ID: 933669057

View in Genome Browser
Species Human (GRCh38)
Location 2:84989525-84989547
Sequence GGATGGATCTGCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 506}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933669050_933669057 25 Left 933669050 2:84989477-84989499 CCAGGGAGTAACATCTGATTTTT 0: 1
1: 0
2: 1
3: 14
4: 194
Right 933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG 0: 1
1: 0
2: 4
3: 51
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933669057 Original CRISPR GGATGGATCTGCAGGGAGGA AGG Intronic
900146278 1:1160241-1160263 GGGGGGATGCGCAGGGAGGAGGG + Intergenic
901207840 1:7507611-7507633 AGATGGAAGTGCAGGAAGGAGGG + Intronic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
902595673 1:17508025-17508047 TCATGGATCTGCTGGGAGGTTGG + Intergenic
902802977 1:18841845-18841867 ATAGGGATCTGGAGGGAGGAGGG + Exonic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903189499 1:21648895-21648917 GGAGGGCTCTGCGGGGACGATGG + Intronic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
904288867 1:29470996-29471018 CCATGGGTCTGCAGAGAGGATGG - Intergenic
904322601 1:29707288-29707310 GGAGGGGTCTGCAGAGAGGAGGG + Intergenic
904554732 1:31352318-31352340 GGTTGCAAGTGCAGGGAGGAAGG - Intronic
904577916 1:31517380-31517402 GGGTGACTCTGCAGGGAGGCTGG - Intergenic
904602733 1:31682866-31682888 GGATGTTTCTGCTGGGAAGAGGG - Intronic
904684779 1:32252054-32252076 GGATGGAGCTCCAGGGTGGATGG + Intronic
904719878 1:32500074-32500096 GGAAGGAACGGAAGGGAGGAAGG + Intronic
905036466 1:34921448-34921470 GGTTGGCTCTGGAGTGAGGAAGG - Intronic
905184704 1:36188044-36188066 GGAGGGATCTCCAGAGGGGATGG - Intergenic
905540906 1:38759805-38759827 GGATGGAGATGGAGAGAGGATGG + Intergenic
906197854 1:43940133-43940155 GGATGGATCTGCAGGATCTAAGG - Intergenic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
907372653 1:54013396-54013418 GGATGGCTCTGCAGCCAGGCAGG - Intronic
907714712 1:56916168-56916190 GTAATGATCTGCAGGGAGGGAGG + Intronic
907836484 1:58113765-58113787 GGGAGCATCTGCAGAGAGGAAGG + Intronic
909152947 1:72031772-72031794 GAAAGGGTCTGAAGGGAGGAAGG + Intronic
909607589 1:77522431-77522453 GGAAGGATGGGAAGGGAGGAGGG + Intronic
911238585 1:95439408-95439430 GGATGGAACTGGAGGTGGGAGGG - Intergenic
912421218 1:109543560-109543582 GGAAGGGTCTCCTGGGAGGAAGG + Exonic
912659254 1:111513885-111513907 GGAAACATCTGCAGGGAGGCAGG + Intronic
912698929 1:111861703-111861725 GGAGGGCTCTGCAGGGAAGAGGG + Intronic
915536154 1:156537082-156537104 TGATAGTCCTGCAGGGAGGAAGG - Intronic
915601885 1:156927671-156927693 GGAGGGACCTGCTGGGAGCAGGG + Intronic
915743729 1:158140196-158140218 GGAGGGAGCTGCAGGGATGGTGG + Intergenic
915916978 1:159946064-159946086 GGGTGGATCCCCTGGGAGGAGGG - Intergenic
916951813 1:169788042-169788064 GGCTGAATCTGCCTGGAGGAAGG + Intronic
917125102 1:171680350-171680372 AAATGGATCTGCAGGCATGAGGG - Intergenic
918187812 1:182143423-182143445 GGATGGATTTGAAGGGCTGAGGG + Intergenic
919573202 1:199274313-199274335 AGATGGACCTGGAGGGAGCAGGG - Intergenic
919838668 1:201593843-201593865 AGTTGCAGCTGCAGGGAGGATGG + Intergenic
919843821 1:201628590-201628612 GGAGGGCTGTGCAGGCAGGAGGG - Intronic
920511923 1:206557882-206557904 GGATGGAACCGCTGTGAGGAGGG - Intronic
920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG + Intergenic
920684936 1:208102179-208102201 GGAGGGCTCTGGAGGGAGGGAGG - Intronic
921178524 1:212613743-212613765 GGAACCAACTGCAGGGAGGAGGG + Intronic
921219731 1:212964784-212964806 GGATGGATTGGAAGGGTGGATGG - Intronic
922470159 1:225871773-225871795 GGATGAATTTGCAGGCAGGAAGG - Intronic
922799622 1:228359246-228359268 GGATGGACCTGGAGGGGAGACGG + Intronic
922823115 1:228497994-228498016 TGCTGGGTCTGCAGGGAGCAGGG - Intergenic
923011526 1:230091804-230091826 GGTGGGATCTGCAGGGAGTGTGG - Intronic
923048114 1:230370127-230370149 GGATGGAGCTGCAGGGGAGCAGG + Intronic
924507328 1:244698020-244698042 GAATACATCTGCAGTGAGGAAGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1063477335 10:6340632-6340654 GGATGGAGCAGCAGAGATGAAGG + Intergenic
1064462213 10:15546138-15546160 GGCTGCTTCTGCAGGTAGGATGG - Intronic
1064779846 10:18822948-18822970 GGGTGGTTCTGGAGGAAGGAAGG + Intergenic
1065628302 10:27653468-27653490 TGCAGGATATGCAGGGAGGAGGG - Intergenic
1065665903 10:28060438-28060460 GTTGGGATCTGCAGGAAGGATGG - Intronic
1065896826 10:30170361-30170383 GGATGGAAATGGAGTGAGGAAGG + Intergenic
1066517629 10:36181458-36181480 GGCTGCAACTGCAAGGAGGAAGG + Intergenic
1066658239 10:37713985-37714007 GGATGGATCTACAGGGATCTGGG - Intergenic
1067042739 10:42963663-42963685 GGATGGATCTACAGGGATCTGGG - Intergenic
1067452556 10:46391223-46391245 GGAAGCTCCTGCAGGGAGGAAGG - Exonic
1067584676 10:47468532-47468554 GGAAGCTCCTGCAGGGAGGAAGG + Exonic
1067723867 10:48751399-48751421 GGATGGATGGGCAGAGATGATGG + Intronic
1067812114 10:49438094-49438116 GGTTGGATCTGCAGTGTGGTTGG - Intergenic
