ID: 933698098

View in Genome Browser
Species Human (GRCh38)
Location 2:85235406-85235428
Sequence TTGGTTTATCACCACCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 1, 2: 7, 3: 142, 4: 535}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933698090_933698098 22 Left 933698090 2:85235361-85235383 CCATTTCTTTATCCTACAATCTA 0: 1
1: 0
2: 3
3: 36
4: 370
Right 933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG 0: 1
1: 1
2: 7
3: 142
4: 535
933698088_933698098 29 Left 933698088 2:85235354-85235376 CCCGAAGCCATTTCTTTATCCTA 0: 1
1: 0
2: 3
3: 36
4: 319
Right 933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG 0: 1
1: 1
2: 7
3: 142
4: 535
933698087_933698098 30 Left 933698087 2:85235353-85235375 CCCCGAAGCCATTTCTTTATCCT 0: 1
1: 0
2: 3
3: 28
4: 376
Right 933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG 0: 1
1: 1
2: 7
3: 142
4: 535
933698093_933698098 10 Left 933698093 2:85235373-85235395 CCTACAATCTAGGATGCAGTGGA 0: 1
1: 0
2: 2
3: 7
4: 116
Right 933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG 0: 1
1: 1
2: 7
3: 142
4: 535
933698089_933698098 28 Left 933698089 2:85235355-85235377 CCGAAGCCATTTCTTTATCCTAC 0: 1
1: 1
2: 1
3: 19
4: 254
Right 933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG 0: 1
1: 1
2: 7
3: 142
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933698098 Original CRISPR TTGGTTTATCACCACCCTCT GGG Intronic
900713033 1:4127077-4127099 AGGGTTTAGCACCATCCTCTTGG + Intergenic
900877891 1:5358778-5358800 ATGGTTTAACACCACCTCCTTGG + Intergenic
900902931 1:5528897-5528919 GTGGTTTAGCACCATCCTCTTGG + Intergenic
901254885 1:7814983-7815005 TTGGTTTCTGACCACCATTTTGG - Intronic
901364621 1:8735690-8735712 ATGGTTTAGCACCATCCCCTCGG + Intronic
901744752 1:11364804-11364826 ATGGTTTAGCACCATCCTCTTGG + Intergenic
902115827 1:14120350-14120372 ATGGTTTAGCATCATCCTCTTGG - Intergenic
902246107 1:15121730-15121752 GTGGTTTAGCACCATCCTCTTGG + Intergenic
902322575 1:15678819-15678841 ATGGTTGAGCACCATCCTCTTGG - Intergenic
903898703 1:26626407-26626429 TTCCTTTATCATCAGCCTCTAGG + Intergenic
904016888 1:27428553-27428575 TTTATCTACCACCACCCTCTAGG - Intronic
905603171 1:39271409-39271431 ATGGTTTAGCACCATCCCCTTGG - Intronic
905776578 1:40671493-40671515 ATGGTTTAGCACCATCCCCTTGG + Intergenic
906375605 1:45294211-45294233 ATGGTTTGGCACCATCCTCTTGG + Intronic
906857657 1:49325784-49325806 ATGGTTTAGCACCATCGTCTTGG + Intronic
907223297 1:52922861-52922883 ATGGTTTAGCACCATCCCCTTGG - Intronic
908454877 1:64293920-64293942 ATGGTTTAGCACCACCCACTTGG - Intergenic
909241057 1:73213454-73213476 TTGGTTTAGTACCATCCCCTTGG - Intergenic
909258046 1:73449347-73449369 ATGGTTTAGCACCATCCTCCTGG - Intergenic
909553404 1:76925182-76925204 GTGGCTTAACACCATCCTCTTGG - Intronic
909773656 1:79457618-79457640 ATGGTTTAGCACCATCCTCTCGG + Intergenic
909834772 1:80240187-80240209 GTGGTTTAGCACCATTCTCTTGG + Intergenic
909861532 1:80611788-80611810 ATGGGTTAACACCATCCTCTTGG - Intergenic
910402648 1:86852760-86852782 ATGGTTTAGCACCATCCCCTTGG - Intergenic
910424213 1:87102418-87102440 ATGGTTTAGCACCATCCCCTTGG - Intronic
910481208 1:87660392-87660414 ATGGTTTAGCACCATCCTCTTGG - Intergenic
910832355 1:91473670-91473692 TAGGTTCAGCACCCCCCTCTTGG - Intergenic
911249915 1:95563773-95563795 ATGGTTTAGCACCGCCCACTTGG - Intergenic
911339980 1:96624110-96624132 ATGGTTCAGCACCATCCTCTTGG + Intergenic
911811208 1:102284398-102284420 ATGGTTTAGCACCACCCCTTTGG - Intergenic
911922545 1:103784035-103784057 GTGGTTTAGCACCATCCTCTTGG - Intergenic
912108054 1:106305499-106305521 GTGGTTTAGCACCATCCCCTGGG - Intergenic
912183623 1:107248689-107248711 TTGCATTTTCACCACCCTCCTGG - Intronic
913052842 1:115132090-115132112 ATGGCTTAGCACCATCCTCTTGG - Intergenic
913377361 1:118167844-118167866 ATGGTTTAGAACCATCCTCTGGG + Intronic
914904922 1:151736128-151736150 ATGGTTTAGCACCATCCCCTTGG + Intergenic
914905243 1:151738451-151738473 ATGGTTTAGCACCATCCCCTTGG + Intergenic
914967286 1:152271348-152271370 ATGGTTTAGCACCATCTTCTTGG - Intergenic
914969082 1:152290765-152290787 ATGGTTTAGCACCATCTTCTTGG + Intergenic
915874910 1:159602177-159602199 ATGGTTTAGTACCATCCTCTTGG + Intergenic
916348856 1:163826102-163826124 TTGCTCTATCTCCACACTCTAGG + Intergenic
916466841 1:165081468-165081490 ATGGTTTAACACCATCCTCTTGG - Intergenic
917004019 1:170391813-170391835 TTGGTTTAGCACCAACTCCTTGG + Intergenic
917100266 1:171438169-171438191 ATGGTTTAGCACCATCCTTTTGG - Intergenic
917101095 1:171446115-171446137 ATGGTTTAGCACCATCCTCTTGG + Intergenic
917365883 1:174231832-174231854 ATGGTTTAGCACCATCCCCTCGG - Intronic
917406618 1:174713466-174713488 ATGGTTTAGCACCATCCCCTTGG + Intronic
918227363 1:182496251-182496273 ATGGATTATCACCATCCCCTTGG - Intronic
918757568 1:188357190-188357212 ATGGTTTAGCACCATTCTCTTGG - Intergenic
919061328 1:192637263-192637285 TTTGTTTTTCAATACCCTCTTGG - Intronic
920607560 1:207404200-207404222 ATGGTTTAGCACCATCCACTTGG + Intergenic
920615711 1:207490954-207490976 ATGGTTTAGCACCATCCCCTTGG - Intergenic
921013705 1:211168234-211168256 GTGGTTTAGCACCATCCACTTGG - Intergenic
921014033 1:211170578-211170600 ATGGTTTAGCACCATTCTCTTGG - Intergenic
921933923 1:220778492-220778514 ATGGTTTAGCACCACCACCTTGG - Intronic
922073242 1:222217116-222217138 CTGGTTTATCAGCATCCTGTGGG - Intergenic
922760537 1:228127285-228127307 ATGGTTTAGCACCATCCTCTTGG - Intergenic
922999542 1:229995348-229995370 ATGGCTTAGCACCATCCTCTTGG + Intergenic
923067554 1:230532718-230532740 ATGGTTTAGCACCATCCTTTTGG + Intergenic
923321814 1:232841886-232841908 ATGGTTTAACACCATCCCCTCGG - Intergenic
924049983 1:240070874-240070896 ATGGTTTATTCCCACCCCCTTGG - Intronic
924278077 1:242408451-242408473 ATGGTTTAGCACCATCCTGTTGG + Intronic
924313984 1:242776661-242776683 ATGGTTTAGTACCATCCTCTTGG - Intergenic
924835430 1:247642240-247642262 TAGGTTAACTACCACCCTCTTGG + Intergenic
1062951039 10:1503708-1503730 ATGGTTTAGCACCATCCTCTTGG + Intronic
1063217375 10:3936861-3936883 ATGGTTTAACACCATCCTCCTGG + Intergenic
1063480006 10:6367229-6367251 ATGGTCTAGCACCATCCTCTTGG - Intergenic
1064126918 10:12670363-12670385 TTGGATTATCATCACATTCTTGG + Intronic
1064259872 10:13776822-13776844 TGGGTCTAACACTACCCTCTGGG + Intronic
