ID: 933687307

View in Genome Browser
Species Human (GRCh38)
Location 2:85152970-85152992
Sequence GAGCATGCCCTTTCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933687307 Original CRISPR GAGCATGCCCTTTCAAAAAC AGG (reversed) Intronic
903845109 1:26275160-26275182 GACCTTTCCCTTTCAAACACTGG - Intronic
907794076 1:57696714-57696736 GATCTTACCCTTTCTAAAACAGG + Intronic
907910122 1:58818097-58818119 GAGCATCCCATTTCACAAATAGG + Intergenic
912787208 1:112616122-112616144 GTGCATGCCCCTTCTAAAAGAGG - Intronic
917494336 1:175526401-175526423 GATCATGCATTTTCAAAAAATGG - Intronic
918169178 1:181979346-181979368 AAGCATTCCCTTTGAAAACCCGG + Intergenic
923058694 1:230450677-230450699 AAGAATGCCCTTTCCAAAAAGGG - Intergenic
924211054 1:241767729-241767751 GATTATTTCCTTTCAAAAACTGG - Intronic
924564129 1:245181941-245181963 GATCATTCCCTTCCAAAAAGTGG + Intronic
1063278717 10:4600738-4600760 GATCTTGCCCTTTATAAAACAGG + Intergenic
1065024623 10:21527859-21527881 GAGCTAGCCCTTTCAAAAACGGG + Intergenic
1067230776 10:44407783-44407805 AAGCATTCCCTTTGAAAAACTGG - Intergenic
1069188642 10:65460384-65460406 AAGCATTCCCATTCGAAAACTGG - Intergenic
1074098873 10:110337430-110337452 GACCATGTCCTTTCAAAATGTGG - Intergenic
1076985444 11:232880-232902 GAGCATCCCCTGTGAGAAACAGG + Intronic
1079336209 11:19572960-19572982 CAGCATGCCTTTTGAAAAACTGG + Intronic
1081410615 11:42753462-42753484 AAGTATTCCCTTTGAAAAACCGG - Intergenic
1082806571 11:57455551-57455573 GTCCAGGCCCTTTCTAAAACAGG - Intergenic
1082900215 11:58240965-58240987 AAGGATGCCCTTTCAATAAATGG - Intergenic
1087194518 11:95292281-95292303 AAGCATGGCCTTTCAAAGAAGGG - Intergenic
1089183256 11:116597280-116597302 GAGCATGACTTTTCAAATACAGG + Intergenic
1090308148 11:125709027-125709049 AAGCATTCCCTTTGAAAACCAGG + Intergenic
1092111353 12:5966998-5967020 CAGCATGGCCTGGCAAAAACAGG + Intronic
1092623014 12:10294326-10294348 GAGGATGCACTTTGACAAACTGG - Intergenic
1096876133 12:54631785-54631807 GAACAAGCCCTTGCAAAAGCAGG - Exonic
1099699514 12:86065625-86065647 AAGCATTCCCTTTGAAAAACGGG + Intronic
1104894350 12:132154467-132154489 GCGCATGCCCTCTGAAATACAGG + Intergenic
1106213235 13:27670242-27670264 AAGCATGCCCTTTTACACACAGG + Intergenic
1106268303 13:28129670-28129692 GAGCATGCCCTATCATAGAATGG - Intergenic
1106868043 13:33988597-33988619 AAGCATTCCCTTTGAAAAAGGGG + Intergenic
1108151094 13:47535297-47535319 AAGCATTCCCTTTGAAAACCTGG + Intergenic
1108783734 13:53868845-53868867 AAGGATGCCACTTCAAAAACTGG - Intergenic
1116688257 14:48071222-48071244 CAGAATGACCTTTTAAAAACAGG - Intergenic
1122471615 14:101971034-101971056 GGGCATGCCCTCTCAAAGTCTGG - Intronic
1123221806 14:106864583-106864605 AAGCATTCCCTTTGAAAAAATGG + Intergenic
1123543942 15:21323929-21323951 GACCATCCCCTTTCAAATTCAGG - Intergenic
1124948064 15:34289060-34289082 AAGCATTCCCTTTGAAAACCGGG - Intronic
1128617298 15:69120311-69120333 GTGAAAGCCCTTTGAAAAACAGG + Intergenic
1129023691 15:72548309-72548331 GAGAATGTACTTTCAAGAACTGG + Intronic
1133514000 16:6489690-6489712 ACTCATGCTCTTTCAAAAACAGG - Intronic
1134250976 16:12573676-12573698 GAGGATGCCCTTGCAAAAATTGG + Exonic
1138283514 16:55790663-55790685 GAGCATTACCTTTTAAAAATGGG - Intergenic
1138285488 16:55806324-55806346 GAGCATTACCTTTTAAAAATGGG + Exonic
1141161762 16:81633771-81633793 GACCATTCCCTTTGGAAAACTGG + Intronic
1142751584 17:1991808-1991830 GAGCATGCAAGTTCAGAAACTGG - Intronic
