ID: 933673620

View in Genome Browser
Species Human (GRCh38)
Location 2:85033100-85033122
Sequence TAGGTGAATTTGGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933673620_933673624 3 Left 933673620 2:85033100-85033122 CCCAGCTACTCCAAATTCACCTA 0: 1
1: 0
2: 0
3: 14
4: 119
Right 933673624 2:85033126-85033148 AGTCTTGTGCACCTAATAAATGG 0: 1
1: 0
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933673620 Original CRISPR TAGGTGAATTTGGAGTAGCT GGG (reversed) Intronic
900434643 1:2623622-2623644 TACATGAGTTTGGAGTAGCCGGG + Intronic
907456033 1:54576085-54576107 TAAGGGAATTTGAAGGAGCTGGG + Intronic
912755114 1:112317905-112317927 TATGTTTATTTGGGGTAGCTTGG - Intergenic
914905093 1:151737479-151737501 TGGCTGAAACTGGAGTAGCTAGG - Intergenic
915901276 1:159848256-159848278 TTGGGGAATCTGGAGGAGCTGGG - Intronic
917205145 1:172563932-172563954 CAGCTGAAGTTGGAGCAGCTGGG - Intronic
918748928 1:188245233-188245255 AAGTTAAATTTGAAGTAGCTAGG + Intergenic
1067210321 10:44255514-44255536 TAGGTGCAATTGAAGTATCTAGG - Intergenic
1073224932 10:101910301-101910323 AAGCTACATTTGGAGTAGCTAGG - Intronic
1076719691 10:132387624-132387646 TTGGTGGATTTGGAGTGTCTGGG + Intergenic
1078426152 11:11252947-11252969 CATGTGAATATGGAGTAGCTTGG + Intergenic
1078683395 11:13502483-13502505 TAGGAGGCTTAGGAGTAGCTAGG - Intergenic
1079461746 11:20686598-20686620 CAGCTGAATTTGTTGTAGCTTGG + Intronic
1081347171 11:42003397-42003419 TATTTGAATTTGGAGTAACTAGG + Intergenic
1086316047 11:85593602-85593624 TGTGTGAATTTGGAGCAACTTGG - Intronic
1092753359 12:11739500-11739522 TAAGTGTGTTTGGAATAGCTTGG + Intronic
1095494340 12:42769072-42769094 TAGGGGAATCTGGCTTAGCTGGG + Intergenic
1097911059 12:64969545-64969567 TAGCTGAACTGGGAGAAGCTTGG - Intergenic
1098824017 12:75270491-75270513 TATGGTAATTTGGACTAGCTAGG - Intergenic
1100541290 12:95560046-95560068 TAGATGAATCTGGAGTTCCTGGG - Intergenic
1104467980 12:129005549-129005571 TAGGTGAGGTAGGAGTGGCTTGG + Intergenic
1104675628 12:130710112-130710134 TGGGTGTTTTTGGAGCAGCTGGG - Intronic
1104706750 12:130953330-130953352 CACGTGTATTTGGAGTAGATCGG + Intergenic
1106845288 13:33731710-33731732 TAGGAGAAAATGGAGTTGCTGGG - Intergenic
1106909928 13:34452726-34452748 TTGGGTAAATTGGAGTAGCTGGG - Intergenic
1107957986 13:45535227-45535249 AAGTTGAGTTTGGAGTAGATTGG + Exonic
1110449491 13:75625621-75625643 TACGTGAGTTTGGAGTAGTTTGG + Intronic
1110708002 13:78617198-78617220 TAGGTGAAATTAGAATAGCCTGG - Intronic
1112380351 13:98882989-98883011 TAAGTGAGTTTGGAGTAGGTTGG - Intronic
1113493172 13:110707984-110708006 CAGGAGAATTTAGAGTAGTTAGG - Intronic
1115797622 14:36956926-36956948 TAGATGAATTTGAAGTACCTAGG - Intronic
1115966658 14:38897276-38897298 TAGGTGAATTTGGAGCTGGCTGG - Intergenic
1116706267 14:48305839-48305861 TAGGTGAATATGTAGTATGTGGG - Intergenic
1120443556 14:84566206-84566228 GAGGTGGACTTGGAGTAGCAGGG + Intergenic
1120570935 14:86116132-86116154 CAGCTGGATTTGGAGCAGCTGGG - Intergenic
1121266282 14:92604409-92604431 TAGGTGGATTTGGAATAGGTTGG + Intronic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1130743350 15:86624880-86624902 TAGATGATTTTTGAGCAGCTGGG - Intronic
1131962871 15:97807755-97807777 TAGGTGATATTGGAGTAGGCAGG + Intergenic
1133511887 16:6467452-6467474 AAGGTGACTTTATAGTAGCTGGG + Intronic