1068531293 10:58189624-58189646 GGATGGATCTGCAAGTTGGCTGG - Intergenic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069430590 10:68331380-68331402 GGAAGGATTTGCAGAGAGAACGG + Intronic
1069847093 10:71379909-71379931 GGATGGACCTTGAGGGAGTATGG - Intergenic
1070857618 10:79619860-79619882 GAATGGAGCCCCAGGGAGGAGGG - Intergenic
1071307777 10:84314317-84314339 GAATAGATCTGAATGGAGGAAGG + Intergenic
1071564541 10:86665012-86665034 GCAGGGATCTGCAGGCAGCAGGG + Intronic
1072430744 10:95368797-95368819 GGATGGATGTGAAGGTAAGAGGG - Intronic
1073302981 10:102482168-102482190 GGACCAATCTGCAGGTAGGAGGG + Exonic
1074196476 10:111190946-111190968 GGATGGATGTACAGGAGGGAGGG - Intergenic
1074761827 10:116672420-116672442 GGAAGGATGTGCATGGAGAAGGG + Exonic
1075087364 10:119422574-119422596 GGAAGGCTCAGGAGGGAGGAGGG - Intronic
1075120355 10:119660044-119660066 GGCTGGGGCTGCAGGGAGGCTGG + Intronic
1075399506 10:122150849-122150871 GGATGTATCTGCCGAGAGGCTGG - Intronic
1075403396 10:122177414-122177436 GGATGGAGTTGCAGGGATGATGG + Intronic
1076188326 10:128465817-128465839 GGAGGCATCTGCAGTCAGGACGG + Intergenic
1076802687 10:132838576-132838598 TGTGGCATCTGCAGGGAGGAAGG - Intronic
1077173844 11:1180007-1180029 GAACAGAGCTGCAGGGAGGAAGG - Intronic
1077209215 11:1360700-1360722 GGATGGCCCTGTAGGGAGGCAGG - Intergenic
1077676229 11:4195412-4195434 GGATGGATTGGGAGGGAGGGAGG - Intergenic
1078580554 11:12536462-12536484 AGATGGAACTGCAGTGAGAATGG - Intergenic
1079180911 11:18192729-18192751 AGATGGATCTGAAGAGAGAAAGG - Intronic
1079404216 11:20130879-20130901 GGATGGGTCAGCAGTGAGGGAGG - Intergenic
1081571441 11:44293881-44293903 GGATGGCTCTGGAGGGAGGAGGG + Intronic
1082184473 11:49163211-49163233 GGATGGAGCTGCCAGGAGGAGGG - Intronic
1082757807 11:57095423-57095445 GTATTGATGTGGAGGGAGGAGGG + Intergenic
1083116634 11:60466185-60466207 GGATTTCTCTCCAGGGAGGAAGG + Intronic
1083190500 11:61048574-61048596 GGATGGACCAGGAGGGAGGGTGG - Intergenic
1083472711 11:62894878-62894900 GGCTGGATATGAAGGGAGAAGGG + Intergenic
1083592371 11:63903260-63903282 GGATGGAACTCCAGGGAGCAGGG - Intronic
1083940488 11:65892853-65892875 GGTGGCATCTGCAGGGAGTAGGG + Exonic
1083951412 11:65958668-65958690 GGATGGATCGGGAGGGTTGAGGG - Intronic
1084362034 11:68674977-68674999 GGAGGACCCTGCAGGGAGGAGGG + Intergenic
1084672025 11:70612655-70612677 GGGTGCCTCTGCAGGGAGGAAGG - Intronic
1085822443 11:79807064-79807086 GGTTGGAGGAGCAGGGAGGACGG + Intergenic
1086079849 11:82891625-82891647 GGGAGGAACTGTAGGGAGGATGG - Intronic
1086681876 11:89682157-89682179 GGATGGAGCTGCCAGGAGGAGGG + Intergenic
1087635209 11:100694552-100694574 AGGTGGAGCTGCAGGGAGGCTGG - Intronic
1088182227 11:107126105-107126127 GGATGGTCCAGGAGGGAGGAAGG - Intergenic
1088332757 11:108670358-108670380 GGAAGGAGCAGCAGGTAGGAAGG + Intronic
1088538119 11:110883912-110883934 GGATGGAACAGCAGGGAGAGTGG + Intergenic
1088794325 11:113254956-113254978 GGATGGTTCTCCAGTGAGTAAGG - Intronic
1089186448 11:116618738-116618760 GGAGGGCTCTCCAGGGAGAAGGG - Intergenic
1089348339 11:117806279-117806301 GGAAGGATATGCAGAGAGGCAGG + Intronic
1089573483 11:119424852-119424874 GGATGGAGTTGGAGGGAGGAGGG - Intronic
1089629371 11:119774542-119774564 GGACTTATCTGCAGGCAGGAGGG + Intergenic
1089966091 11:122655987-122656009 GGATGGTTCGGGAAGGAGGAGGG - Exonic
1090269480 11:125376104-125376126 GCATGTGTCTGAAGGGAGGAGGG + Intronic
1091205536 11:133818428-133818450 GGATGAATCTGCACGGGGCAAGG + Intergenic
1092134755 12:6139045-6139067 GGATGGCTCTGCAAGGGGGCAGG + Intergenic
1092824612 12:12386789-12386811 GTATGGGTGGGCAGGGAGGAAGG - Intronic
1092831661 12:12449888-12449910 GCCTGGATCTGCAGTGAGAAGGG - Intronic
1095484991 12:42675598-42675620 AAATGGATCTCCAGAGAGGAAGG + Intergenic
1096071046 12:48775743-48775765 GGAAGGAGCTGCAGAGATGAAGG - Intronic
1096887266 12:54730606-54730628 GGATGGATCTGGGAGGAAGAGGG - Intergenic
1097836126 12:64274227-64274249 TGATGCAGCTGCAGGGAGGGGGG + Intronic
1098854433 12:75636412-75636434 GGATGGATCTGGAAGCAGAAAGG - Intergenic
1100589034 12:96007420-96007442 GGATGGGTCAGCAAGGAGGGTGG + Intronic
1102291396 12:111703251-111703273 GCATGGAGGTGCTGGGAGGAGGG - Intronic
1102604107 12:114055551-114055573 GGTGGGATCTGCAGGTAGGGAGG + Intergenic
1102629892 12:114268778-114268800 GGATGAGGGTGCAGGGAGGAAGG - Intergenic
1102685465 12:114721196-114721218 GGATGCATCTGCAGGGGTGCGGG + Intergenic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1103253578 12:119521829-119521851 GGATTCATCTGCAGGGATTAGGG + Intronic
1103797457 12:123514296-123514318 GGTTGTACCTGCAGGGAGGGAGG + Intronic
1104258626 12:127162397-127162419 GCATGGAGCTGCAGGGATGGAGG - Intergenic
1104386431 12:128355261-128355283 GGAGGGATCTTCAGGAGGGAAGG + Intronic
1104688284 12:130804977-130804999 GGATGGACCTGCAGGAGAGATGG + Intronic
1104749518 12:131229550-131229572 AGGTGGGTCTGCAGGGAGGCCGG - Intergenic
