGCAGTCAGAGCCTTGGTGG - Intergenic
1088401264 11:109423946-109423968 CACTGCAGCGGCAGCCGCGGTGG + Exonic
1089046323 11:115504312-115504334 AGCCGGAGCCGGAGCCCGGGAGG + Exonic
1089325056 11:117651271-117651293 CACTGCAGCCCCTGCCAGGGTGG - Intronic
1090684520 11:129100614-129100636 CACTGTAGACGGAGCCTTGGTGG + Intronic
1092187693 12:6493310-6493332 CCCTCCTGCCGGAACCCGGGGGG - Exonic
1094204834 12:27829330-27829352 AACAGCAGCCTGAGCCAGGGTGG - Intergenic
1102422583 12:112815685-112815707 CACTGCAGCCTGGGCCTGAGTGG + Intronic
1102429384 12:112870018-112870040 GACTCCAGCCGGAGCCCAGCAGG + Exonic
1104043837 12:125147590-125147612 CACTGAAGCTGTAGCCTGGGAGG + Intergenic
1104865277 12:131949945-131949967 CAGTGCATCCGGGGCCCCGGCGG - Intronic
1104869153 12:131982207-131982229 CACTGCCGCAGCTGCCCGGGAGG + Exonic
1110481806 13:75986848-75986870 CAGTGCAGCTGGAGCCCATGAGG - Intergenic
1112250463 13:97774555-97774577 CACGGCAGCCTGAGGCAGGGAGG - Intergenic
1112652703 13:101416284-101416306 CACCGCCGCCGGTGCCCGGGAGG - Intronic
1114418101 14:22557388-22557410 CGCTCCACCCGGAGCCCTGGAGG + Intronic
1115762030 14:36584387-36584409 CTCTGCAGACGGGGCCGGGGCGG + Intergenic
1122457374 14:101864848-101864870 CACTGCAGCCGGAGCAAACGGGG - Intronic
1122504945 14:102226511-102226533 CCCTGCTGCCGGGGCCCCGGCGG - Intronic
1122695817 14:103551541-103551563 CACTGCTGCTGGAGCCGGGAGGG - Intergenic
1122769730 14:104092612-104092634 CACTGCAGGCAGAGTCCAGGTGG - Exonic
1128338442 15:66803297-66803319 CACTGCGGCCCCAGCCCAGGAGG + Intergenic
1128947217 15:71834674-71834696 CACTGAGGCGGGAGCCCAGGAGG + Intronic
1130424014 15:83776969-83776991 CACTGCAGACAGAGCCTTGGTGG + Intronic
1132900905 16:2253801-2253823 TTCTGCAGCCGGGGCCCGGCTGG + Exonic
1134250366 16:12569730-12569752 CACTGGAGGAGGAGCCCTGGGGG - Exonic
1135517525 16:23148590-23148612 CACTGCACCCCGAGCCCCTGGGG - Intronic
1136366688 16:29812256-29812278 TGCAGCAGCCGCAGCCCGGGAGG - Exonic
1137426664 16:48385747-48385769 CCCTCCGGCCGGAGCCGGGGGGG - Intronic
1140859800 16:79008816-79008838 ACCTGCAGCCGGAGACCAGGGGG + Intronic
1141418926 16:83899208-83899230 CTCGCCAGCCGGGGCCCGGGCGG - Exonic
1142848410 17:2692902-2692924 CACTGCACCCAGAGCCCGCCTGG + Intronic
1143037816 17:4009756-4009778 CACTGCAGGAGGAGCCCCGGAGG + Exonic
1144501229 17:15787631-15787653 CACTGATGCTGGAGCCCGGAAGG - Intergenic
1144789913 17:17851791-17851813 CGCAGCAGCCAGAGCCAGGGAGG + Intronic
1145390827 17:22454279-22454301 CACGCCAGTCGGAGTCCGGGCGG + Intergenic
1149585506 17:57783448-57783470 CCCTGCTGCCCGAGCCCGGGTGG + Intergenic
1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG + Intronic
1151854309 17:76710549-76710571 AGCGGCAGCCGGAGCCCCGGGGG + Intronic
1152076778 17:78164720-78164742 CTCTGCAGCCAGGGCCCGGTTGG - Intronic
1152663292 17:81552776-81552798 CACTCCAGCCGGGGTCGGGGTGG + Intronic
1153823195 18:8850129-8850151 CACAGCAGCTGTAGCCCAGGAGG - Intergenic