1065155169 10:22862260-22862282 TTGGTTTATTGCCTTCCTCTTGG - Intergenic
1065207676 10:23372768-23372790 ATGGTTTAGCACCATCCACTTGG - Intergenic
1065444119 10:25780135-25780157 ATGGTTTACCACCATCCCCTTGG - Intergenic
1065872938 10:29971549-29971571 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1065940412 10:30559294-30559316 CTGGTTTATGACCTTCCTCTAGG + Intergenic
1066001908 10:31112444-31112466 ATAGTTTAGCACCATCCTCTTGG - Intergenic
1066128123 10:32362367-32362389 ATGATTTAGCACCATCCTCTTGG + Intronic
1066253064 10:33652887-33652909 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1066278867 10:33895599-33895621 ATGGTTTAGCGCCATCCTCTTGG + Intergenic
1066295741 10:34052718-34052740 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1066376932 10:34866002-34866024 GTTGTTTATCACCACCTACTAGG + Intergenic
1066695737 10:38076191-38076213 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1066751356 10:38660207-38660229 CTGGTTTATCCCCATCCTTTTGG - Intergenic
1066965687 10:42262885-42262907 CTGGTTTATCCCCATCCTTTTGG + Intergenic
1066996800 10:42571373-42571395 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1067249158 10:44572619-44572641 ATGGTTTAGCATCATCCTCTTGG + Intergenic
1067580956 10:47445180-47445202 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1067895652 10:50176550-50176572 ATGGTTTAGCACCATTCTCTAGG - Intergenic
1067953335 10:50765428-50765450 ATGGTTTAGCACCATTCTCTAGG + Intronic
1068200186 10:53774188-53774210 ATGGTTTATCACCATCTCCTTGG - Intergenic
1069217696 10:65842595-65842617 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1069361957 10:67653258-67653280 ATGGCTTAGCACCAGCCTCTTGG - Intronic
1070070673 10:73086261-73086283 TTGGGTTATTTCCACCCTTTTGG - Intronic
1072494288 10:95940220-95940242 ATGGTTTAACACCATCCCCTTGG - Intergenic
1073538976 10:104302701-104302723 ATGGTTTAGCACCATTCTCTTGG + Intronic
1073547232 10:104361005-104361027 ATGGTTTAGCACCATCCTCTTGG - Intronic
1073579875 10:104655683-104655705 ATGGTTTAGCACCATCCTCTTGG + Intronic
1073676646 10:105654862-105654884 ATGATTTAGCACCATCCTCTTGG + Intergenic
1074112617 10:110433287-110433309 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1074588830 10:114793247-114793269 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1074603087 10:114935154-114935176 ATGGTTTAGCACCAACCCCTTGG - Intergenic
1074702713 10:116106554-116106576 ATGGTTTAGCACCACCCTCTTGG + Intronic
1075189326 10:120291987-120292009 ATGGTTTAGCACCATCCTCTCGG - Intergenic
1075421623 10:122305390-122305412 ATGGCTTAGCACCATCCTCTTGG + Intronic
1075918164 10:126187606-126187628 TTGCCTTAACACCACCCTCTAGG - Intronic
1076435259 10:130436718-130436740 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1076465639 10:130679659-130679681 GTGGTTTAGCACCATCCTCTTGG + Intergenic
1076561278 10:131366405-131366427 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1077349794 11:2087273-2087295 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1077381381 11:2240702-2240724 ATGGTTTAGCACCGTCCTCTTGG - Intergenic
1077845053 11:6014351-6014373 ATGGTTTAACACCATCCTCCGGG + Intergenic
1079150994 11:17898917-17898939 ATGATTTAGCACCACCCTCTCGG + Intronic
1079552895 11:21722678-21722700 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1079883741 11:25959115-25959137 ATGGTTTAGTACCACCCTCCTGG + Intergenic
1079975155 11:27082103-27082125 ATGGTTTAGCACCATCCACTTGG - Intronic
1080660564 11:34292845-34292867 CTCCTTTATTACCACCCTCTGGG - Intronic
1081160346 11:39741289-39741311 TTGGTATATGACCTTCCTCTAGG - Intergenic
1081743349 11:45456254-45456276 ATGGTTTAACACCATCCCCTTGG + Intergenic
1082090775 11:48087984-48088006 TTGGTTTCTCAGCTCTCTCTTGG + Intronic
1082644787 11:55709318-55709340 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1083176570 11:60953751-60953773 TTGCTTTCTCACCATCCTCTTGG - Intergenic
1084767348 11:71321303-71321325 ATGATTTAGCACCATCCTCTTGG + Intergenic
1084926652 11:72518820-72518842 TCAGTTGATCCCCACCCTCTTGG - Intergenic
1085180690 11:74533614-74533636 ATGGTTTAGCACCATCCCCTTGG - Intronic
1086084488 11:82940779-82940801 GTGGTTTACCACCATCCACTTGG - Intronic
1086351471 11:85946103-85946125 ATGGTTTAACACCATCCCCTTGG - Intergenic
1086505182 11:87497293-87497315 GTGGTTTAGCACCATCCCCTTGG + Intergenic
1087728512 11:101751809-101751831 TTAGTTTATCCCCATTCTCTGGG - Intronic
1087891089 11:103538984-103539006 ATGGTTTATCATCATCCCCTTGG - Intergenic
1088096062 11:106102657-106102679 ATGGTTTATCACCATCATCTTGG + Intergenic
1088566528 11:111178466-111178488 ATGATTTAGCACCATCCTCTTGG + Intergenic
1088910843 11:114191107-114191129 ATGGTTTAGCACCAACCTCTTGG - Intronic
1090050199 11:123371240-123371262 TTGGGTAATCCCCACCATCTTGG + Intergenic
1091134496 11:133176544-133176566 ATGGTTTTACACCATCCTCTTGG + Intronic
1091211726 11:133866312-133866334 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1092668956 12:10840396-10840418 CTGGTTTAACACCATTCTCTCGG - Intronic
1093181930 12:15976486-15976508 TAGGTTTCTCTCCACCTTCTTGG + Intronic
1093223293 12:16449348-16449370 ATGATTTAGCACCATCCTCTTGG - Intronic
1094143036 12:27200124-27200146 TTGGTTACTCACCTCCTTCTTGG + Intergenic
1095344272 12:41130970-41130992 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1095367997 12:41431022-41431044 ATGGTTTACCACCATCCCCTTGG - Intronic
1095641834 12:44494757-44494779 ATGGTTTAACACCACCCCCTTGG - Intergenic
1098571138 12:71988580-71988602 ATGATTTAGCACCATCCTCTTGG - Intronic
1098601110 12:72332486-72332508 ATGGTTTAGCACCATCCCCTGGG - Intronic
1098649378 12:72944988-72945010 ATGGTTTAGCATCAACCTCTTGG - Intergenic
1098719291 12:73875220-73875242 ATGGTTTAGCACTATCCTCTTGG + Intergenic
1099658563 12:85526459-85526481 ATGGTTTATCACCATCTCCTTGG + Intergenic
1099858673 12:88203140-88203162 ATGGTTTAGCACCATCCACTTGG - Intergenic
1099941853 12:89198224-89198246 ATGGTTTAGCACCACCCTCTTGG + Intergenic
1100002559 12:89855134-89855156 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1100052071 12:90461010-90461032 ATGGTTTAGCACTACCTTCTGGG - Intergenic
1100119438 12:91351752-91351774 ATGATTTAACACCAACCTCTTGG + Intergenic
1100142629 12:91636846-91636868 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1100766586 12:97872814-97872836 CTGGTTTAGCACCATCCTTTTGG - Intergenic