1105014183 12:132776190-132776212 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014214 12:132776349-132776371 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014231 12:132776426-132776448 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014248 12:132776505-132776527 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014265 12:132776584-132776606 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105209623 13:18250137-18250159 GCATGGACCTCCAGGGAGGGGGG + Intergenic
1105258558 13:18761531-18761553 AGATGGAGCTGCAGGGATGCAGG + Intergenic
1105261226 13:18780832-18780854 AGATGGAGCTGCAGGGATGCAGG + Intergenic
1105263551 13:18797427-18797449 AGATGGAGCTGCAGGGATGCAGG + Intergenic
1105892061 13:24689020-24689042 GGAGGGATCTCCAGGCAGGATGG + Intronic
1106144433 13:27039125-27039147 TGATGACTCTGCAAGGAGGAAGG + Intergenic
1108556403 13:51597629-51597651 GGATGGATTTGCAGAGAGAATGG + Intronic
1110001288 13:70204834-70204856 GGATGGGACTACAGGGAAGAAGG - Intergenic
1111792112 13:92870959-92870981 GGATGGAGCGGCAGGGTGGGGGG - Intronic
1111900763 13:94197075-94197097 GTATGAATCTACAGGGAGAAAGG + Intronic
1112693124 13:101917589-101917611 GGAGGGATTAGCAGGGAGGGCGG - Intronic
1113060090 13:106313712-106313734 GGATAGAGCTGCACGGAGAAGGG - Intergenic
1113608045 13:111624243-111624265 GGAGGGGTCTGCAGAGAGGATGG - Intronic
1113625077 13:111789122-111789144 GGCAGCATCTTCAGGGAGGATGG - Intergenic
1113766104 13:112881998-112882020 GGATGGAACTGCAGTGGTGATGG - Exonic
1113849271 13:113408846-113408868 GGAGGGGGCTGCAGAGAGGAAGG + Intergenic
1113849280 13:113408871-113408893 GGAGGGGGCTGCAGAGAGGAGGG + Intergenic
1113875448 13:113591785-113591807 GGATGGATCTGCGAGGGGAAGGG + Intronic
1113908282 13:113830401-113830423 GGATGGAGCCACGGGGAGGAGGG - Intronic
1113908310 13:113830476-113830498 GGATGGAGCCACGGGGAGGAGGG - Intronic
1113908338 13:113830551-113830573 GGATGGAGCCACGGGGAGGAGGG - Intronic
1113908450 13:113830852-113830874 GGATGGAGCCCCGGGGAGGAGGG - Intronic
1115179631 14:30608437-30608459 CGATGGGTCTGAAGAGAGGAAGG + Intronic
1117062911 14:51981155-51981177 GAATGGTCCTGAAGGGAGGAAGG + Intergenic
1118006427 14:61568126-61568148 GGTAGGATCTGCAGGAAGGCAGG - Intronic
1118708825 14:68503184-68503206 GAATGGATTTGGAGGGAGGGTGG + Intronic
1118715419 14:68556404-68556426 GGAGCGATCTGCAGGGAGGAAGG - Intronic
1119409616 14:74422229-74422251 GGGGGCAGCTGCAGGGAGGAAGG + Intronic
1119539934 14:75431370-75431392 GGATGGCTGTGCAGGGATCACGG + Intronic
1119866760 14:77980911-77980933 GGGTGGATTGGCAGGGAGGTCGG + Intergenic
1120018115 14:79497493-79497515 AGAAGGAACTGCAGGGAGGTGGG - Intronic
1121464575 14:94106692-94106714 TCATGGTTCTGCAGGGAGCATGG + Intronic
1122059795 14:99129380-99129402 GGATGGAGCTCCAGGGAGCCAGG - Intergenic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122479234 14:102035377-102035399 GGATGTAACTGCAGTGAAGATGG + Intronic
1122722229 14:103728471-103728493 GGATGGAGCTGTGGGCAGGAAGG - Intronic
1122916178 14:104860035-104860057 GGATGGAGATGGAGGGTGGATGG - Intergenic
1122916257 14:104860395-104860417 GGATGGAGATGGAGGGTGGATGG - Intergenic
1122916316 14:104860640-104860662 GGATGGAGATGGAGGGTGGATGG - Intergenic
1123942902 15:25225169-25225191 GGATGCATGTGCAGGGAGGTGGG + Intergenic
1124431693 15:29613939-29613961 GGATGGATATTCATGGAAGAAGG - Intergenic
1124621191 15:31275011-31275033 GGATGTAGATGCAGGGAGAATGG + Intergenic
1124923528 15:34048556-34048578 GGATGGAGCTCCCAGGAGGAGGG + Intronic
1126354723 15:47783090-47783112 GGATGGATTAGGAGGGAAGATGG + Intergenic
1126628841 15:50713005-50713027 GATTGGATCTACAGGGAGGTAGG - Intronic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1126956266 15:53936381-53936403 GGATGGAGCCCCTGGGAGGAGGG + Intergenic
1129161697 15:73751484-73751506 GGATGACTCTGCAGGGACTAAGG + Exonic
1129178801 15:73858715-73858737 GGATGGGTCTTCCAGGAGGAAGG - Intergenic
1129252285 15:74315670-74315692 GAATGGATCTGCAGAGATGGGGG + Intronic
1129517355 15:76164861-76164883 GGATGGCTCTGCAGGGCACAGGG + Intronic
1130254185 15:82318281-82318303 AGATGGAGCAGCTGGGAGGATGG + Intergenic
1130600786 15:85271690-85271712 AGATGGAGCAGCTGGGAGGATGG - Intergenic
1130635186 15:85611862-85611884 GGATGGTGCTGTAGGGAGGCAGG - Intronic
1131962597 15:97805195-97805217 GGAGGGAAATGCAGGGAGAACGG + Intergenic
1132622194 16:873084-873106 GGATGCCTCTGCATGGAGCAGGG - Intronic
1132737548 16:1394386-1394408 GGTCGGCTCTGCAGAGAGGAGGG - Intronic
1132839316 16:1971189-1971211 GGAGGGAGCGGAAGGGAGGAAGG - Intergenic
1132854079 16:2037064-2037086 GGACGGATCTCCAGGGAGAAGGG - Intronic
1133109883 16:3541686-3541708 GCCGGGCTCTGCAGGGAGGAAGG - Intronic
1133279509 16:4657231-4657253 GGCTGTATCTGCAGGGAGCCAGG - Exonic
1134447067 16:14338655-14338677 GGATGGATGAGTAGGGAGGTGGG - Intergenic
1134447073 16:14338676-14338698 GGATGGATAGGCTGGGTGGATGG - Intergenic
1135853374 16:25984563-25984585 GGATGGAAGGGCAAGGAGGAAGG - Intronic
1136281302 16:29213087-29213109 GGTTGGGGGTGCAGGGAGGACGG - Intergenic
1136408558 16:30063895-30063917 GAAAGGCTCTTCAGGGAGGAGGG - Exonic