1154304747 18:13222558-13222580 CTCTGCAGCCGGCGGCCGGCTGG + Intronic
1154416343 18:14177907-14177929 CACTGCCGGCGGCGCCGGGGTGG + Intergenic
1155392093 18:25349588-25349610 CACAGCGGCCGGGGGCCGGGAGG + Intronic
1160421929 18:78753835-78753857 CCCTTCACCCTGAGCCCGGGAGG + Intergenic
1160421940 18:78753873-78753895 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160421952 18:78753911-78753933 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160421964 18:78753949-78753971 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160421976 18:78753987-78754009 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160421988 18:78754025-78754047 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160422000 18:78754063-78754085 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160422012 18:78754101-78754123 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160422036 18:78754177-78754199 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160422048 18:78754215-78754237 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160422060 18:78754253-78754275 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160422082 18:78754329-78754351 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160422094 18:78754367-78754389 CCCTTCACCCCGAGCCCGGGAGG + Intergenic
1160859049 19:1230028-1230050 CACTGGAGCCGGACGCCGAGCGG - Exonic
1161003932 19:1925051-1925073 CCCAGCAGCCGGAGCCCTGCAGG + Exonic
1161006829 19:1941303-1941325 CACCGGAGCCGGAGCGCGAGGGG + Exonic
1161008271 19:1947452-1947474 CACTGGAGCAGAAGCCCGAGGGG - Intronic
1161156137 19:2732712-2732734 CCCTGCCGCCGGAGCCCGCCGGG - Exonic
1161590788 19:5128283-5128305 CCCTGCAGCTGGAGGCCGTGAGG + Intronic
1162125747 19:8498752-8498774 TGCTGCAGCCGGAGCGCCGGGGG - Exonic
1165785413 19:38458905-38458927 CACTGCATCCGGCCCCCAGGAGG + Intronic
1165902388 19:39174839-39174861 AACTGCAGGGGGAGCCAGGGGGG + Intronic
1166882927 19:45940171-45940193 CGCTGCAGCCGCGGCCGGGGCGG - Exonic
925188227 2:1864051-1864073 ACCTGCAGCCGCAGCCCTGGGGG - Intronic
926152484 2:10432760-10432782 CACTGCGGCCTGGGCCCCGGGGG + Intergenic
928121935 2:28590095-28590117 CAGTGCAGCCGGAGCCTGGAAGG - Intronic
928674683 2:33639019-33639041 CACTGTAGCAGGGGCCTGGGCGG - Intergenic
930011527 2:46941414-46941436 GACGGCAGCCGGGGCCCGGGCGG - Exonic
930177609 2:48315621-48315643 CACTGCAGCAGCAGCCTGTGTGG + Intronic
932568530 2:72924518-72924540 CCCTGCGCCCGGAGCCCGGGTGG + Intronic
933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG + Exonic
934661682 2:96146439-96146461 CACTGCACCCGGAGGACTGGGGG + Intergenic
937116227 2:119406905-119406927 CACTGCAGCCAGAGGCTGTGTGG + Intergenic
944579153 2:201116907-201116929 CCCTGCAGCCGCAGCCCCAGAGG + Intronic
946702107 2:222424487-222424509 CACTCCGGGCGGAGGCCGGGCGG - Intergenic
947119323 2:226799487-226799509 CACTGCAGCTGGGGACCGGCCGG + Exonic
