ID: 933698900

View in Genome Browser
Species Human (GRCh38)
Location 2:85240292-85240314
Sequence TTGTGAACACAGAGGAAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933698897_933698900 -6 Left 933698897 2:85240275-85240297 CCTCTCTCACAAGGCTGTTGTGA 0: 1
1: 4
2: 19
3: 208
4: 932
Right 933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 292
933698893_933698900 4 Left 933698893 2:85240265-85240287 CCTGCACCTCCCTCTCTCACAAG 0: 1
1: 1
2: 4
3: 34
4: 392
Right 933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 292
933698895_933698900 -2 Left 933698895 2:85240271-85240293 CCTCCCTCTCTCACAAGGCTGTT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 292
933698896_933698900 -5 Left 933698896 2:85240274-85240296 CCCTCTCTCACAAGGCTGTTGTG 0: 1
1: 0
2: 3
3: 59
4: 514
Right 933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 292
933698892_933698900 5 Left 933698892 2:85240264-85240286 CCCTGCACCTCCCTCTCTCACAA 0: 1
1: 1
2: 3
3: 37
4: 462
Right 933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933698900 Original CRISPR TTGTGAACACAGAGGAAGCC GGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900916662 1:5644332-5644354 TGGTGACAGCAGAGGAAGCCGGG + Intergenic
901484250 1:9547479-9547501 TTGTTAAGACAGAGGAAGAGAGG + Intronic
901979199 1:13020862-13020884 TTGTGTGCTCAGAGGAACCCAGG - Intronic
902002883 1:13208076-13208098 TTGTGTGCTCAGAGGAACCCAGG + Intergenic
902022108 1:13353840-13353862 TTGTGTGCTCAGAGGAACCCAGG + Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
902783296 1:18717770-18717792 TTCTGTGCACAGAGGATGCCAGG + Intronic
904657495 1:32060226-32060248 TGCTGAACACAGAGAAACCCAGG + Intronic
904706041 1:32391636-32391658 TTGACAACACACAGGAAGACAGG + Intronic
905866621 1:41380431-41380453 TTCTGAGGACAGAGGAAGGCAGG - Intronic
906305710 1:44717527-44717549 ATGGGAACACAAAGGAAGCCAGG - Intronic
907989049 1:59561265-59561287 TGGTAAACAAAGAGGAAGCGAGG - Intronic
908092859 1:60704903-60704925 TTATCAACATAGAGGAATCCTGG + Intergenic
910441755 1:87260223-87260245 TTGAAAGCTCAGAGGAAGCCAGG + Intergenic
911057541 1:93721370-93721392 TTGTCAACCCAGAAGAATCCTGG + Intronic
911475380 1:98367007-98367029 TTGTGAGCACATAAAAAGCCTGG - Intergenic
913036865 1:114976206-114976228 TTTTGAATAAAAAGGAAGCCTGG - Intronic
915405932 1:155659783-155659805 TTGTGAAAACAGAGGAGGGAAGG - Exonic
915419097 1:155765576-155765598 TTGTGAAAACAGAGGAGGGGAGG - Exonic
917787708 1:178476784-178476806 CTGAGAACACAGTGAAAGCCAGG - Intronic
917801825 1:178578550-178578572 TTGTGAACACTGAGCAAGGCTGG - Intergenic
918008315 1:180562717-180562739 GTGTGCACAGAGAGGAAGGCTGG + Intergenic
919119492 1:193321501-193321523 GTCTGAACACAAAGGAAGCCTGG + Intergenic
923531966 1:234818835-234818857 TTTAGAGCACAGAGGAAGCGGGG - Intergenic
923762665 1:236861144-236861166 TTGAGGATACTGAGGAAGCCAGG + Exonic
1062828518 10:588970-588992 TGGTGAGGACAGAGGCAGCCGGG - Intronic