1137456203 16:48619872-48619894 GGAGGCAGCTGCAGGGAGGCAGG - Intronic
1137456451 16:48621547-48621569 GGAGGCAGCTGCAGGGAGGCAGG - Intergenic
1138105326 16:54284721-54284743 GGAGAGAGCTGCAGGGCGGAAGG + Exonic
1138554006 16:57761831-57761853 GGATGGTTCTGGGGGGAGGAGGG - Intronic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1139547452 16:67656409-67656431 GGAAGGGTCTGTAGGGAGAAAGG - Exonic
1140141662 16:72264104-72264126 GGAAGGAGCTGAAGGGAGAATGG + Intergenic
1140182681 16:72736205-72736227 GGATGGAGCCCCTGGGAGGAAGG - Intergenic
1140242087 16:73211828-73211850 GGATGGAATGGCAGGGAGGGGGG + Intergenic
1142085671 16:88179015-88179037 GGTTGGGGGTGCAGGGAGGACGG - Intergenic
1142271606 16:89092663-89092685 GGATGGTTTTCCTGGGAGGAAGG - Intronic
1143162740 17:4881889-4881911 GGATGGAGCAGCAGGGAGTGTGG + Intronic
1143204561 17:5132944-5132966 GGATGGAAATGCTGGGAGAATGG + Exonic
1143406022 17:6677695-6677717 GGCTGGCCCTGCAGGGAGGCTGG - Intergenic
1143732956 17:8891381-8891403 GGCTGCATCTGCCCGGAGGAGGG + Intronic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1145760286 17:27421662-27421684 GGATGGAAATGCTGGGAGAATGG + Intergenic
1145798766 17:27670664-27670686 GGATGGAAATGCTGGGAGAATGG - Intergenic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1146883598 17:36456952-36456974 GGATGGAAATGCTGGGAGAATGG - Intergenic
1147128934 17:38394482-38394504 GGCTGGTTCAGCAGGGAGGCTGG - Intronic
1147359785 17:39923404-39923426 GGATGGAGCAGCTGGGAGTATGG + Intronic
1147621524 17:41871326-41871348 GGATGGATCTACTGGGTGGGTGG - Intronic
1148686791 17:49505693-49505715 GGACGGACCTGCAGGCAAGAGGG - Intronic
1150643947 17:66966437-66966459 GGTTGGAACTGCAGTAAGGAAGG - Intronic
1150658109 17:67053742-67053764 GGATGAGTCTGCAGGGCAGACGG - Intronic
1151250475 17:72830017-72830039 TGATGAATATGCAGGAAGGAAGG + Intronic
1151539366 17:74757393-74757415 GGAGGGATGTGGAGGGTGGAAGG + Intronic
1151631351 17:75313200-75313222 GCTTGGAACTGCAGGGAGGTTGG + Intergenic
1151965711 17:77430194-77430216 GGATGGAGCTGGCGGGGGGAGGG - Intronic
1152092962 17:78257106-78257128 GGAAGGATGGGCAGGGAGGCTGG + Intergenic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1153931776 18:9885552-9885574 GGATGTGTCTGCATGGGGGAGGG + Intergenic
1154387081 18:13903694-13903716 GGGTGGTTCTGGAGGGAGGTGGG + Intronic
1154424799 18:14263976-14263998 AGATGGAGCTGCAGGGATGCAGG - Intergenic
1154427482 18:14283311-14283333 AGATGGAGCTGCAGGGATGCAGG - Intergenic
1154428408 18:14289846-14289868 AGTTGGATCTGCAGGGATGCAGG - Intergenic
1154432489 18:14319199-14319221 AGATGGAGCTGCAGGGATGCAGG - Intergenic
1156702625 18:39842778-39842800 GGCTGGATCTGCAGACAGGCTGG - Intergenic
1156850495 18:41720200-41720222 GGATGGGTAGGAAGGGAGGAAGG - Intergenic
1157454370 18:47812894-47812916 GGAAGACTCTGCAGAGAGGATGG + Exonic
1160185682 18:76674705-76674727 GGCTGCATCTGCAGGCTGGAGGG + Intergenic
1160231823 18:77054521-77054543 GGATGGATCAGGATGGAGGCTGG + Intronic
1160742431 19:693388-693410 GGAGGACTCTGCGGGGAGGAGGG + Intronic
1160829805 19:1098461-1098483 GGATGGACGTGCAGGCAGGGTGG + Intergenic
1160862772 19:1244722-1244744 GGCTGGCTCTGCAGGGCAGAGGG - Exonic
1160997197 19:1888264-1888286 GGAAGGGGCTGCAGGGAAGATGG - Intergenic
1161105824 19:2443503-2443525 GGAGGGATCTGCTGGCAGGAGGG - Intronic
1161278691 19:3433633-3433655 GGAGGGGGCCGCAGGGAGGAAGG + Intronic
1161403965 19:4081676-4081698 GGAAGGAAGAGCAGGGAGGAGGG - Intergenic
1161404035 19:4081901-4081923 GGAAGGAAGAGCAGGGAGGAGGG - Intergenic
1162158623 19:8696396-8696418 GGAGAGTTCTGCAGGGATGATGG + Intergenic
1162471131 19:10872319-10872341 GGCCGCCTCTGCAGGGAGGAGGG + Intronic
1162475563 19:10897485-10897507 GGCTGGAACTGCAGGGAAGGGGG - Intronic
1162844500 19:13381925-13381947 GGAGGGTTCTGAGGGGAGGAGGG + Intronic
1163084745 19:14971385-14971407 GTATGGATGTGCAGGGAGTGGGG - Intronic
1163255680 19:16154384-16154406 GGATCCTTCTGCAGGGCGGAAGG - Exonic
1163440369 19:17319742-17319764 GGATGGGCCGGCAGGGAGGCGGG - Exonic
1163826034 19:19525543-19525565 GGAAGGATCTGGAGGGTGCAGGG + Intronic
1164645575 19:29856643-29856665 GGAAGGAACTGCAGGGAGAGGGG + Intergenic
1164669747 19:30065645-30065667 GGAGGTATGTGGAGGGAGGAGGG + Intergenic
1164869483 19:31631408-31631430 GGATGGATCTGCCCGGAGAGTGG - Intergenic
1165090282 19:33383833-33383855 GGATGGCTCTGCATGGGGGTCGG - Intergenic
1165092355 19:33393799-33393821 GGATGCAGCAGCAGAGAGGAAGG - Intronic
1165385010 19:35505218-35505240 GGAAGGGTAGGCAGGGAGGAAGG + Intronic
1165787282 19:38469271-38469293 GGATGGATGGGCAGGGGTGAGGG - Intronic
1165801231 19:38551785-38551807 GGAGGGATCAGCTGGGAGGCAGG - Intronic
1166336755 19:42112864-42112886 GGATGGATGAGCTGGGAGGGAGG - Intronic
1166644339 19:44520035-44520057 GGAGGCAGCTGCAGGGAGGCTGG - Intronic
1166744133 19:45132014-45132036 GGATGGATCTGCAGAGGTAACGG - Intronic
1166881589 19:45933644-45933666 GGGTGGAGGTGCAGGGAGGAGGG + Intergenic
1166892207 19:46000545-46000567 GGGAGGTTCTGCAGAGAGGAGGG + Intronic