947637050 2:231685484-231685506 CACTGCCCCCAGAGCCCAGGAGG - Intergenic
947958215 2:234213077-234213099 CACTGAAGCCAGAGACAGGGAGG + Intergenic
948726932 2:239939858-239939880 CACTGCAGCCGGTTCCAGGAGGG - Intronic
949070667 2:242022302-242022324 CAGTGCAGCTGGAGACCGGCGGG + Intergenic
1172781298 20:37438376-37438398 CACAGCAGCCTGAGCTCTGGGGG + Intergenic
1174351880 20:49974404-49974426 CCCTGCAGCCGGAGCCTTGTGGG + Intergenic
1175109568 20:56637634-56637656 CACTGAGGCTGGCGCCCGGGAGG - Intronic
1175429315 20:58891110-58891132 GGCTGCTGCCCGAGCCCGGGGGG + Intronic
1175825270 20:61933479-61933501 CAGTGCACCAGGCGCCCGGGAGG + Intronic
1176856993 21:13981383-13981405 CACTGCCGGCGGCGCCGGGGTGG - Intergenic
1176867604 21:14062840-14062862 CACTGCCGGCGGCGCCGGGGTGG + Intergenic
1178554886 21:33580846-33580868 CACTGCAGCCGGTGACAGAGTGG + Intronic
1179943611 21:44655517-44655539 CTCTGCAGACGGAGCCCAGGAGG + Intronic
1179947040 21:44685521-44685543 CTCTGCAGACGGAGCCCAGGAGG - Intronic
1180155490 21:45975312-45975334 CACTGCAGCCGGGCCCTGCGGGG + Intergenic
1181163587 22:20971759-20971781 CCCTGCAGCAGCAGCCTGGGAGG + Intronic
1182103662 22:27674115-27674137 GACAGCAGCGGGAGCCCCGGGGG + Intergenic
1183407899 22:37639504-37639526 CACAGCAGCGGGGGCCCGGCCGG + Exonic
1183437089 22:37802557-37802579 CACTGCAGCCGGACCCCGCCTGG - Intergenic
1183622389 22:38982106-38982128 CATTGCAGCCTGAGCCTGGGAGG - Intronic
1183628791 22:39020877-39020899 CATTGCAGCCAGCGCCCGGGAGG - Intronic
1183632269 22:39040636-39040658 CATTGCAGCCAGCGCCCGCGAGG - Exonic
1183638091 22:39077037-39077059 CATTGCAGCCAGCGCCCGGGAGG - Exonic
1184568962 22:45310210-45310232 CCCTGCATCCGGAGCCCCTGGGG + Intronic
1184684021 22:46087949-46087971 CCCTGCAGCTGCAGCCCTGGAGG - Intronic
1184820376 22:46905527-46905549 CCCTGCAGCCGGCCCCGGGGAGG + Intronic
1185072852 22:48666839-48666861 CATTCCATCCGGAGCCCAGGAGG + Intronic
950680787 3:14583725-14583747 CACTCCACCCGGATCCCGGCAGG - Intergenic
951813073 3:26722791-26722813 CACTGCATTCGGAGCCTGGAGGG + Intergenic
956675004 3:71725230-71725252 CGCTGCAGCCTGAGCCGGGCGGG - Exonic
958407345 3:93765220-93765242 CACTGGAGCCCGAGGCAGGGAGG + Intergenic
959398222 3:105868504-105868526 GACTGCAGCAGGCGGCCGGGAGG - Intronic
959421626 3:106135856-106135878 CACTGCAGTCAGAGCCTTGGCGG + Intergenic
961076357 3:123986618-123986640 CACTGCAGACAGAGCCTTGGAGG - Intronic
961332291 3:126149714-126149736 CACTGTAGCTGGAGCCCAGGGGG - Intronic
966447315 3:180016589-180016611 CAGTGCAGCTGGAGCCAGAGGGG + Intronic
968050229 3:195648905-195648927 CAGTGCAGCTGGAGACCCGGCGG + Intergenic
968105599 3:195999354-195999376 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968303877 3:197636936-197636958 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968756084 4:2417353-2417375 CGCTGCAGCCGGAGCAGGGCCGG - Intronic
969261337 4:6036051-6036073 CGCTGCAGCAGGAGCCGGGGCGG - Exonic