1100965391 12:100007438-100007460 ATGGTTTAGCACCATCCACTTGG - Intergenic
1103076654 12:117988621-117988643 ATGCTTTAGCACCATCCTCTTGG + Intergenic
1103178451 12:118886088-118886110 TTTTCTTACCACCACCCTCTTGG - Intergenic
1103233443 12:119351635-119351657 ATGGTTTAGCACTAACCTCTTGG - Intronic
1103532944 12:121615054-121615076 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1103847311 12:123910380-123910402 TTGGTTTGACACCACGCTGTTGG + Intronic
1104146375 12:126037741-126037763 TTGTGTCATCACCTCCCTCTAGG - Intergenic
1104431410 12:128719423-128719445 ATGATTTAGCACCAACCTCTAGG - Intergenic
1105659831 13:22481801-22481823 ATGGTTTAGCACCATCTTCTTGG + Intergenic
1106464194 13:29998200-29998222 ATGGTTTAGGACCATCCTCTTGG + Intergenic
1106831164 13:33584787-33584809 ATGGTTTACCACCATCCCCTTGG + Intergenic
1107230872 13:38108796-38108818 ATGGTTTAGCATCATCCTCTTGG - Intergenic
1108005122 13:45938541-45938563 ATGGTTTAGCTCCATCCTCTTGG + Intergenic
1108210845 13:48138459-48138481 ATGGTTTAACACCATCCACTTGG + Intergenic
1108237784 13:48427065-48427087 ATGGTTTAGCACCACCCCCTTGG - Intronic
1108263918 13:48685312-48685334 TTGGTTTAGCACCGTCCCCTCGG - Intronic
1108680263 13:52774040-52774062 GTGGTTTAGCACCATCCTCTTGG - Intergenic
1108715930 13:53077812-53077834 ATGGTTAAGCACCATCCTCTTGG - Intergenic
1108826799 13:54422368-54422390 ATGGTTTAACACCATCCCCTTGG + Intergenic
1109788716 13:67218530-67218552 TTTGTTAATAACCACTCTCTGGG - Intronic
1109920754 13:69054875-69054897 ATGGTTTATTACCACCCCCTTGG - Intergenic
1110146860 13:72202593-72202615 TTGGTCTATCACAAACCTCCTGG - Intergenic
1110161992 13:72389444-72389466 GTGGTTTAACACCATCCCCTTGG - Intergenic
1110189634 13:72715646-72715668 ATGGTTTAGCACCATCCTCTTGG + Intronic
1110423135 13:75335614-75335636 ATGGTTTAGCACCATCCACTTGG + Intronic
1110797501 13:79657241-79657263 ATGGTTTATCTCCATCTTCTTGG + Intergenic
1111447882 13:88373831-88373853 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1111457914 13:88508097-88508119 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1111494697 13:89033174-89033196 ATGGTTTAGCACCATCTTCTTGG + Intergenic
1111494935 13:89035228-89035250 GTGGTTTAGCACCATCCACTTGG + Intergenic
1112735240 13:102408832-102408854 TTGGCTTATCACCACACTATTGG + Intergenic
1113257604 13:108523932-108523954 ATGGTTTAGCACCATCCTTTTGG + Intergenic
1113499848 13:110764538-110764560 GTGGTTTAGCATCATCCTCTTGG + Intergenic
1113980445 13:114270345-114270367 ATGGTTTAGTACCATCCTCTTGG - Intronic
1114248712 14:20938371-20938393 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1114258046 14:21018971-21018993 TTGGTAAATCACTTCCCTCTAGG - Intronic
1114564682 14:23621692-23621714 CTGGTATATGACCACCTTCTAGG + Intergenic
1114736137 14:25046002-25046024 TTAGTTTAAAAGCACCCTCTAGG + Intronic
1114846586 14:26330389-26330411 TTGGTCTTTCACCTCCCTTTGGG - Intergenic
1114850145 14:26373726-26373748 GTGGTCTAGCACCATCCTCTTGG + Intergenic
1115073916 14:29362725-29362747 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1116280750 14:42903707-42903729 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1116352835 14:43887374-43887396 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1116681523 14:47976410-47976432 ATGGCTTATCACCATCCCCTTGG - Intergenic
1117497509 14:56320043-56320065 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1117819789 14:59636262-59636284 ATGGTTTAGCACCATCCCCTTGG + Intronic
1117886870 14:60372782-60372804 ATGGTTTATCACCATCCTCTCGG + Intergenic
1118024619 14:61756408-61756430 ATGGTTTAGCACCATCCTTTTGG - Intergenic
1120072679 14:80121507-80121529 ATGGTTTATCATCATCCCCTTGG + Intergenic
1120335631 14:83150815-83150837 TTGATTTCTCAGCACCCTCAAGG + Intergenic
1120707916 14:87763405-87763427 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1120902513 14:89588077-89588099 AAGGTTTAGCACCATCCTCTTGG + Intronic
1120909880 14:89656602-89656624 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1121140602 14:91538558-91538580 ATGGTTTAGCGCCATCCTCTTGG - Intergenic
1121754602 14:96392204-96392226 CAGGTTTATAAACACCCTCTGGG - Exonic
1121914320 14:97822171-97822193 TTGGTTTATCCCCAATATCTTGG - Intergenic
1122128934 14:99593980-99594002 TGTGTAAATCACCACCCTCTTGG + Intronic
1123026306 14:105425885-105425907 TGGGCTTTGCACCACCCTCTAGG + Intronic
1202891493 14_KI270722v1_random:163358-163380 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1123875091 15:24616481-24616503 ATGCTTTATCACCATCCTTTTGG - Intergenic
1126336781 15:47593892-47593914 ATGGTTTAGCACCATCCCCTTGG - Intronic
1126907476 15:53383609-53383631 ATGCTTTAGCACCATCCTCTTGG - Intergenic
1126955973 15:53934174-53934196 ATGGTTTAGCACCATCCACTTGG - Intergenic
1127427319 15:58868957-58868979 ATGGTGTAACACCATCCTCTTGG + Intronic
1127501114 15:59554982-59555004 TTGGTGTGACACCACACTCTGGG - Intergenic
1127855195 15:62948332-62948354 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1128892250 15:71341823-71341845 TTGGTTTATTTCCACCTACTAGG + Intronic
1129314661 15:74734197-74734219 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1129927263 15:79375700-79375722 ATGATTTAGCACCATCCTCTTGG - Intronic
1130050069 15:80476953-80476975 ATGGTTTAGTACCATCCTCTTGG + Intronic
1131218043 15:90556567-90556589 TTGGTCACTCACCAGCCTCTAGG - Intronic
1131285366 15:91052492-91052514 ATGGTTTAGCACCACCCTTTTGG + Intergenic
1131377696 15:91939303-91939325 ATGGTTCAGCACCATCCTCTTGG - Intronic
1131520860 15:93113841-93113863 ATGGTTTAGCACCATCCTCTCGG + Intergenic
1131609639 15:93947575-93947597 TGATTTTATCACCAGCCTCTTGG - Intergenic
1131611698 15:93971175-93971197 ATGGTTTTTCTCCACCCTCAGGG + Intergenic
1131612095 15:93976036-93976058 ATGATTTAGCACCATCCTCTTGG + Intergenic
1133296428 16:4754887-4754909 ATGGTTTGGCACCATCCTCTTGG + Intronic
1133714682 16:8435783-8435805 ATGGTTTAGCATCATCCTCTTGG - Intergenic
1135151724 16:20012853-20012875 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1135751545 16:25062410-25062432 ATGGTTTAGGACCATCCTCTTGG + Intergenic
1135930548 16:26732647-26732669 ATGGTTTAGCACCATCTTCTTGG + Intergenic
1136731372 16:32416899-32416921 CTGGTTTATCCCCATCCTTTTGG + Intergenic
1138261820 16:55629241-55629263 TTGGTATATGACCTTCCTCTAGG + Intergenic