1167094264 19:47365600-47365622 GGCTTGGTCAGCAGGGAGGAAGG + Intronic
1167100494 19:47401699-47401721 GGATGGCTCTGGGGAGAGGATGG + Intergenic
1167111088 19:47461799-47461821 TTATTGACCTGCAGGGAGGAAGG - Intronic
1167134934 19:47610194-47610216 GGATGGAGGAGGAGGGAGGAGGG + Intronic
1167469093 19:49665549-49665571 GGATGGGTCTGCACGGAGAGTGG - Exonic
1167643883 19:50695529-50695551 GGAGGGCTCTGGAGGGGGGAGGG - Intronic
1167647813 19:50715343-50715365 GGATGGATATGGGGGGAGGCAGG + Intronic
1168043517 19:53777649-53777671 GCTTGGATCTGCAGAGAGGTTGG - Intergenic
1168257477 19:55174643-55174665 GTATGGATCTGGGGAGAGGAAGG + Exonic
1168349606 19:55668595-55668617 GGACGGGTCTGGAGGGAGGCAGG - Intronic
927282515 2:21321857-21321879 GGATGGAGAGGCAGGGTGGAGGG - Intergenic
927291553 2:21409368-21409390 AGCTGGATCTTGAGGGAGGAAGG - Intergenic
927692715 2:25219628-25219650 GGCTGGCTCTGCAGAGGGGAGGG - Intergenic
928273710 2:29880101-29880123 GGATGGGTCTGCAGAAAAGATGG - Intronic
929031333 2:37652312-37652334 AGAAGGATCTGCTTGGAGGAAGG + Intronic
929417980 2:41762931-41762953 GGATGGACCTGGAGAGATGAAGG - Intergenic
929442810 2:41978713-41978735 GGAGGGAACTGGTGGGAGGATGG - Intergenic
930052667 2:47228682-47228704 GGATGCAGCTTAAGGGAGGATGG - Intergenic
930053429 2:47234488-47234510 GGTGGCATCTGCAGGGAGGAGGG + Intergenic
931475968 2:62587879-62587901 GGCTGCATCTGCAAGGAAGATGG - Intergenic
931492629 2:62765788-62765810 GGAGGGATAGGCAGGGAGAATGG + Intronic
932143338 2:69298224-69298246 GGATGGATGGGCTGGTAGGATGG + Intergenic
932216422 2:69969204-69969226 GGTTGAATCTGCCTGGAGGAAGG + Intergenic
932461252 2:71883339-71883361 GGCTGGATGTGCAGCGAGGCAGG - Intergenic
932842366 2:75095474-75095496 GGTTGGATCAGCATGGAGGGAGG + Intronic
933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG + Intronic
935618692 2:105110563-105110585 TGTGGGATCTGCAGGGAAGAAGG + Intergenic
935718450 2:105959454-105959476 GGGTGGATCTGAAAGGAGGGAGG - Intergenic
936059862 2:109287525-109287547 GGGTGGCTCTGCAGGGTGCATGG - Intronic
936620407 2:114090482-114090504 GGCTGGATCAGCAGGGAAGGGGG + Intergenic
936768844 2:115887466-115887488 GGATGGATCAGGAGGGAGGAAGG - Intergenic
937956832 2:127426440-127426462 GGAGGGGTCTGCAGGAGGGAGGG + Intronic
938232429 2:129672702-129672724 GTATGGAGCAGCAGGGCGGAAGG + Intergenic
938712121 2:133983956-133983978 GGATGCCTGTGCAGGGAGGAAGG + Intergenic
941873520 2:170410244-170410266 GGAATGAACTACAGGGAGGAAGG + Intronic
942043957 2:172088298-172088320 GGATGGACCTGGAGGCGGGAGGG - Exonic
942264545 2:174208745-174208767 TGATGGATATGCATGGAGGAGGG - Intronic
943669007 2:190640998-190641020 GGACAGATCTGCAGGGAAAAGGG - Intergenic
944037080 2:195307942-195307964 GGATGGCTCTGCAGGGGGTGGGG - Intergenic
944932341 2:204532622-204532644 GGGTGGATCTGAAGGGACGTAGG - Intergenic
945488828 2:210430471-210430493 GAATGGATCTGCAGTCAGGGAGG + Intergenic
945515243 2:210755940-210755962 GGATGCTTTTGCAGGGATGAAGG + Intergenic
946338482 2:219054281-219054303 GAATGGACCTGCAGTGAGGGTGG + Intergenic
947446738 2:230169906-230169928 TCATGGAGCTGCAGGGAGAAAGG - Intronic
947910298 2:233796185-233796207 GGAGCGAGCTGCAGGGTGGAAGG - Exonic
948091848 2:235301935-235301957 GGAGGGAGCAGGAGGGAGGAGGG - Intergenic
948107668 2:235428164-235428186 GGCAGGATCAGCAGGGAGGATGG + Intergenic
948143670 2:235692701-235692723 GGAAGGATAAGCAGGGAGGCTGG - Intronic
948345519 2:237294105-237294127 GGCTGAATTTGCAGGGAGGAGGG + Intergenic
948652845 2:239459241-239459263 GGTTGGATGTCCTGGGAGGATGG + Intergenic
1169801273 20:9514851-9514873 GTATGGATCTCCAAGGAAGAGGG + Exonic
1170117276 20:12873680-12873702 GAATGGATCTGAAGGGACAAAGG + Intergenic
1170235683 20:14102537-14102559 GGTTGGATCTGCAGAGAGGCAGG - Intronic
1170280139 20:14637095-14637117 GGAGGGAGCTGGTGGGAGGAAGG + Intronic
1170463601 20:16602043-16602065 GGATGGAGATGCAGGGAGCAAGG - Intergenic
1171290784 20:23981804-23981826 GCATGGACCTCCAGGGAGGGGGG + Intergenic
1171376761 20:24699196-24699218 GGATGGACGTGCAGGGATGAGGG + Intergenic
1171400764 20:24871874-24871896 GGCTGGATGTGCAGCGAGGGTGG + Intergenic
1171460705 20:25296478-25296500 GGCGGGATCTGCAGGTCGGAGGG - Exonic
1171987637 20:31671516-31671538 GGAGGGATGAGCAGGGAAGAGGG - Intronic
1172275530 20:33677009-33677031 GGATGCCCCAGCAGGGAGGAAGG + Intronic
1172699691 20:36845576-36845598 GGCTGGGTCTGCAGGGACGTGGG + Intronic
1172944221 20:38675038-38675060 GCAGGGATTTGCAGGGAGGCTGG + Intergenic
1173146735 20:40531274-40531296 GGATGGAAATGAAAGGAGGAAGG + Intergenic
1173387651 20:42603873-42603895 AGCTGGATATGCATGGAGGAGGG - Intronic
1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG + Intergenic
1173586266 20:44185801-44185823 GGATGGATGGGCAGGCAGGTGGG + Intronic
1173815871 20:45987698-45987720 AGAAGGTTCTGCTGGGAGGAGGG - Intergenic
1173863168 20:46297410-46297432 GGATGGGTCTCCAGGAAGGGTGG + Intronic
1173873374 20:46355354-46355376 GGATGGAGCTGAAGGGTGGAAGG - Intronic