970001936 4:11373033-11373055 TTCTGCAGCCGGAGCCCGGCTGG - Intergenic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
979122908 4:116926208-116926230 CCCTGCAGCCGCTGCCCGAGAGG - Intergenic
979158560 4:117429473-117429495 CACTGCAGACAGAGCCTTGGAGG - Intergenic
979545943 4:121940038-121940060 CACTGCAGAAAGAGGCCGGGAGG - Intronic
981156827 4:141447546-141447568 CACCTGAGCCCGAGCCCGGGAGG + Intergenic
982501986 4:156169175-156169197 GACTGCAGCAGGAGCCAGAGAGG - Intergenic
985064137 4:186104957-186104979 CCCCGCACCCGGAGCCCCGGAGG - Intronic
985506507 5:284639-284661 CCGTGCAGCTGGAGACCGGGCGG + Intronic
985946414 5:3188189-3188211 CACTGCGGCCGGAGCCTGCCAGG + Intergenic
986172793 5:5327348-5327370 CTCTGCACCCTGAGCCCCGGTGG - Intergenic
987050376 5:14143459-14143481 CGCTCCGGCCGGCGCCCGGGAGG + Intergenic
988934159 5:36066199-36066221 AGCTGCATCCGGAGCCAGGGTGG - Intronic
994624142 5:102196652-102196674 CACTGCAGCTGGACACGGGGAGG - Intergenic
998028052 5:138837658-138837680 CACTGCAGTCCCAGCCTGGGTGG - Intronic
998412149 5:141919554-141919576 CACTGTAGCTGGAGCCGGGAGGG - Intergenic
998446669 5:142204279-142204301 GGCTGCAGGCGGAGCCCTGGGGG - Intergenic
1001020451 5:168178241-168178263 CAGTGCAGCCGAGGCCCGGCAGG - Intronic
1002055099 5:176594251-176594273 CACTGCTGCAGGAGACAGGGTGG - Intronic
1003330502 6:5124736-5124758 CACTGCAGTCTGAGCCCTGCTGG - Intronic
1003567002 6:7230422-7230444 CACTGCGGCCGCGGCCTGGGCGG + Exonic
1005360275 6:25024547-25024569 CACTGCTGCCTGAGCCCGAGTGG - Intronic
1006319844 6:33313923-33313945 CACTGGAGCCGATGCCAGGGTGG - Intronic
1007406035 6:41637045-41637067 GACAGCAGCCGGATCCCGGCCGG + Intronic
1007498615 6:42279166-42279188 CACTCCAGCCAGGGCCCAGGAGG + Intronic
1008600464 6:53089111-53089133 CACTGCACCTGCAGCCTGGGCGG - Intronic
1013393741 6:109713540-109713562 CATTGCAGCTGGAGCCTTGGTGG - Intronic
1016500818 6:144718905-144718927 CACTGGAGCCGGATCCCTGAAGG + Intronic
1017208885 6:151833473-151833495 CACTGCAGCAAGAGCCAGGCAGG - Intronic
1017731232 6:157318303-157318325 CACTGCAGCCTCAGCCTGTGAGG + Intronic
1018394502 6:163367241-163367263 CATTGTAGCCGGAGCTCTGGAGG - Intergenic
1019412421 7:912094-912116 CAGGGCAGACGGAGCCCAGGAGG - Intronic
1019478639 7:1256005-1256027 CCCTGGAGCCGAAGCCCTGGAGG - Intergenic
1022396200 7:29989740-29989762 CACTGCAGCTGCAGCCCCCGAGG - Intronic
1022559869 7:31336710-31336732 CAGTGCAGCCTGTGCCCGGGCGG + Intergenic
1023821823 7:43984938-43984960 CTCTGCAGCCTGGGCCAGGGAGG + Intergenic
1029099800 7:98119686-98119708 CACTGCAGCTAGAGTCAGGGTGG + Intronic
1029205996 7:98869730-98869752 CCCTGCAGCCGCAGCCCGCCCGG - Intronic
1029458549 7:100682973-100682995 AACTGTAGGGGGAGCCCGGGAGG + Intronic
1029750088 7:102538360-102538382 CTCTGCAGCCTGGGCCAGGGAGG + Intronic
1029768039 7:102637468-102637490 CTCTGCAGCCTGGGCCAGGGAGG + Exonic
1032442848 7:131955360-131955382 CACTGCATCAGGAGCCCTGTGGG + Intergenic
1033186540 7:139231738-139231760 CGCTGCAGCGGGAGCCCCCGCGG + Exonic