1138333103 16:56231019-56231041 CTGGTTAATCCCCACCCTGTGGG + Intronic
1138402719 16:56760639-56760661 ATGGTTTAATACCATCCTCTTGG - Intronic
1138923177 16:61557340-61557362 ATGGTTTAGCACCGTCCTCTTGG + Intergenic
1138987679 16:62350100-62350122 ATGGTTTAGCACCATCCACTTGG - Intergenic
1139342235 16:66275123-66275145 ATGGTGCAGCACCACCCTCTTGG + Intergenic
1139968522 16:70759190-70759212 TGGGTTTATCACAACCATCCTGG + Intronic
1140256259 16:73338838-73338860 ATGGTTTAGCACCATCCGCTTGG + Intergenic
1140331489 16:74061517-74061539 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1140660698 16:77189541-77189563 ATGGTTTAGCATCATCCTCTTGG + Intergenic
1140678182 16:77354967-77354989 TTGATTTTTTACCACCCTTTGGG + Intronic
1140704521 16:77614176-77614198 ATGGTTTAGCACCACCCGCTTGG + Intergenic
1140716097 16:77727052-77727074 ATGGTTTAGCACCATCATCTTGG - Intronic
1140864068 16:79044396-79044418 ATGGTTTACCACCATCCTCTTGG + Intronic
1141053069 16:80790278-80790300 TTATTTTATTACCACCCCCTTGG - Intronic
1141355922 16:83346969-83346991 TTTCTTTCTCAGCACCCTCTGGG + Intronic
1202995020 16_KI270728v1_random:100372-100394 CTGGTTTATCCCCATCCTTTTGG - Intergenic
1203021707 16_KI270728v1_random:412714-412736 CTGGTTTATCCCCATCCTTTTGG - Intergenic
1142785751 17:2221263-2221285 ATGGTTTAGCACCATCCTCCTGG + Intronic
1143427318 17:6850274-6850296 ATGGTTTATCACCATCTCCTTGG + Intergenic
1144274793 17:13655982-13656004 ATGGTTTAGCACCATCCTCATGG + Intergenic
1146274660 17:31509233-31509255 GTGATTTATTACCTCCCTCTGGG + Intronic
1150956788 17:69868471-69868493 ATGGATTATCACCACCCCCTTGG - Intergenic
1151045523 17:70916074-70916096 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1151901848 17:77021145-77021167 ATGGTTTAGCACCATCCTATTGG + Intergenic
1152270315 17:79320663-79320685 GTGGCTGCTCACCACCCTCTGGG + Intronic
1152982844 18:295274-295296 CTGTTTTATCACCATCCTCCTGG + Intergenic
1153461473 18:5338583-5338605 ATGGTATAGCACCATCCTCTTGG + Intergenic
1153615724 18:6931195-6931217 ATGGTTTCTCACCCCCCCCTTGG + Intergenic
1154508592 18:15068964-15068986 ATGTTTTATCACCATCCCCTTGG - Intergenic
1155430593 18:25752038-25752060 ATGGTTTAGCACAATCCTCTTGG + Intergenic
1156524364 18:37752583-37752605 TTGGTTTCTCACCAACCTTGTGG + Intergenic
1156684090 18:39623278-39623300 TTGGTATATGACCTTCCTCTAGG + Intergenic
1156789308 18:40952533-40952555 ATGGTTTAGCACCATTCTCTTGG + Intergenic
1156819378 18:41354268-41354290 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1157225749 18:45862525-45862547 ATGGTTTAGCACCATCCTCTTGG + Intronic
1157396673 18:47347324-47347346 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1157407894 18:47438734-47438756 ATGATTTAGCACCATCCTCTTGG + Intergenic
1158316254 18:56214075-56214097 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1159004327 18:62999201-62999223 TTGTTTTGTCAGCACCTTCTAGG + Intergenic
1159154076 18:64559365-64559387 TTGGTTTCTCACAACCATATGGG - Intergenic
1164475979 19:28576329-28576351 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1164538215 19:29102666-29102688 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1165905843 19:39194153-39194175 CTGGTTTTTCCCCACCCGCTGGG + Intergenic
925009774 2:474470-474492 ATGGTTTAGCACCATCCCCTTGG - Intergenic
925061918 2:897921-897943 GTGGTTTAACACAATCCTCTTGG + Intergenic
925122637 2:1431176-1431198 ATGGTTTAGCCCCATCCTCTTGG + Intronic
925822553 2:7814661-7814683 GTGGTTTAGCACCATCTTCTTGG + Intergenic
926133647 2:10321271-10321293 ATGGTTTCTCACCATCCCCTTGG - Intronic
926227107 2:10974798-10974820 ATGGTTTAGCACCATCCTCTCGG - Intergenic
926950941 2:18242768-18242790 ATGGTTTAACACCATCCTCTTGG + Intronic
927141258 2:20132436-20132458 ATGGTTTAGCACCATCCTCTTGG - Intergenic
927242618 2:20931942-20931964 TTGGGTTCTCAGCAGCCTCTTGG + Intergenic
927838045 2:26417063-26417085 ATAGTTTAGCACCATCCTCTTGG - Intronic
928619855 2:33077589-33077611 ATGATTTATCACCATCCCCTTGG - Intronic
928623055 2:33110599-33110621 ATGGTGAATCACCACACTCTGGG - Exonic
929095959 2:38263514-38263536 ATGGTTTGTCACCATCCCCTTGG - Intergenic
929119127 2:38469376-38469398 TTGGTTTCTCAGCCCCATCTTGG + Intergenic
929547947 2:42868261-42868283 ATGGTTTAGCACCATCCTCTTGG - Intergenic
929695229 2:44108949-44108971 ATGGTTTAGCACCATCCTTTTGG + Intergenic
929806577 2:45151472-45151494 ATGGTTTAGCACCATCCTCTTGG + Intergenic
930939634 2:56998269-56998291 TTGATTAATGACCTCCCTCTGGG + Intergenic
931111170 2:59113198-59113220 TTGGTTTAGCTCCATCCTCTGGG + Intergenic
931135765 2:59398919-59398941 ATGGTTTAGCGCCATCCTCTTGG - Intergenic
931528006 2:63179397-63179419 ATGGTTTAGCACCATCCCCTTGG + Intronic
931824226 2:65982870-65982892 ATGGTTTAGCACCACCACCTTGG + Intergenic
932072139 2:68631334-68631356 ATGGTTTAGCACCATTCTCTTGG - Intergenic
932835234 2:75029742-75029764 TTATTTAATCACCCCCCTCTGGG - Intergenic
933535884 2:83574087-83574109 ATGGTTTAGTACCATCCTCTTGG - Intergenic
933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG + Intronic
933989546 2:87624481-87624503 ATAGTTTAGCACTACCCTCTTGG - Intergenic
934694905 2:96392735-96392757 ATGGTTTAGCACCATCTTCTTGG - Intergenic
934992105 2:98929186-98929208 TGGGTTTAACACCTCCCTCCTGG - Intronic
935239614 2:101167129-101167151 ATGGTTTAGCACCACCTGCTTGG + Intronic
935241414 2:101181530-101181552 ATGGTTTAGCACCATCCTCTTGG - Intronic
935409042 2:102739497-102739519 ATGGTTTAGCCCCATCCTCTTGG + Intronic
935837442 2:107070435-107070457 CTGGTTTACCACCACCGTCAGGG + Intergenic
936304297 2:111326345-111326367 ATAGTTTAGCACTACCCTCTTGG + Intergenic
936339075 2:111615542-111615564 ATGGTTTAGCACCAACCTCTTGG + Intergenic
936874587 2:117172951-117172973 ATGGTTTAGCACCATCTTCTTGG + Intergenic
936955371 2:118017088-118017110 ATGGTTTAGCAACATCCTCTTGG + Intergenic
937344449 2:121116017-121116039 TTGGTTTAGTACCATCCCCTTGG - Intergenic
937906727 2:127056110-127056132 TTGGTTTTCAATCACCCTCTGGG - Intronic
939482718 2:142769924-142769946 ATGGTTTGGCACCACCCCCTTGG + Intergenic
939787549 2:146536388-146536410 ATGGTTTAGCACCATCCTCATGG - Intergenic
940646566 2:156398516-156398538 ATGGTTTAGTACCATCCTCTTGG - Intergenic
941394799 2:164961302-164961324 ATGGTTTAGCACCATCCTCATGG - Intergenic
941728837 2:168893147-168893169 ATGGTTTAATACCATCCTCTTGG - Intronic