1174819299 20:53713362-53713384 GGAAGGGGCTGCAGGAAGGAGGG - Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175539771 20:59741146-59741168 GCATGGACATGCAGGGAGAAGGG - Intronic
1176843199 21:13856766-13856788 AGATGGAGCTGCAGGGATGCAGG + Intergenic
1176844549 21:13866550-13866572 AGATGGAGCTGCAGGGATGCAGG + Intergenic
1176847282 21:13886113-13886135 AGATGGAGCTGCAGGGATGCAGG + Intergenic
1176849096 21:13899118-13899140 AGCTGGATCTGCAGGGATGCAGG + Intergenic
1178627553 21:34230977-34230999 GGAAGGGGCTTCAGGGAGGATGG - Intergenic
1179282943 21:39950632-39950654 GGAATGACCTGCAGGGAGGATGG - Intergenic
1179416016 21:41199333-41199355 GGAGGGAGCCCCAGGGAGGAGGG + Intronic
1179525072 21:41970834-41970856 GGCTGCATCTGCCTGGAGGAAGG + Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1180999579 22:19981743-19981765 GGATGGATAGGCAGGTAGGTGGG + Intronic
1181198546 22:21204684-21204706 GCATGGACCTCCAGGGAGGGGGG + Intergenic
1181401189 22:22651116-22651138 GCATGGACCTCCAGGGAGGGGGG - Intergenic
1181540906 22:23572897-23572919 GGATTGAGCTGCAAGGAGGAAGG + Intergenic
1181550818 22:23638259-23638281 GGGTTGAGCTGCAAGGAGGAAGG + Intergenic
1181648337 22:24245773-24245795 GCATGGACCTCCAGGGAGGGAGG + Intergenic
1182047836 22:27289499-27289521 TGATGGCTGTGCTGGGAGGAGGG - Intergenic
1182435227 22:30326063-30326085 GGATGGAGCTGAGGGGAGGGAGG + Intronic
1182449867 22:30413273-30413295 GAATGGATATGCAGGGAAGTAGG + Intronic
1182738583 22:32548998-32549020 GGATGGAGCTGGAGGGATGTTGG + Intronic
1182762713 22:32735553-32735575 GGCTGGATTTGCAGGGAAGCTGG - Intronic
1184101132 22:42342305-42342327 GGATGGACAGGCAGGTAGGAAGG + Intronic
1184785431 22:46669279-46669301 GGTTTGATGTGCAGGGAGGTTGG + Intronic
1184999518 22:48236403-48236425 GGGAGGATCTGCTGGGAGTACGG - Intergenic
1185152070 22:49169528-49169550 GGATGGATGGGCAGTGAGTAAGG - Intergenic
1185224021 22:49643001-49643023 GTCTGGATCTGCAGGCAGGAGGG - Intronic
1185258619 22:49849632-49849654 GGATGGAGCGGACGGGAGGAAGG - Intergenic
1203228259 22_KI270731v1_random:90153-90175 GCATGGACCTCCAGGGAGGGGGG - Intergenic
950263596 3:11559448-11559470 GGCCGGTTCTGCGGGGAGGAGGG + Exonic
950434488 3:12970572-12970594 GGCTGGCTGTGCAGGGAGGCTGG - Intronic
951398301 3:22199202-22199224 GGATGGAAAAGCAGGGTGGAGGG - Intronic
952283321 3:31944698-31944720 TGATGGATGTGCTGGGAAGAAGG - Intronic
952340092 3:32438190-32438212 GGTTGGAGCTGGCGGGAGGAGGG + Intronic
953144172 3:40258558-40258580 GGAGGGAGGTGGAGGGAGGAAGG + Exonic
953813857 3:46137218-46137240 TGATGGATCTGTGGGAAGGAAGG + Intergenic
954479877 3:50788820-50788842 GGATGTACGTGCAGGGAGGGAGG + Intronic
955445507 3:59006147-59006169 GGATGGATGGACGGGGAGGAGGG + Intronic
955454795 3:59108098-59108120 GAATGGATCTGAAGGGAAAAGGG + Intergenic
956267940 3:67418713-67418735 GGTTGGAACAGCAGGCAGGATGG - Intronic
956438336 3:69256267-69256289 GGATAGATCTACATGGAGGTAGG + Intronic
957369363 3:79272382-79272404 TGATGTTTCTGCAAGGAGGATGG - Intronic
958980060 3:100709837-100709859 GGAAGGGGCTGGAGGGAGGAGGG + Intronic
959705034 3:109331831-109331853 GGACGGTGCTGCTGGGAGGAAGG - Intronic
961673820 3:128552907-128552929 GGATGGAGCAGCAGGAAGGATGG + Intergenic
961698661 3:128724954-128724976 GGATGGTTCTGCAGTGTGCAAGG + Intergenic
962456621 3:135570886-135570908 GCTTGGACCTGCAGGGAAGATGG - Intergenic
962873326 3:139517138-139517160 GGTTGGATCTCTAGGGTGGAAGG + Intergenic
962888139 3:139647044-139647066 GGTTTGATCTGCAGGAAAGAAGG + Intronic
962920545 3:139946561-139946583 ACAAGGATCTGCAGGGAGGTAGG + Intronic
963723676 3:148894059-148894081 GCTTGGAACTGCAGAGAGGAAGG + Intronic
963769963 3:149379377-149379399 GGATAGATCAGCAGACAGGAGGG - Intergenic
964514517 3:157493370-157493392 GGCTGGATCTGAGGGAAGGATGG + Intronic
965285342 3:166812022-166812044 GGAGGGATGTGGAGGGAGGAAGG + Intergenic
966128301 3:176606298-176606320 GGATGGATCTGCAGGTGGGACGG + Intergenic
967148774 3:186628991-186629013 GGATGGAGTTGCAGGGAGATTGG + Intergenic
967440369 3:189501073-189501095 GGAAGGAAGTGCAGGAAGGAAGG - Intergenic
968090001 3:195893705-195893727 GCATGGCTCAGCAGGGAGGGGGG - Intronic
968470951 4:782049-782071 GGACGGATCTGCTGGGGAGATGG + Intergenic
968584152 4:1408132-1408154 GGATGGACCAGCAGCGGGGAGGG - Intergenic
968938827 4:3627499-3627521 GGCTGGATGTGCATGGAGAATGG + Intergenic
969121948 4:4917274-4917296 GGCTGGAGCTGCAGAGAGGCAGG + Intergenic
969133553 4:5011321-5011343 GGGTGGATTTGGAGGGAGGGAGG + Intergenic
969680312 4:8639677-8639699 GGCTGGAGCAGCAGGAAGGAAGG + Intergenic
970408894 4:15788552-15788574 GGATGAATCTGATGGGAGGTGGG + Intronic
970909828 4:21262060-21262082 GGATGTATCTGTTGGGAGCATGG - Intronic
974862962 4:67545682-67545704 GGGTGGGTCTGCAGGCTGGAGGG - Intergenic
975106226 4:70571821-70571843 GGATGGAGCTGCCAGAAGGAGGG - Intergenic
975153516 4:71045596-71045618 GGATGGAGCTCCTGTGAGGAGGG + Intergenic
977011111 4:91634390-91634412 ATATGGAGCTGCAGGAAGGAAGG + Intergenic
978025435 4:103867645-103867667 GGATGGAGCTCCTGGGGGGAGGG - Intergenic