1134612276 16:15618797-15618819 TAGGGGCCATTGGAGTAGCTGGG - Intronic
1138623279 16:58229119-58229141 TTGGGGAATTTGGAGAATCTGGG + Intergenic
1139231596 16:65288332-65288354 TGGGTGACTTTGAATTAGCTAGG - Intergenic
1140033053 16:71353788-71353810 GAGGTGAAATAGCAGTAGCTGGG - Intergenic
1141381751 16:83583214-83583236 GAGATGATTTTGGATTAGCTGGG - Intronic
1144414072 17:15029642-15029664 TAGGTGCATTTGAAGCACCTGGG + Intergenic
1145721382 17:27076100-27076122 TAGGGAAATTTGGAGTAGGAAGG - Intergenic
1146782528 17:35687664-35687686 TAGGAGAATCTCAAGTAGCTGGG + Intronic
1147017865 17:37506852-37506874 TAGGGGAAACTGGAGCAGCTCGG + Intronic
1148999227 17:51739983-51740005 TAAGTAAATTCGGAGTACCTGGG - Intronic
1154243241 18:12671799-12671821 TAAGTTAATTTTAAGTAGCTAGG - Intronic
1157550262 18:48576345-48576367 TAGAAGAATTTGCGGTAGCTGGG + Intronic
1158101512 18:53834800-53834822 TGGCTGAAGCTGGAGTAGCTGGG - Intergenic
1159078310 18:63706609-63706631 AAGGTGAATGTGGAGTAAGTGGG + Intronic
1159704148 18:71665865-71665887 TAGGTGAATTTGGCCTTGATTGG + Intergenic
1163852427 19:19672329-19672351 TAGCTGAATCCTGAGTAGCTGGG + Intronic
925061751 2:896955-896977 TAGCTGGAGTTGGAGTGGCTGGG - Intergenic
925923522 2:8654164-8654186 GTGGTGATTTTGGAGTAGGTGGG - Intergenic
926006883 2:9379335-9379357 CAGGTGAATTTGGACAAGGTTGG + Intronic
929620726 2:43351398-43351420 TAGGTGGAGTTGGAGAAGGTGGG - Intronic
933673620 2:85033100-85033122 TAGGTGAATTTGGAGTAGCTGGG - Intronic
935224854 2:101044641-101044663 TAGGTGTAGCTGGGGTAGCTGGG - Intronic
937695545 2:124804498-124804520 TAGCTGTATTTGGAGTAACAGGG + Intronic
940462281 2:153980379-153980401 TAGGAGATATTAGAGTAGCTTGG + Intronic
941939504 2:171019370-171019392 TAGGTGAATCTGGAGTATTTTGG + Intronic
943444218 2:187963396-187963418 CAGGTAAATTTGGAGAAGCTAGG + Intergenic
944404721 2:199370664-199370686 GAGGGGAATTTGGATTATCTGGG - Intronic
944648805 2:201807891-201807913 TACTTGAACTTGGAGAAGCTGGG + Exonic
946584615 2:221170765-221170787 TCTGTGAATTGGGAGGAGCTGGG + Intergenic
1169177890 20:3534506-3534528 TTAGTGCATTAGGAGTAGCTGGG + Intronic
1172050945 20:32117538-32117560 GGGGTGAATTTGGAGTGGCTGGG + Intronic
1176511115 21:7748857-7748879 CAGGTCAATTTGGAGTTCCTAGG - Intronic
1176522438 21:7834576-7834598 GAGGAGAATGTGGAGTAGCGGGG - Intergenic
1178010225 21:28276272-28276294 TATATGAATTTGGAGTAGGAGGG + Intergenic
1178645229 21:34379386-34379408 CAGGTCAATTTGGAGTTCCTAGG - Intronic
1178656458 21:34464588-34464610 GAGGAGAATGTGGAGTAGCGGGG - Intergenic
1178905795 21:36635043-36635065 TAGGTGAAGTTGGAGGTGCTGGG - Intergenic
1183247601 22:36705847-36705869 TAGGTGGCTTGGCAGTAGCTGGG - Intergenic
1184185321 22:42861025-42861047 CATGTGAGTTTGGACTAGCTGGG + Intronic
949905408 3:8854567-8854589 TAGGTGAAGTCTGAGTAGCAGGG + Intronic
951324552 3:21286425-21286447 TAGTTGCAGTTGGAGTGGCTGGG - Intergenic
954145759 3:48633525-48633547 CAGGAGCATTTGGAGGAGCTGGG - Exonic
957694295 3:83614302-83614324 TAGTTGAGTTTGTTGTAGCTTGG - Intergenic
957768557 3:84658418-84658440 TGGCTGGATTTGGAGTGGCTGGG - Intergenic
959137539 3:102442964-102442986 TAGTTGAATTTAGAGTACCAAGG + Intronic
960703824 3:120462742-120462764 TAGTTGAACTTGGAGTATTTGGG + Intergenic
963494869 3:146045831-146045853 TAGCTGGAGTTGGAGTGGCTGGG + Intergenic