942237148 2:173921824-173921846 ATGGTTTAGCACCACTGTCTTGG + Intronic
942482544 2:176404704-176404726 GTGGTTTAGCACCATCCTCTTGG - Intergenic
942539742 2:177003154-177003176 ATAGTTTAGCACCACCCTCTTGG - Intergenic
943435386 2:187859257-187859279 ATGGTTTAGCACCATTCTCTTGG + Intergenic
943553446 2:189371007-189371029 ATGGTTTAACACCATCCCCTTGG + Intergenic
943702641 2:191003495-191003517 ATAGTTTAGCACCATCCTCTTGG + Intronic
943859949 2:192848773-192848795 ATGGTTTAGCACCATCCCCTTGG + Intergenic
943912500 2:193586433-193586455 ATGGTTTAGCACCACCCACTTGG + Intergenic
944100703 2:196023120-196023142 ATGGTTTAGCATCATCCTCTTGG + Intronic
944311137 2:198235173-198235195 ATGGCTTAGCACCACCCTCTTGG - Intronic
944447711 2:199807981-199808003 ATGGTTTAGTACCATCCTCTTGG + Intronic
944508162 2:200436902-200436924 ATGGTTTAACACCATCCCCTTGG + Intronic
944940050 2:204614681-204614703 GTGGTTTAGTACCATCCTCTTGG + Intronic
945328900 2:208516287-208516309 ATGGTTTAGCACCATCCCCTTGG - Intronic
945637282 2:212371148-212371170 TTGGTTTTTCCCCAGCCTATGGG + Intronic
946145884 2:217730687-217730709 ATGGTTTATCACCATCCCCTTGG + Intronic
946619740 2:221548120-221548142 ATGGGTTAGCACCATCCTCTTGG + Intronic
946636887 2:221739149-221739171 ATGGTTTAGCACCATCCCCTCGG - Intergenic
946714455 2:222538831-222538853 ATGGTTTAGCACCATCCCCTTGG - Intronic
947256230 2:228167027-228167049 ATGGTTTAGCACCATCCTCTTGG - Intronic
948091244 2:235297734-235297756 ATGGCTTAGCACCATCCTCTTGG - Intergenic
948105689 2:235411941-235411963 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1168809355 20:694107-694129 ATGGTTTACCACCATCCCCTTGG - Intergenic
1169505887 20:6210950-6210972 ATAGTTTAGCACCATCCTCTTGG - Intergenic
1169635844 20:7690472-7690494 ATGGTTTAGCACTATCCTCTTGG + Intergenic
1169745575 20:8939222-8939244 ATGGTTTAGCACCATCCTCCTGG - Intronic
1169828108 20:9791726-9791748 TTGCTTTATCACCAGCCCATTGG - Intronic
1170015398 20:11775649-11775671 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1171146975 20:22793248-22793270 ATGGTTTAACACCATCCTCTTGG + Intergenic
1171725962 20:28620974-28620996 TTAGTTTTTGACCAGCCTCTAGG - Intergenic
1172226454 20:33308193-33308215 ATGGTTTAGCGCCATCCTCTTGG - Intronic
1172867733 20:38112881-38112903 CTGGTTTATCAGCAGTCTCTGGG - Intronic
1173020477 20:39263703-39263725 ATGGTTTATCACCATCCCCTTGG - Intergenic
1173456504 20:43206699-43206721 ATGGTTTAGCACCACCCTTTTGG - Intergenic
1173554804 20:43958519-43958541 GTGCTTTATCACCCCCCTCCAGG + Intronic
1176789489 21:13302765-13302787 ATGTTTTATCACCATCCCCTTGG + Intergenic
1176992641 21:15517281-15517303 TTGATTCATGACCACCTTCTTGG - Intergenic
1177883195 21:26718495-26718517 ATGGCTTAGCACCAGCCTCTTGG - Intergenic
1178520418 21:33284660-33284682 ATGGCTTATCACCATCCCCTTGG + Intronic
1178767298 21:35466430-35466452 ATGGTTTATCACCATCCCCTTGG + Intronic
1179432492 21:41333370-41333392 ATGGTTTAGCACCATCTTCTTGG + Intronic
1179550266 21:42139419-42139441 ATGATTTAGCACCATCCTCTTGG - Intronic
1180541107 22:16448242-16448264 CTGGTTTATCCCCATCCTTTTGG - Intergenic
1180946946 22:19700480-19700502 TTGGTTTACCACCATCCCCTTGG - Intergenic
1181383466 22:22525685-22525707 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1182882163 22:33742989-33743011 ATGGTTTAGCACCATTCTCTTGG + Intronic
1182938449 22:34249839-34249861 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1184706962 22:46221223-46221245 ATGGTTTAGCACCATCCTCTTGG - Intronic
1184915918 22:47568961-47568983 ATGGTTTAGCACCATCCTCTCGG - Intergenic
950160195 3:10754725-10754747 ATGGTTTAGCACCATCCTCCTGG + Intergenic
951237109 3:20249557-20249579 TTGGCTTAGCACCATCCCCTTGG - Intergenic
951306861 3:21074479-21074501 TTGGTTTATCACCATCCTCTTGG - Intergenic
951499654 3:23370818-23370840 TTTGTTTATCACCTTCCTCCTGG - Intronic
951673223 3:25208105-25208127 ATGGTTTAGCACCATCCCCTCGG - Intronic
951810027 3:26688676-26688698 ATGGTTTAGCACCATCCCCTTGG - Intronic
951937150 3:28034162-28034184 ATGATTTAGCACCACCCCCTTGG + Intergenic
951954137 3:28235805-28235827 ATGCTTTAGCACCATCCTCTTGG - Intergenic
952662623 3:35869979-35870001 TTGATTTATCTCCAGCTTCTGGG - Intergenic
952807826 3:37374404-37374426 ATGGTTTAACACCATCCCCTTGG - Intergenic
953519140 3:43624423-43624445 ATGGTTTAGCACCATCCCCTTGG + Intronic
955654508 3:61230265-61230287 ATGGTTTAGCACTATCCTCTTGG + Intronic
955669444 3:61387988-61388010 ATGGTTTAGCACCATCCCCTTGG + Intergenic
955725300 3:61926304-61926326 ATGGTTTAGCACCATCCCCTTGG + Intronic
956900158 3:73707211-73707233 CTGGTTAAACACCACCCACTGGG + Intergenic
957088974 3:75709355-75709377 ATGGTTTAGCACCATCCCCTTGG - Intergenic
957176070 3:76811578-76811600 TTGGTGAATCATCACCCTGTAGG + Intronic
957273890 3:78065287-78065309 ATGGTTTTGCACCATCCTCTTGG + Intergenic
957674101 3:83345018-83345040 TTCCTTTATCACCTTCCTCTAGG - Intergenic
957747875 3:84368152-84368174 ATGGTTTAGCACCATCTTCTTGG - Intergenic
957876234 3:86149939-86149961 ATGGTTTAGCACCACCACCTTGG + Intergenic
958557831 3:95703188-95703210 ATGGTTTAGCACCATCCTCTTGG + Intergenic
958699127 3:97566250-97566272 ATGGCTTACCACCACCCCCTTGG - Intronic
958841590 3:99211195-99211217 ATGGCTTAGCACCATCCTCTTGG - Intergenic
959884426 3:111482307-111482329 ATGGCTTAGCACCATCCTCTTGG - Intronic
960724873 3:120659981-120660003 ATGGCTTAGCACTACCCTCTTGG + Intronic
964470046 3:157043002-157043024 ATGGTTTAGCACCATCCTGTTGG + Intronic
965232680 3:166073108-166073130 GTGGTTTAACACCATCCCCTTGG + Intergenic
965870284 3:173256239-173256261 ATGATTTAGCACCATCCTCTAGG + Intergenic
966296697 3:178432320-178432342 GTGGTTTAACACCATCCCCTTGG + Intronic
967324390 3:188224795-188224817 ATGGTTTAGCACCATCCTCTTGG - Intronic
968124480 3:196148411-196148433 ATGGTTTGGCACCATCCTCTCGG + Intergenic
969175217 4:5393668-5393690 ATGGTTTAGCACCATCCTCTTGG - Intronic
970117782 4:12718619-12718641 ATGGTTTAGCACCATCCTCTTGG + Intergenic
970855922 4:20649367-20649389 ATGGTTTAGCATCATCCTCTTGG + Intergenic
971562275 4:28095276-28095298 TTGGTTTAGCACCATCTCCTTGG - Intergenic
971934897 4:33135205-33135227 TTATTTTCTCACCATCCTCTTGG + Intergenic
972069406 4:34996506-34996528 ATGGGTTAGCACCATCCTCTTGG - Intergenic
973028133 4:45299906-45299928 TTGGTTTAGCACCATCCTCTAGG + Intergenic
973342368 4:49018249-49018271 ATGGTTTAGCACCACACCCTCGG - Intronic