978483021 4:109216243-109216265 GGATGGATAGGAAGGAAGGAAGG + Intronic
978766475 4:112410213-112410235 GGATGGAGCTGCTGGGAGTCTGG - Intronic
980034997 4:127873101-127873123 GGAGGGGTCTGCAGTGGGGATGG - Intergenic
980182026 4:129413123-129413145 TTATGGATGTGCAGGGATGATGG + Intergenic
981718957 4:147779555-147779577 GGCTGGATGTTCAGTGAGGAAGG + Intronic
983481937 4:168285738-168285760 GGGTGGATATGCATGGGGGATGG + Intronic
983952640 4:173660876-173660898 GGAGGGACCTGGAGGGAGGGAGG + Intergenic
984878612 4:184391027-184391049 GGACAGAGCTGCAGTGAGGAGGG - Intronic
985421005 4:189785288-189785310 GGATGGCTCTGCAGGGTTGCTGG - Intergenic
985644240 5:1077617-1077639 GGAGGGACCTGCAGGCAGGAGGG + Intronic
985721828 5:1493534-1493556 GGAAGGAGCTGCTGGGACGAGGG - Intronic
985747380 5:1654952-1654974 GGGTGGAGTTGCAGGGTGGATGG - Intergenic
985912593 5:2895721-2895743 GGATGGATGTGGAGGGAGTGAGG + Intergenic
986690285 5:10308032-10308054 GGAGGGAACCGCAGAGAGGAAGG + Intergenic
986753596 5:10812525-10812547 GGATGGAGTTCCTGGGAGGAGGG + Intergenic
987135319 5:14894584-14894606 GGATGGATAGGAAGTGAGGAGGG + Intergenic
987251997 5:16109462-16109484 GCATGGAGCTGCCCGGAGGATGG + Intronic
987873597 5:23650539-23650561 GGATGGATGTGCTGGGGGGGTGG - Intergenic
988271715 5:29025823-29025845 GGATGGAGACGCAGAGAGGATGG + Intergenic
988430863 5:31117178-31117200 GAATGGATCTGAAGGGCAGAGGG - Intergenic
990645770 5:57842788-57842810 TGATGGCTCTGCAGTCAGGATGG + Intergenic
991981414 5:72235384-72235406 GGATGAATAGGCAGGGATGAGGG + Intronic
996284026 5:121767882-121767904 GGAAGGGGTTGCAGGGAGGAAGG - Intergenic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
997626287 5:135333149-135333171 GGTAGGATCTGCAGTGTGGATGG - Intronic
997824235 5:137092057-137092079 GGATGGAGTGGCAGGGAGTATGG - Intronic
998816154 5:146016326-146016348 GGATGGATCTATAGGTAGGTAGG + Intronic
999262050 5:150244478-150244500 GGAGGGAACTGCAGAGAGCAGGG + Intronic
1001089011 5:168723295-168723317 GGATGGATGGGCAGGCAGGCAGG - Intronic
1001771789 5:174302391-174302413 AGATGGGGCTTCAGGGAGGAGGG - Intergenic
1002334696 5:178469702-178469724 TGATGGCTCTGCAGACAGGACGG - Intronic
1002660952 5:180790954-180790976 GGAGAGAGGTGCAGGGAGGAAGG - Exonic
1003020922 6:2508774-2508796 GGATGGATGGACAGGGAGAAGGG + Intergenic
1003034865 6:2633604-2633626 GGATGGATGTGCATGCAGGGAGG - Exonic
1003385771 6:5666030-5666052 GGCAGGATCTGGAGGGAGGAAGG + Intronic
1003742124 6:8952867-8952889 TGATGGCTATGCAGGTAGGAGGG - Intergenic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004367686 6:15025755-15025777 GGATGGATCTCCAGAGATGCTGG + Intergenic
1004426938 6:15513136-15513158 GGGTGTGTCTGCAGGGAGGCCGG + Intronic
1004507425 6:16258403-16258425 GGAGGGAAGTGCAGGAAGGAGGG + Intronic
1005154216 6:22785194-22785216 GGATGAATCTGCAGGCAGGCAGG + Intergenic
1005348576 6:24912705-24912727 GGACGAATCTGGAGGGAGAAGGG + Intronic
1006149598 6:31979597-31979619 GGATGGAACTGGAGGGAGGCAGG - Intronic
1006514162 6:34536768-34536790 GGATTGTACTGCAGGGAGGAGGG - Intergenic
1006797592 6:36741503-36741525 GGAAGCCTCTGGAGGGAGGAAGG + Exonic
1007090681 6:39182988-39183010 GGATGGATTGGCAGGGATGTGGG + Intergenic
1008687140 6:53938221-53938243 GGATGGATAGGCAGGGATGGTGG - Intronic
1010250252 6:73699707-73699729 GAATGGATCTGTGGGAAGGAAGG + Intronic
1010852777 6:80798376-80798398 AGATGGAGTTGTAGGGAGGAGGG + Intergenic
1011377619 6:86706762-86706784 GGATGGAGCTCCTGGGAAGAGGG - Intergenic
1012770342 6:103425199-103425221 GATTGGATCTGCAGGGATGGAGG - Intergenic
1013017888 6:106177717-106177739 GAATGAATCTGCAGCGAGGATGG + Intergenic
1017723703 6:157262150-157262172 GGATTGATGTCCAGGGAGGAGGG - Intergenic
1018240319 6:161767785-161767807 GGATGGGAGTGCAGGGAGGTAGG + Intronic
1019326966 7:443262-443284 GGATGGATGAGAATGGAGGATGG + Intergenic
1019326986 7:443363-443385 GGATGGAGATGGATGGAGGATGG + Intergenic
1019527355 7:1486767-1486789 TGTTGCCTCTGCAGGGAGGAAGG + Exonic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1019989267 7:4681057-4681079 GGAAGGAAATGGAGGGAGGAAGG + Intergenic
1020119467 7:5495085-5495107 GGCAGCGTCTGCAGGGAGGATGG + Intronic
1020372190 7:7444417-7444439 AGATGGAGCTGCAGGGAAGAAGG - Exonic
1021140089 7:17013453-17013475 GGATGGGAGAGCAGGGAGGAAGG + Intergenic
1022333769 7:29403645-29403667 AGATGGAGAGGCAGGGAGGAAGG + Intronic
1023360585 7:39411193-39411215 GGATAGTTCGGCAGGGAGGAGGG + Intronic
1023607217 7:41941796-41941818 TGAGGGATCTGAAGGGCGGAAGG - Intergenic
1023666466 7:42527747-42527769 GGATGGAGCTCCTGGGAGAAGGG + Intergenic
1024039579 7:45541892-45541914 GGATGCATCAGCAGGCGGGAGGG + Intergenic
1025957403 7:66193456-66193478 GGATGGAGCTGCAGGAGGAAAGG + Intergenic
1026232100 7:68493787-68493809 GGATGGAACTGCACAGGGGATGG - Intergenic
1026776035 7:73231638-73231660 GGATGGAGCAGGAGGGTGGAGGG + Intergenic
1026796075 7:73366928-73366950 GGATGGGGCTGTGGGGAGGAGGG - Intergenic
1026872427 7:73861203-73861225 GGCTGGATCTGACTGGAGGAAGG - Exonic
1027016892 7:74785009-74785031 GGATGGAGCAGGAGGGTGGAGGG + Intronic