1145281238 17:21468438-21468460 GAGCAAGCCCTCCCAAAATCTGG + Intergenic
1149980300 17:61305399-61305421 GAGCATGGCCTTTGAAAGATTGG + Intronic
1150203230 17:63378636-63378658 GAGCTTTCTCTTTCATAAACAGG + Intronic
1154556014 18:15755061-15755083 GAACATTCCCTTTCAAGAGCAGG + Intergenic
1156230987 18:35153763-35153785 CAGCATGCTATTTTAAAAACAGG - Intergenic
1157659137 18:49423497-49423519 GAGCAAACACTTTCAAAAGCTGG + Intronic
1163687917 19:18722605-18722627 CATCATGTCCATTCAAAAACTGG - Intronic
1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG + Intronic
1168462864 19:56574849-56574871 GAGAATAACCATTCAAAAACTGG - Intronic
1168495554 19:56845319-56845341 GAGTATCCCCTTTCAAATATAGG - Intergenic
1168544143 19:57236112-57236134 GAGTATGCCATTTGTAAAACAGG + Intergenic
927281177 2:21308220-21308242 AATCTGGCCCTTTCAAAAACTGG + Intergenic
928417680 2:31110103-31110125 GAGCCTCATCTTTCAAAAACTGG + Intronic
929415147 2:41739683-41739705 AAGCATTCCCTTTGAAAAAGGGG - Intergenic
930981402 2:57530032-57530054 AAGCATTCCCTTTGAAAAACTGG + Intergenic
933554261 2:83811926-83811948 GAGCATTCTCTTTAAAATACAGG + Intergenic
933687307 2:85152970-85152992 GAGCATGCCCTTTCAAAAACAGG - Intronic
933823066 2:86132354-86132376 GTACATGGCCTTTTAAAAACCGG + Exonic
936166203 2:110121937-110121959 GCTCATGTTCTTTCAAAAACAGG + Intergenic
936566541 2:113586896-113586918 CAGCAAGCCCGTTCAAGAACGGG - Intergenic
937774533 2:125760632-125760654 GAGCATGGCTTTGCGAAAACAGG - Intergenic
940576864 2:155519244-155519266 AGGCATTCCCTGTCAAAAACGGG - Intergenic
941051879 2:160743886-160743908 AAGGATGCCCTTTTAAAAGCAGG + Intergenic
943395489 2:187328276-187328298 GAGCATACACTTTCAGAAACAGG - Intergenic
944094358 2:195949679-195949701 AAGCATTCCCTCTGAAAAACCGG - Intronic
944386827 2:199174895-199174917 GGGTATGACCTTTGAAAAACTGG + Intergenic
944702280 2:202256906-202256928 GAGCAAGCTCTTTAAAATACTGG - Intergenic
945371505 2:209024220-209024242 AAGCATTCCCTTTGAAAAGCTGG + Intergenic
1173579630 20:44137780-44137802 AATCCTGCCCTTTCAAAGACTGG + Intronic
1173942437 20:46922996-46923018 GAACATTCCATTTCAAAAAAAGG + Intronic
1182600274 22:31457520-31457542 AAACATGCTTTTTCAAAAACTGG + Intronic
952548252 3:34446425-34446447 AAGCATTCCCCTTGAAAAACCGG - Intergenic
955609405 3:60741158-60741180 CAGAATGCTCTTGCAAAAACAGG - Intronic
956093844 3:65695498-65695520 GAGTTGGCCCTTTCAAGAACAGG - Intronic
956419499 3:69072135-69072157 GAGCATGCAATTTAAAAAGCAGG + Intronic
956441221 3:69282031-69282053 GAGTATGTCATTTGAAAAACTGG - Intronic
957367796 3:79249230-79249252 GAGAAAGCCCTTTAAAAAGCGGG + Intronic
972914486 4:43858890-43858912 AAGCATTCCCTTTGAAAACCGGG - Intergenic
973018340 4:45169251-45169273 AAGCATTCCCTTTGAAAACCAGG - Intergenic
978548224 4:109896376-109896398 AAGCATTCCCTTTGAAAAAAGGG - Intergenic
978892753 4:113849681-113849703 AAGCAGGCACTTTCAGAAACAGG + Intergenic
979087079 4:116427009-116427031 GGGCATGCTGTTTCAAAAGCAGG - Intergenic
981542380 4:145859434-145859456 GACCGTACCCTATCAAAAACAGG - Intronic
981810066 4:148763805-148763827 AAGCATTCCCTTTGAAAAACTGG + Intergenic
986275538 5:6272032-6272054 GAGCATGCCTTTTCTAGAAGAGG + Intergenic
988124603 5:27013181-27013203 GAGCATACCCAGTCAAAAACTGG + Intronic
988187040 5:27878979-27879001 GAGCATGCCTTTTAAGAAATTGG + Intergenic
988659660 5:33251508-33251530 AAACATGCCCTTTAGAAAACAGG - Intergenic
989184940 5:38614624-38614646 GAGCCTGGCCATTCAAAAGCTGG - Intergenic