973608093 4:52607667-52607689 GTGGTTTAGCACCATCCTCCTGG + Intronic
973780561 4:54284661-54284683 ATGGTTTAGCACCATCCCCTTGG - Intronic
974670290 4:65021666-65021688 ATGGTTTAGCACCATCCTCTTGG - Intergenic
974733162 4:65896597-65896619 GTGGTTTAGTACCATCCTCTTGG - Intergenic
974844119 4:67330511-67330533 TTTATTTATCACCACCCTGGAGG - Intergenic
975946698 4:79715108-79715130 ATGGCTTAGCACCACCCGCTTGG - Intergenic
976013119 4:80516595-80516617 ATGGTTTAGCACCATCTTCTTGG - Intronic
976542398 4:86293826-86293848 ATGGATTAGCACCATCCTCTTGG - Intronic
976822128 4:89218328-89218350 ATGGTTTAGCACCATCCTTTTGG + Intergenic
977514026 4:97997488-97997510 ATAGTTTAGCACCACCCCCTTGG - Intronic
977719990 4:100228901-100228923 ATGGTTTGGCACCACCCCCTTGG + Intergenic
977874006 4:102128190-102128212 ATGGTTTAGCACCATCCCCTTGG + Intergenic
978441893 4:108741881-108741903 TTGGTTAATCACCATCCCGTGGG - Intergenic
978528722 4:109693017-109693039 ATGGTTTAGCATCATCCTCTTGG + Intronic
978872314 4:113594207-113594229 ATGGTTTAGCACCATCCTCTTGG - Intronic
978921940 4:114194217-114194239 CTGGTTTATCACTGCCCTTTGGG + Intergenic
979049200 4:115909162-115909184 ATGGTTTATCACCATCTCCTTGG - Intergenic
979131016 4:117044635-117044657 TTGGTTTATCGTGACCTTCTAGG + Intergenic
979253662 4:118590335-118590357 ATGGTTTAGCACCATCCCCTTGG + Intergenic
979358324 4:119731934-119731956 TTGGTATATGACCTCCCTCTAGG + Intergenic
979602108 4:122597257-122597279 ATGGTTTAGCACCATCCCCTTGG - Intergenic
980094457 4:128474958-128474980 TTAGTTTACCACCATCTTCTTGG - Intergenic
980096368 4:128495257-128495279 ATGGTTTAGCACCATTCTCTTGG + Intergenic
980498413 4:133615494-133615516 TTGGTTGATGCCCACCCTGTTGG - Intergenic
980700958 4:136429290-136429312 ATGGTTTAGCACCATCCTGTTGG + Intergenic
980773066 4:137403958-137403980 TTGGTTTCTCATCAACATCTAGG + Intergenic
980898373 4:138880904-138880926 ATGGTTTAGCACCATCCTCTTGG + Intergenic
981213942 4:142140424-142140446 CTGGTTAATCACTACCCTTTGGG - Intronic
981240245 4:142467843-142467865 ATGGCTTAGCACCACTCTCTTGG + Intronic
981304384 4:143230854-143230876 TTGGGTAATTTCCACCCTCTCGG + Intergenic
982027905 4:151270287-151270309 ATGGTTTATTACCATCCTCTTGG + Intronic
982093312 4:151898596-151898618 ATGGTTTAGCACCATCCTCTTGG - Intergenic
982188940 4:152834153-152834175 ATGGTTTAACACCACTCCCTTGG - Intronic
982391059 4:154864174-154864196 ATGGTTTAGCACCATTCTCTTGG - Intergenic
982994043 4:162317805-162317827 AGGGTATATCACCAGCCTCTGGG + Intergenic
983075050 4:163316198-163316220 ATGGTTTAGCACCACCCTCTTGG - Intergenic
983075308 4:163318238-163318260 ATGGTTTAGCACCATCCTCTTGG - Intergenic
983195177 4:164798838-164798860 ATGGTTTAACACCATCCCCTCGG + Intergenic
983540130 4:168900161-168900183 ATGGTTTAGCACCATCCCCTTGG - Intronic
985060469 4:186072674-186072696 ATGGTTCAGCACCACCCCCTCGG - Intronic
986140365 5:5024645-5024667 TTGGTACATCACCACACTCACGG + Intergenic
986461010 5:7972285-7972307 GTGGCTTAGCACCATCCTCTTGG + Intergenic
986802892 5:11279904-11279926 ATGGTTTAGCACCATCCTCTTGG - Intronic
987289407 5:16494452-16494474 ATGGTTTAGCACCATCCCCTTGG + Intronic
987689098 5:21244205-21244227 ATGGTTTAGCACCATCCCCTTGG + Intergenic
988455987 5:31387805-31387827 ATGGTTTAGCACCATGCTCTTGG - Intergenic
988635229 5:32976659-32976681 ATGGTTTAACACCATCCCCTTGG + Intergenic
988850955 5:35180324-35180346 TTGGTTTAGCACCATTCCCTTGG + Intronic
989294105 5:39803909-39803931 TTGTTTTATCACCACTCTGGAGG + Intergenic
991057866 5:62339304-62339326 ATGGTTTAGCACCATCCCCTTGG - Intronic
991249218 5:64541290-64541312 ATGGTTTAGCACCATCCCCTTGG - Intronic
991562802 5:67972325-67972347 ATGGTTTAGCACCATCCTGTTGG + Intergenic
992134823 5:73734024-73734046 ATGGTTTAGCACCATCCTTTTGG - Intronic
992791146 5:80215180-80215202 ATGGTTTACCACCATCCACTTGG + Intronic
993017024 5:82545536-82545558 ATGGTTTAGCACCATCCTCTTGG + Intergenic
993468475 5:88277140-88277162 GTGGTTTAGTACCATCCTCTTGG + Intergenic
994693066 5:103042048-103042070 ATGGTTTAGCACCATCCCCTTGG + Intergenic
995857433 5:116608107-116608129 ATGGTTTAGCACCATCCTCTTGG - Intergenic
996593799 5:125178679-125178701 ATGGTTTTGCACCATCCTCTTGG + Intergenic
996602191 5:125277319-125277341 ATGGTTTAGCGCCATCCTCTTGG + Intergenic
996615426 5:125435751-125435773 ATGGTTTAGCACCATCCTCTTGG - Intergenic
996993598 5:129667508-129667530 ATGGTTTAGCACCATCCTCTTGG + Intronic
997032304 5:130145081-130145103 ATGGTTTAGCACCAGCCCCTTGG - Intronic
997188140 5:131901976-131901998 GTGCTTTAGCACCACCCTCTTGG + Intronic
997724900 5:136112371-136112393 ATGGTTTAGCACCATCCTCTTGG + Intergenic
997779749 5:136644639-136644661 ATGGTTTAGTACCATCCTCTTGG + Intergenic
998874023 5:146581383-146581405 ATGGTTTAGCACCATCTTCTTGG - Intronic
998941557 5:147288699-147288721 ATGGTTTCACACCATCCTCTTGG - Intronic
1000401986 5:160838872-160838894 GTGGTTTAGCACCAACCTCTTGG + Intronic
1002317699 5:178354521-178354543 ATGGTTTAACACCATCCTCTGGG + Intronic
1003168818 6:3704265-3704287 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1003190751 6:3872241-3872263 CTGGTTTAGCACCATCCTTTGGG - Intergenic
1003561547 6:7184848-7184870 TTGATGTATCACCATCCTGTTGG + Intronic
1003856267 6:10279448-10279470 TTGGTTTAACATCATCCTCCTGG - Intergenic
1004778860 6:18882259-18882281 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1005423217 6:25674060-25674082 ATGGTTTAGCACCATCCCCTTGG - Intronic
1005597942 6:27397347-27397369 TTGGTTTAGCAGCATCCTCTTGG - Intronic
1005669966 6:28095456-28095478 ATGGTTTAGCACCACCTTCTTGG + Intergenic
1006308045 6:33236759-33236781 ATGGTTTAGCACCATCCTCCTGG + Intergenic
1007209102 6:40177394-40177416 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1008097199 6:47351186-47351208 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1008226303 6:48920792-48920814 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1008871638 6:56279090-56279112 ATGGTTTAGCACCATCCTCTTGG + Intronic
1009038017 6:58141441-58141463 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1009038266 6:58144728-58144750 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1009213809 6:60895077-60895099 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1009214057 6:60898358-60898380 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1009358972 6:62791121-62791143 ATGGTTTAACACCATCTTCTTGG - Intergenic