1027071135 7:75160927-75160949 GGATGGAGCAGGAGGGTGGAGGG - Intergenic
1027196661 7:76035262-76035284 AGATGAAACTGGAGGGAGGAAGG - Intronic
1029303516 7:99602202-99602224 GATTGGAGCTGCAGGGAGGGTGG - Intronic
1029572496 7:101379464-101379486 GGAAGGATCTGGAGGGTGAAAGG - Intronic
1030469640 7:109947747-109947769 GGATGGATATGTTGGGAGGCAGG - Intergenic
1030688683 7:112510998-112511020 GGATGGAGATGCAGGGAGTGAGG + Intergenic
1034632806 7:152543843-152543865 GGATGCCACTGCAGGGAGGGTGG + Intergenic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035171621 7:157020689-157020711 GGAAGGATCTGCGAGGAGGCCGG - Intergenic
1035600364 8:893682-893704 GGATAGACCTGCAGGCAGGAGGG - Intergenic
1036032747 8:4991805-4991827 GGAAGGGGCTGCAGGCAGGAAGG - Intronic
1036690785 8:10943513-10943535 GGATGGATCTCCAGGCAGAGGGG - Intronic
1038411088 8:27360503-27360525 GGAGGGACCTGGAAGGAGGAAGG - Intronic
1039196345 8:35035719-35035741 GGATGGAGCAGCTGGGAGCATGG - Intergenic
1039414668 8:37383653-37383675 GCCTGGATTTGCATGGAGGAAGG + Intergenic
1039440983 8:37595187-37595209 GGTTGGAGCTGAGGGGAGGATGG - Intergenic
1039608171 8:38900035-38900057 GACTGGATTTGCAGGAAGGAGGG - Intergenic
1041101103 8:54397168-54397190 GGAAGGCTCTGCAGGGGTGATGG - Intergenic
1043564606 8:81534239-81534261 GAAAGGGTCTGCAGGAAGGAAGG - Intergenic
1043567982 8:81569985-81570007 GCATGGAGCTGCAAGGAGCATGG + Intergenic
1044465999 8:92506463-92506485 TGATGAATCGGCTGGGAGGATGG - Intergenic
1044611832 8:94099284-94099306 ACATGCATTTGCAGGGAGGAGGG + Intergenic
1044771862 8:95644555-95644577 GCCTGGATCTCCAGTGAGGAAGG + Intergenic
1045732942 8:105263246-105263268 GGATGGAGCCCCTGGGAGGAGGG - Intronic
1045904198 8:107323652-107323674 GGATGGATCAGCATGGTAGATGG + Intronic
1045905342 8:107338177-107338199 GGATGTATTTGAAGGGAGCAAGG + Intronic
1046687904 8:117247516-117247538 GGTTGGATCTGAAGGGACCATGG + Intergenic
1046844687 8:118902766-118902788 GGACAGACATGCAGGGAGGAAGG - Intergenic
1048217653 8:132511167-132511189 GGATGGACCTGGTGGGAGTATGG - Intergenic
1048543103 8:135360956-135360978 GGATGGATAAGCAGGTAGGTGGG - Intergenic
1049408129 8:142460709-142460731 GGAGGTACCTTCAGGGAGGAGGG - Intronic
1049511331 8:143028269-143028291 GGATGGGGCTGCAGAGAGGAGGG - Intergenic
1049671961 8:143873884-143873906 GGATGGCTGTGGAGGGAGGGCGG - Intronic
1049744819 8:144258839-144258861 GCATGGACCTGGAGGGAGGCTGG + Exonic
1050622301 9:7467167-7467189 GACTGGATCTCCAGAGAGGAGGG - Intergenic
1050705593 9:8393090-8393112 GGATGTTTCTGCTGGGAGGCTGG + Intronic
1051906501 9:22101225-22101247 GGTTGAGTCTGCAGTGAGGAGGG - Intergenic
1054451915 9:65407821-65407843 GGCTGGATGTGCATGGAGAATGG - Intergenic
1056929827 9:90864970-90864992 TGATTGATCTGCAGTGGGGAGGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057770693 9:97965198-97965220 GGGTGTATCTGCAGGGAAGAGGG - Intergenic
1059248939 9:112871082-112871104 GGCTGGCTCTGAAGGGAGGCAGG + Exonic
1061297090 9:129682591-129682613 GGGTGAAGCTGGAGGGAGGAGGG + Intronic
1061412162 9:130427621-130427643 TGAGGGAGCTGCCGGGAGGAGGG + Intronic
1061485567 9:130918946-130918968 AGCTGGCTCTGCAGGGAGGGTGG - Intronic
1061884171 9:133583297-133583319 GGCTGAGACTGCAGGGAGGATGG + Intronic
1062144504 9:134981506-134981528 TGATGGTTATACAGGGAGGAGGG + Intergenic
1062144540 9:134981721-134981743 TGATGGTTATACAGGGAGGAGGG + Intergenic
1062144593 9:134981970-134981992 GGATGGTTATACAGGGAGAAGGG + Intergenic
1062144615 9:134982078-134982100 TGATGGTTATACAGGGAGGAGGG + Intergenic
1062144638 9:134982189-134982211 TGATGGTTATACAGGGAGGAAGG + Intergenic
1062496491 9:136833874-136833896 GGACGGCTCTGCAGGAAGGAGGG - Intronic
1062657884 9:137613560-137613582 GGTGGGCTCTGCAGGGTGGAAGG + Intronic
1186129798 X:6454229-6454251 GGAGGGGTCTGCAGAGAGAAGGG - Intergenic
1186507116 X:10102048-10102070 GGATGCATGAGCAGGGAGGCAGG + Intronic
1187028523 X:15461036-15461058 GGATGCATCTGCTAGGAGGAAGG - Intronic
1187299373 X:18032884-18032906 TTATGGCTCTGCAGGGAGAAGGG + Intergenic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1188343981 X:29041269-29041291 GGACGTATCTGCAGGCAGGGGGG + Intronic
1188723510 X:33551820-33551842 GGATGGAGTTCCCGGGAGGAGGG - Intergenic
1190420730 X:50281848-50281870 TGAAGGATATGAAGGGAGGATGG + Intronic
1193176502 X:78400799-78400821 GGATGGAGCCCCTGGGAGGAGGG + Intergenic
1194800048 X:98262020-98262042 GGAAGGATCTTCAGGAAGAAGGG + Intergenic
1195252576 X:103063514-103063536 GGATGGATCTGTAGGGAAAATGG - Intronic
1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG + Intronic
1195278765 X:103310187-103310209 AGATGGATCTGCAGAGAAGATGG - Intronic
1196190820 X:112792394-112792416 GGGTGGATCTCCAGGAAGAAAGG + Intronic
1196807025 X:119597429-119597451 GGAAGGCTCTGAAGGTAGGAAGG - Intronic
1200146239 X:153927793-153927815 GGCTGGCTCTGCTGGGTGGAGGG - Intronic
1200759867 Y:7027972-7027994 GGATGGATGAGCAGGGAAGGAGG - Intronic
1201612798 Y:15861634-15861656 GGAGGGGTCTGCAGAGAGAAAGG - Intergenic