990067840 5:51740174-51740196 GAGCAAACCCATTCAAAAGCTGG - Intergenic
990511869 5:56496848-56496870 GAGAATGGTCTGTCAAAAACAGG - Intergenic
992942215 5:81773623-81773645 GAGCATTCCCTTTCCATTACAGG + Intergenic
996057146 5:118994008-118994030 AAGCATTCCCTTTGAAAAACTGG - Intergenic
996902437 5:128557983-128558005 AAGCATTCCCCTTGAAAAACTGG + Intronic
999654005 5:153795074-153795096 GAGCAGGCCCTTTGAAAAAAAGG - Intronic
1000490258 5:161904112-161904134 AAGCATTCCCTTTGAAAACCAGG - Intergenic
1000673397 5:164090333-164090355 GGGCATTCCCTTTGAAATACTGG - Intergenic
1004027674 6:11835133-11835155 CAGCATGCCCTTTTAAGAGCAGG + Intergenic
1004355012 6:14923143-14923165 CAATATGCCCTTTCAAAAATTGG - Intergenic
1008242919 6:49134260-49134282 GATAATGTCCTTTCAAGAACTGG + Intergenic
1008324708 6:50163622-50163644 AAGCATTCCCTTTGAAAACCAGG - Intergenic
1008379584 6:50826177-50826199 GTGCAGGCCCTTTTAAAGACTGG - Intronic
1008736944 6:54556509-54556531 AAGCATTCCCTTTTGAAAACCGG + Intergenic
1009937589 6:70251943-70251965 CAGCATGCCTTTTCAGAAAATGG - Intronic
1010791592 6:80071178-80071200 AAGCATGACTTTTTAAAAACTGG - Intergenic
1016734672 6:147464049-147464071 TATCATGCCTTTTAAAAAACTGG + Intergenic
1017998250 6:159553741-159553763 GCTCATGCCCTTTAGAAAACAGG + Intergenic
1020747906 7:12101032-12101054 GAGCATTCCCTTTGAGAAACGGG - Intergenic
1021507156 7:21398436-21398458 GAGCAGGCCCTGTGACAAACTGG - Intergenic
1021669517 7:23021227-23021249 GATGATGCCCTTTCAATGACAGG - Intergenic
1022693809 7:32684772-32684794 AAGCATTCCCTTTGAAAAACTGG - Intergenic
1022696573 7:32712059-32712081 AAGCATTCCCTTTGAAAAACTGG + Intergenic
1023390664 7:39708583-39708605 GAGCACAACCTTTCAAAATCTGG + Intergenic
1023459707 7:40382475-40382497 GAGTATTTCCTTTCAAAAAAAGG - Intronic
1026555980 7:71409081-71409103 TGGCATGCCATTTCCAAAACTGG - Intronic
1028580514 7:92404640-92404662 CAGCATCCACTTTGAAAAACAGG + Intergenic
1033110773 7:138573274-138573296 GAGGACGCTATTTCAAAAACAGG - Intronic
1034546746 7:151794367-151794389 GAGCACGCCCTTTAAAATCCAGG + Intronic
1042167471 8:65959562-65959584 AAACACGCCCTTTCAAAAAGGGG - Intergenic
1046393793 8:113612166-113612188 AAGCATTCCCTTTGAAAAACTGG + Intronic
1052476552 9:28968267-28968289 GACATTTCCCTTTCAAAAACTGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1057819462 9:98319821-98319843 GAGCAGGCCCTTTCCACAAGAGG - Intronic
1057870275 9:98711397-98711419 TAGCATGCCCTTCAAAACACTGG - Intergenic
1059470299 9:114499974-114499996 GAGAATGCCCTTAAAAAAATCGG - Intronic
1062433698 9:136536779-136536801 GAGCATGCCCCTTAAGAACCAGG - Intronic
1203366096 Un_KI270442v1:258079-258101 AAGCATTCCCTTTGAAATACTGG + Intergenic
1188653402 X:32659892-32659914 GAGCCTGCCATTTCAAAGAATGG + Intronic
1189966092 X:46375470-46375492 GGCCATGCCATTTCAAAAACTGG - Intergenic
1191579578 X:62745285-62745307 GAGCAAGCACATTCAAAAGCTGG + Intergenic
1195607792 X:106828857-106828879 AAGCATTCCCTTTTGAAAACTGG + Intronic
1195733997 X:107994731-107994753 GAGGATGCCCATTCTAATACAGG + Intergenic
1196544969 X:116951751-116951773 TAGCATGCCTTTTGAAAGACAGG + Intergenic
1197959979 X:131993559-131993581 AAGCATTCCCTTTAAAAGACAGG + Intergenic
1198617704 X:138477753-138477775 GAGCATGGCCTTCCAAAATCAGG + Intergenic
1198622945 X:138534188-138534210 GAGCAAGCCCCATCAAAACCAGG + Intergenic
1199012995 X:142778894-142778916 GTGCATCCCCTTTGAGAAACAGG - Intergenic
1200733703 Y:6771063-6771085 AAGCATTCCCTTTGAAAAAATGG - Intergenic