1009460957 6:63912691-63912713 ATGGTTTACCACCATCCCCTGGG + Intronic
1010202441 6:73294804-73294826 ATGGTTTAGCACCATCCACTTGG + Intronic
1010988158 6:82449869-82449891 TTGGTTTAGCACCATCCCCTTGG - Intergenic
1011041398 6:83033508-83033530 ATGGTTTAGCACCATCCCCTTGG + Intronic
1011118639 6:83925298-83925320 ATGGTTTAGGACCACCCTCTTGG - Intronic
1011172107 6:84516696-84516718 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1011544353 6:88467615-88467637 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1011645665 6:89455593-89455615 ATGGTTTAGCACCGTCCTCTTGG + Intronic
1011849027 6:91603063-91603085 ATGCTTTAGTACCACCCTCTTGG - Intergenic
1012001945 6:93664854-93664876 GTGGTTTAGCACTATCCTCTTGG - Intergenic
1012017813 6:93874267-93874289 ATGGTTTAACACCATCCCCTTGG + Intergenic
1012499155 6:99869520-99869542 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1012564366 6:100628489-100628511 ATGGCTTAGCACCATCCTCTTGG + Intronic
1012674790 6:102101773-102101795 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1014107641 6:117584794-117584816 ATGGTTTAGCACCATCCCCTTGG + Intronic
1014328369 6:120028167-120028189 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1014415391 6:121177235-121177257 ATGGTTTAGCACCATCCCCTTGG + Intronic
1014524869 6:122490509-122490531 GTGGTTTAGCACCATCCTCTCGG + Intronic
1014937437 6:127400710-127400732 ATGGTTTAGCACCATTCTCTTGG - Intergenic
1015280935 6:131433443-131433465 ATGGTTTAACACCATCCCCTTGG + Intergenic
1015311119 6:131768181-131768203 ATGGTTTAGCACCATCCTCCTGG + Intergenic
1015477661 6:133671617-133671639 ATGGTTTATCACCATCCCCTTGG - Intergenic
1015560369 6:134508849-134508871 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1015798148 6:137033482-137033504 GTGGTTTAGCACCACCCGCTTGG + Intronic
1015907384 6:138130815-138130837 ATGGTTTATCACCATCTTCTTGG - Intergenic
1017018982 6:150125060-150125082 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1017925272 6:158906431-158906453 ATGGTTTAGCATCATCCTCTTGG + Intronic
1018036931 6:159889627-159889649 TTAGTTTCTGACCATCCTCTGGG + Intergenic
1018425248 6:163674036-163674058 ATGGTTTAGCACCATCCTCTAGG - Intergenic
1018484256 6:164224913-164224935 CTGGTTTAACACCATCCTCTTGG - Intergenic
1018846586 6:167561085-167561107 TTGGGTTCTCACCACACTGTGGG - Intergenic
1019730026 7:2624433-2624455 ATGGATTCTCACCTCCCTCTCGG - Intergenic
1019955370 7:4410274-4410296 GTGATTTAGCACCATCCTCTCGG - Intergenic
1020907070 7:14076529-14076551 TTGGGATATTACCAGCCTCTGGG - Intergenic
1022039885 7:26570903-26570925 GTGGTTTAGCACCATCCTTTTGG + Intergenic
1022669313 7:32441032-32441054 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1023034010 7:36115142-36115164 ATGGTTTAGCAGCATCCTCTTGG - Intergenic
1023706178 7:42943873-42943895 ATGGTTTAGCACCATCTTCTTGG + Intronic
1023707514 7:42957236-42957258 ATGGCTTAGCACCACCCACTTGG + Intergenic
1023789308 7:43739425-43739447 ATGGTTTAGCACCATTCTCTTGG - Intergenic
1024218963 7:47273144-47273166 TTGGTTTATCAGGTACCTCTGGG + Intergenic
1024575638 7:50761807-50761829 ATGGTTTAGCACCATCCTCGTGG + Intronic
1026104255 7:67408688-67408710 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1026198865 7:68196598-68196620 ATGGTTTAACACCATCCACTTGG - Intergenic
1026744292 7:72999011-72999033 TTTCTTTAACACCACCCTCTCGG - Intergenic
1027030398 7:74883684-74883706 TTTCTTTAACACCACCCTCTCGG - Intergenic
1027099445 7:75366081-75366103 TTTCTTTAACACCACCCTCTCGG + Intergenic
1027490292 7:78815453-78815475 TTGGCTTTTCACCACCATATAGG + Intronic
1027935790 7:84600283-84600305 ATGGTTTAACACCATCCTCTTGG + Intergenic
1029378697 7:100198604-100198626 TTTCTTTAACACCACGCTCTCGG + Intronic
1029467290 7:100734232-100734254 CTGGTTTATCATTACCCCCTGGG - Intronic
1029502284 7:100939370-100939392 ATGGTTTAACACCATCCCCTTGG - Intergenic
1030127520 7:106168549-106168571 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1030286495 7:107832266-107832288 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1030913954 7:115289218-115289240 TTGGTTTAGCACCATCCTCTTGG - Intergenic
1031164462 7:118212543-118212565 AAGGTTTAGCACCATCCTCTTGG + Intergenic
1032282450 7:130515399-130515421 ATGGTTTAGCACCATCCCCTTGG - Intronic
1032743785 7:134765727-134765749 ATGGTTTAGCACCATCTTCTTGG + Intronic
1032743794 7:134765796-134765818 ATGGTTTAGCACCATCTTCTTGG + Intronic
1033151034 7:138915293-138915315 GTGGTTCAGTACCACCCTCTAGG + Intronic
1033313404 7:140278953-140278975 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1033953768 7:146817743-146817765 ATGGTTTAGCACCATCCTCTTGG - Intronic
1034076520 7:148236909-148236931 ACGGTTTAGCACCACCCTCTTGG - Intronic
1034708991 7:153173863-153173885 ATGGTTTAGCACCATCCTTTTGG + Intergenic
1035610780 8:962609-962631 TTGGTTTCCCACTCCCCTCTCGG - Intergenic
1035984530 8:4412275-4412297 ATAGTTTACCACCATCCTCTCGG + Intronic
1036666204 8:10742275-10742297 ATGGTTTAGCACCATCCACTTGG - Intronic
1036927698 8:12923194-12923216 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1036957829 8:13209641-13209663 ATGGTTTAGCACCATCCTCTTGG + Intronic
1038214038 8:25545449-25545471 ATGATTTAGCACCAACCTCTTGG - Intergenic
1038988937 8:32844737-32844759 TTGGTTTAGCACCATCCCTTTGG + Intergenic
1039163831 8:34653704-34653726 TTGTTTTACCCACACCCTCTAGG - Intergenic
1039313978 8:36351674-36351696 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1041270068 8:56103024-56103046 ATGATTTAGCACCATCCTCTCGG + Intergenic
1041907872 8:63053548-63053570 ATGGTTTAGCACCATCCCCTTGG - Intronic
1041919240 8:63164451-63164473 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1042037523 8:64551917-64551939 ATGGTTTAACACCACCCCCTCGG + Intergenic
1042893989 8:73645886-73645908 ATGGTTTAGCACCATCCCCTTGG - Intronic
1042943996 8:74136924-74136946 ATGGTTTAATACCACCCTTTTGG - Intergenic
1043192360 8:77241690-77241712 CTGGTTTAGCACCATCCGCTTGG + Intergenic
1043333478 8:79145620-79145642 TTGCTTTATCACCACCCCTTAGG - Intergenic
1043709215 8:83393775-83393797 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1043765159 8:84121712-84121734 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1043823955 8:84902355-84902377 ATGGTTTAGCACCATCCTCTTGG - Intronic