1033659189 7:143392041-143392063 CACTCCAGCAGGAGACCGGCTGG - Intronic
1034272999 7:149812301-149812323 CACTGTAGCCGGAGCTGTGGGGG + Intergenic
1035171115 7:157017993-157018015 CCCCGGAGCCGCAGCCCGGGAGG + Intergenic
1035321398 7:158031902-158031924 CTCTGCAGCCGGCGCTCCGGGGG + Intronic
1036977094 8:13425862-13425884 CACTTGAGCCTGAGCCCAGGAGG - Intronic
1040521405 8:48179202-48179224 CACTGCACGCAGAGCCCAGGGGG - Intergenic
1042414251 8:68501054-68501076 CACTGCAGAAGGAGCCCATGGGG + Intronic
1043375830 8:79648494-79648516 CACTCCAGCCTGAGCCTGAGTGG - Intronic
1045216904 8:100158059-100158081 CAGTGCAGCCAGAGCCGGTGCGG + Intronic
1048256549 8:132909211-132909233 CACTGCAGCCTGGGGCCAGGTGG + Intronic
1048968189 8:139629008-139629030 GACTGCAGTCGGAGCCAGGCTGG - Intronic
1049337547 8:142094471-142094493 CCCTGGAGCGGGAGCCCCGGAGG + Intergenic
1049421302 8:142517788-142517810 CACTGCAGACGGGGCCAGGGAGG - Intronic
1049476121 8:142797688-142797710 CAGTGCAGCCGCAGGCCTGGTGG - Intergenic
1049615631 8:143574712-143574734 CAGCCCAGCCGCAGCCCGGGAGG + Intergenic
1049664620 8:143837410-143837432 CACTGCAGCGGGGGCCTGCGGGG + Exonic
1049776769 8:144409552-144409574 CGCTGCAGCCGGCGCCCCTGCGG - Intergenic
1055177897 9:73343007-73343029 CACCGCAGGCAGAGCCCTGGAGG - Intergenic
1055321641 9:75088383-75088405 CGCCGCAGCAGGAGCGCGGGCGG - Intergenic
1055772242 9:79729971-79729993 CACTGCAGGCCTAGCCAGGGTGG + Intergenic
1056965308 9:91160003-91160025 CAATGGAGCAGGAGCCCGGCAGG - Intergenic
1057076610 9:92141447-92141469 CACAGCGCCCGGAGCCTGGGCGG - Intergenic
1057383422 9:94588588-94588610 CACTGCAGCCTGAGCGATGGAGG + Intronic
1059471038 9:114505096-114505118 GACTGCTGCTGGAGTCCGGGGGG + Intronic
1060048513 9:120359758-120359780 CACTGCAGCCAGAGCCCCTCTGG - Intergenic
1061204159 9:129153297-129153319 CACTGCAGGCGGAGGGCGGAGGG + Intergenic
1061279106 9:129586888-129586910 CACTGGAGCCACAGCCTGGGTGG - Intergenic
1061283592 9:129610388-129610410 CACTGAAGCCGGAGTCCGCGTGG - Intronic
1061290939 9:129649909-129649931 CACTGCAGTCTGACCCAGGGTGG + Intergenic
1061582413 9:131545986-131546008 CACCCCATCCGGAGCCAGGGTGG + Intergenic
1061862579 9:133475596-133475618 CACGGCAGCAGGAGGCCTGGGGG + Exonic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062367730 9:136219313-136219335 AAGCGCAGCCGGAGCCCAGGCGG - Intronic
1062397446 9:136358179-136358201 CACTGCTGCTGGGGCTCGGGCGG - Exonic
1186464327 X:9772736-9772758 CACTGCAGCCTCAACCCTGGAGG - Intronic
1188852705 X:35151084-35151106 CATTGCAGTCGGAGCCTTGGCGG + Intergenic
1192350301 X:70350399-70350421 CACGGGAGCCGGAGGCAGGGAGG + Intronic
1192886070 X:75336220-75336242 CACTGGAGCCCGAGGCAGGGAGG + Intergenic
1194781314 X:98028531-98028553 CACTGCAGACAGAGCCTTGGCGG - Intergenic
1195031174 X:100929004-100929026 CACTGCATTCGGAGACAGGGTGG - Intronic
1195541470 X:106067945-106067967 CATTGCAGATGGAGCCCTGGTGG - Intergenic