965426124 3:168525462-168525484 TATGTGAATTTTGAGAAGCATGG + Intergenic
965492211 3:169351892-169351914 TAGGTGAATTTGGACTAAAGAGG - Intronic
965848770 3:172995830-172995852 TAGATGAAGCTGGAGAAGCTGGG - Intronic
972082244 4:35167676-35167698 TAGGGGAGTTAGGAGTAGCATGG - Intergenic
973802873 4:54496261-54496283 CAGGGGAATTTGGAGTCACTGGG + Intergenic
974264925 4:59573844-59573866 TAGGTAATTTTGTAGTAACTGGG + Intergenic
976634371 4:87273004-87273026 AAGGTGTATAGGGAGTAGCTGGG - Intergenic
977052373 4:92144883-92144905 TGAGTGATTTTGGAGTAGATGGG - Intergenic
977668318 4:99666983-99667005 TATGTGTCTTTGGAGTATCTGGG - Intergenic
980989209 4:139724600-139724622 TAGGTAACTTTTGAGAAGCTAGG + Intronic
986931853 5:12834724-12834746 AAGGTGAATTTAAAGTACCTGGG - Intergenic
987813597 5:22871796-22871818 TATGTGAATGTGGAGAAACTAGG - Intergenic
988446634 5:31293441-31293463 TTGGTGAATTTAGGGAAGCTTGG - Intronic
990938199 5:61173125-61173147 TAGGGGAAGTTGGAGAAGGTGGG - Intergenic
990986127 5:61642495-61642517 TAGGAGAAGTGGAAGTAGCTAGG - Intronic
992615881 5:78545673-78545695 TAGGTGCATTTGGAAAAGCTGGG - Intronic
993621369 5:90172052-90172074 TAAGTGAAATTGTAGTAGATTGG - Intergenic
994678079 5:102849876-102849898 GAGCAGGATTTGGAGTAGCTGGG + Intronic
995778846 5:115754957-115754979 TGGGTGAATTTGAAGGGGCTGGG - Intergenic
1002392818 5:178929054-178929076 TGGGTGGATCTGGAGTAGCTGGG + Intronic
1002392910 5:178929744-178929766 GAGGTGACTTTGGAATAACTGGG - Intronic
1005436690 6:25819718-25819740 CAGCTGGAATTGGAGTAGCTTGG - Exonic
1006686039 6:35835088-35835110 TAGGTGAATTTGGCCTTGGTTGG - Exonic
1007919699 6:45595450-45595472 TAGGTGACTCTGAAATAGCTGGG + Intronic
1012045592 6:94269041-94269063 TATATGAATTTGGAGTAGTGGGG - Intergenic
1018056758 6:160058817-160058839 TAGTGGGATTTGGAGTTGCTAGG + Intronic
1019373212 7:674398-674420 TAGGTATACATGGAGTAGCTGGG - Intronic
1028239699 7:88404651-88404673 AAGGTGAATTTGGAGCAGAGGGG + Intergenic
1031959277 7:127974322-127974344 AAGGTGAATTTGGAGTGGTTTGG + Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1037933506 8:22898818-22898840 GGGGTGAATTTGGAGGGGCTGGG + Intronic
1038980036 8:32749822-32749844 TATGTGAATTTGCAGCAGGTAGG - Intronic
1043201228 8:77372367-77372389 TAGCTGGAGTTGGAGTGGCTGGG - Intergenic
1045392750 8:101731743-101731765 TAGATGGACTTGGAGTAGCTGGG - Intronic
1046331384 8:112719776-112719798 TATGTAAATTTGAAGTAGTTAGG + Intronic
1047092389 8:121588477-121588499 TGGGTGAATTTGGAGCTGATAGG - Intergenic
1047702609 8:127464733-127464755 TAGCTGAATTTGGACAACCTTGG - Intergenic
1047904735 8:129460599-129460621 TTGGAGAATTTGGAGCACCTGGG - Intergenic
1050204067 9:3179190-3179212 TAGCAGAATTTTGAGTGGCTAGG - Intergenic
1052164977 9:25315040-25315062 TACGTGATTTTGTAGTAGATAGG + Intergenic
1060368599 9:123046014-123046036 TGGGTGAATGTGGAGTGGCCTGG + Intronic
1187434410 X:19253858-19253880 TAGGTGAAGATGAAGTAGGTGGG + Intergenic
1192369374 X:70500424-70500446 TTGGTGAATAGGGAGTGGCTGGG + Intronic
1194169461 X:90564120-90564142 TGGGTGAAGCTGGAGTGGCTTGG - Intergenic
1194435041 X:93859852-93859874 CAGCTGAAGCTGGAGTAGCTGGG - Intergenic
1196437833 X:115691187-115691209 CAGCTGAATTTGGAGTGGTTAGG + Intergenic
1200515703 Y:4141894-4141916 TGGGTGAAGCTGGAGTGGCTTGG - Intergenic