1044117738 8:88355113-88355135 ATGGTTTATCACCATCCTTTTGG - Intergenic
1044140424 8:88644620-88644642 ATGGTTTAGCACCACCCACCTGG - Intergenic
1044312276 8:90707921-90707943 GTGGTTTAGCACCATCCTCTTGG + Intronic
1044684228 8:94811745-94811767 ATGGTTTAGCACCATCATCTTGG - Intergenic
1046066004 8:109197368-109197390 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1046450461 8:114383660-114383682 ATGGTTTGGCACCACCCCCTTGG + Intergenic
1048392089 8:133976707-133976729 ATGGTTTAACACCAGCGTCTTGG + Intergenic
1050672810 9:8016872-8016894 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1051442255 9:17097987-17098009 ATGGTTTAGCACCATCCTTTTGG - Intergenic
1052612783 9:30797754-30797776 CAGGTTTATCATCATCCTCTTGG - Intergenic
1052661294 9:31435559-31435581 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1052830379 9:33210625-33210647 ATGCTTTAACACCATCCTCTTGG - Intergenic
1055031201 9:71772562-71772584 ATGGTTTAGTACCATCCTCTTGG + Intronic
1055166114 9:73196093-73196115 ATGGTTTAGCACCATCCTGTTGG + Intergenic
1056109170 9:83377536-83377558 ATGGTTTAGCACCTTCCTCTTGG + Intronic
1056427602 9:86492691-86492713 ATGGTTTAACACCATCCTCTTGG + Intergenic
1056525777 9:87441744-87441766 ATGGTTTAGCACCACCCTCTTGG - Intergenic
1056604258 9:88072957-88072979 ATGGGTTAGCACCATCCTCTTGG - Intergenic
1057638586 9:96795568-96795590 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1058182066 9:101810210-101810232 ATGGTTTAGCACCATCCCCTCGG + Intergenic
1058498902 9:105591039-105591061 ATGGTTTAGCACCATCCTCTTGG - Intronic
1059038629 9:110787978-110788000 TTGGTCTATCCCAACCCTATAGG + Intronic
1059065010 9:111074608-111074630 ATGATTTAGCACCATCCTCTTGG - Intergenic
1059617713 9:115968660-115968682 ATCGGTTAGCACCACCCTCTTGG - Intergenic
1059765367 9:117378888-117378910 ATGGTTTAGCACCATCCCCTTGG + Intronic
1059779981 9:117515972-117515994 ATGGTTTACCACCACCCCCCTGG - Intergenic
1059917424 9:119118779-119118801 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1060334283 9:122706707-122706729 ATGGTTTAGCACCATCTTCTTGG - Intergenic
1061775211 9:132958554-132958576 ATGGTTTATTACCATCCTCTTGG - Intronic
1062148159 9:135002266-135002288 ATGGTTTAGCACCCTCCTCTTGG - Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185896805 X:3866301-3866323 TTGCTTTAGCACCATCCGCTTGG + Intergenic
1185901923 X:3904728-3904750 TTGCTTTAGCACCATCCGCTTGG + Intergenic
1186151847 X:6683076-6683098 ACGGTTTAGCACCATCCTCTTGG - Intergenic
1186603017 X:11058611-11058633 ATGGTTTATCACCATCTTCTTGG - Intergenic
1186832381 X:13403803-13403825 TTGATTTATCACCACTCCCAGGG + Intergenic
1186850640 X:13576343-13576365 ATGGTTTAGCACCATCCCCTTGG - Intronic
1187561546 X:20408078-20408100 ATTGTTTAGCACCATCCTCTTGG - Intergenic
1188045341 X:25419929-25419951 ATGGTTTAGCACCATACTCTTGG + Intergenic
1188618733 X:32192996-32193018 ATGGTTTAACACCATCCTCTTGG + Intronic
1188775668 X:34215538-34215560 GTGGTTTAGCACCATCCCCTTGG + Intergenic
1189263990 X:39699713-39699735 ATGGTTTAGCACCATCCCCTCGG - Intergenic
1189668968 X:43387559-43387581 GTGGTTTAGCACTATCCTCTTGG + Intergenic
1189973278 X:46439210-46439232 ATGGTTTAGCATCATCCTCTTGG + Intergenic
1190145691 X:47889880-47889902 ATGGTTTAGCACCATCCCCTTGG - Intronic
1190576720 X:51846801-51846823 ATGGTTTAGCACCATCCACTTGG - Intronic
1191015242 X:55802645-55802667 TTGGTTTAACACCATCCCCTTGG + Intergenic
1191600740 X:63002438-63002460 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1191754679 X:64581021-64581043 TGGGCTTATCACCTCCCTCTGGG - Intergenic
1191769073 X:64735613-64735635 ATGGGTTAGCACCACCCCCTTGG - Intergenic
1192316772 X:70058467-70058489 GTGGTTTAGCACCATCCTCTTGG - Intergenic
1192331345 X:70177757-70177779 CTGGGTGATCTCCACCCTCTGGG + Intronic
1192501558 X:71657201-71657223 ATGGTTTAGCACCATCCACTTGG - Intergenic
1192936846 X:75869434-75869456 ATGGTTTAACACCATCCCCTTGG + Intergenic
1193026422 X:76850547-76850569 ATGGTTTAACACCACTCCCTGGG - Intergenic
1193205344 X:78741050-78741072 GTGGTTTAGCACCATCCTATTGG - Intergenic
1193466285 X:81852053-81852075 ATGGTTTAGCACCACCCCCTTGG - Intergenic
1193466559 X:81854385-81854407 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1193648387 X:84097140-84097162 TTTCTCTATCACAACCCTCTTGG + Intronic
1193801754 X:85945347-85945369 ATGGTTTAGCATCATCCTCTTGG + Intronic
1193911627 X:87313697-87313719 TTGGTTTAGCGCCATCCCCTTGG - Intergenic
1193964577 X:87969345-87969367 ATGGTTGAGCACCATCCTCTTGG + Intergenic
1194039148 X:88918253-88918275 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1194092623 X:89597947-89597969 AAGGTTTAGCACCACCCCCTTGG - Intergenic
1194119769 X:89947391-89947413 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1194306673 X:92257221-92257243 ATGATTTAGCACCATCCTCTTGG - Intronic
1194559058 X:95397604-95397626 ATGGTTTAACACCATCCCCTTGG + Intergenic
1194927986 X:99850046-99850068 ATGGTTTAGGACTACCCTCTTGG + Intergenic
1194961682 X:100243473-100243495 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1195122520 X:101769929-101769951 ATGGTTTAGCACTATCCTCTTGG + Intergenic
1197413984 X:126151507-126151529 ATGGATTAGCACCATCCTCTTGG - Intergenic
1197473299 X:126890097-126890119 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1197557773 X:127976933-127976955 TTGGTCTCTCAGCTCCCTCTTGG + Intergenic
1197812223 X:130455431-130455453 TTGGTTTAGCACCATCCCTTTGG + Intergenic
1197952280 X:131910453-131910475 TTTGTTTCTCACCACTTTCTAGG + Intergenic
1198309613 X:135417701-135417723 GTGGTTTAGCACCATCCCCTTGG + Intergenic
1198842449 X:140872604-140872626 ATGGTTCAGCACCACCCCCTTGG - Intergenic
1198951032 X:142072769-142072791 ATGGTTTACCACCATCCCCTTGG - Intergenic
1199006777 X:142708651-142708673 ATGACTTAGCACCACCCTCTTGG + Intergenic
1199253286 X:145689469-145689491 GTGGTTTAGTACCAGCCTCTTGG + Intergenic
1199289317 X:146088891-146088913 ATGGTTTAGCACCGTCCTCTTGG + Intergenic
1199963040 X:152794837-152794859 ATGGTTTAGCGCCACCCCCTTGG + Intergenic
1200050426 X:153426781-153426803 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1200175025 X:154108324-154108346 ATGATTTAGCACCATCCTCTTGG - Intergenic
1200445270 Y:3254050-3254072 AAGGTTTAGCACCACCCCCTTGG - Intergenic
1200472635 Y:3604923-3604945 ATGGTTTAGCACCATCCTCTTGG + Intergenic