ID: 933683091

View in Genome Browser
Species Human (GRCh38)
Location 2:85120193-85120215
Sequence AGCAAATGGCTTTCCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933683091_933683095 6 Left 933683091 2:85120193-85120215 CCCTCACAGGAAAGCCATTTGCT No data
Right 933683095 2:85120222-85120244 AGGAATTAGCTAGCCCTGAGAGG No data
933683091_933683096 7 Left 933683091 2:85120193-85120215 CCCTCACAGGAAAGCCATTTGCT No data
Right 933683096 2:85120223-85120245 GGAATTAGCTAGCCCTGAGAGGG No data
933683091_933683100 22 Left 933683091 2:85120193-85120215 CCCTCACAGGAAAGCCATTTGCT No data
Right 933683100 2:85120238-85120260 TGAGAGGGGCAGTCTCTCCCAGG No data
933683091_933683097 8 Left 933683091 2:85120193-85120215 CCCTCACAGGAAAGCCATTTGCT No data
Right 933683097 2:85120224-85120246 GAATTAGCTAGCCCTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933683091 Original CRISPR AGCAAATGGCTTTCCTGTGA GGG (reversed) Intergenic
No off target data available for this crispr