1063071597 10:2671837-2671859 TTCAGAACCCAGAGGAAGCCTGG - Intergenic
1063099608 10:2938039-2938061 ATGTGAAAACAGAAGAAACCTGG - Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1065134005 10:22650454-22650476 TTATGAAAACTGAGGCAGCCTGG - Intronic
1065138307 10:22694573-22694595 TTGTGATCACAGAGTAGGTCAGG - Intronic
1065858979 10:29854872-29854894 TTCTGGACACAGACGAAGACAGG - Intergenic
1066232456 10:33449568-33449590 ATGTGAGCACAGAGGCAGGCAGG + Intergenic
1066707223 10:38193540-38193562 TTTTGAATTCAGAAGAAGCCAGG - Intergenic
1067328815 10:45294960-45294982 GTGTGATCACTGAGGAAGCCTGG - Intergenic
1067371987 10:45693109-45693131 TTTGGAACTCAGAAGAAGCCAGG - Intergenic
1067387793 10:45833044-45833066 TTTGGAACTCAGAAGAAGCCAGG + Intronic
1067418330 10:46124220-46124242 TTTGGAACTCAGAAGAAGCCAGG - Intergenic
1067446481 10:46351568-46351590 TTTGGAACTCAGAAGAAGCCAGG - Intergenic
1067503689 10:46830804-46830826 TTTGGAACTCAGAAGAAGCCAGG - Intergenic
1067590901 10:47509199-47509221 TTTGGAACTCAGAAGAAGCCAGG + Intronic
1067638020 10:48017299-48017321 TTTGGAACTCAGAAGAAGCCAGG + Intergenic
1067833302 10:49622439-49622461 TGGAGAACACATAGGAAGGCGGG + Intronic
1067875471 10:50003046-50003068 TTTGGAACTCAGAAGAAGCCAGG - Intronic
1069725042 10:70572017-70572039 TTGTGGACCCAGGGGGAGCCAGG + Intergenic
1070134618 10:73681722-73681744 TTTGGAACTCAGAAGAAGCCAGG + Intronic
1071137585 10:82469702-82469724 TTCTGAGTACATAGGAAGCCTGG + Intronic
1071299455 10:84245367-84245389 CTGGGAGCAGAGAGGAAGCCAGG + Intronic
1071607116 10:87002686-87002708 TTTGGAACTCAGAAGAAGCCAGG - Intergenic
1073318522 10:102599786-102599808 GTGTGAACAGACAGGAGGCCAGG + Intronic
1073485894 10:103819010-103819032 TAGAGAAAACAAAGGAAGCCCGG - Intronic
1073560208 10:104489775-104489797 TTGTTGACACAGAGGAAGGAGGG + Intergenic
1075082812 10:119395319-119395341 CAGTGACCACAGAGGCAGCCAGG - Intronic
1075486805 10:122829178-122829200 TTGGGAAAGCAGAGGTAGCCTGG + Intergenic
1076322579 10:129594318-129594340 TTCTGAACAAGGAGGTAGCCTGG + Intronic
1077884656 11:6378001-6378023 TTTTAAACAGACAGGAAGCCAGG + Intergenic
1080640412 11:34155251-34155273 TTGTGCAAACAGGGGAAGGCAGG - Intronic
1080944887 11:36959829-36959851 TTCTAAACACAAAGGAAGACAGG + Intergenic
1081242264 11:40721563-40721585 TTGTGGACACATAGGAAGCCTGG + Intronic
1083555680 11:63624790-63624812 TTCTGAACACAGAAAACGCCTGG + Exonic
1085315477 11:75542291-75542313 TTCTGGACCCAGATGAAGCCTGG - Intergenic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1086040631 11:82472912-82472934 TTGTTAACATTGGGGAAGCCTGG - Intergenic
1087153054 11:94875850-94875872 ATGTGAACACATAGGAGGCATGG - Exonic
1089842012 11:121426696-121426718 TTGGCAACACAGAGGCAGTCTGG + Intergenic
1090603526 11:128397046-128397068 TTGAGAACGAAGAGTAAGCCAGG - Intergenic
1092402523 12:8188798-8188820 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1093137666 12:15471681-15471703 TTGGGAGCAAAGAGGAAGACAGG - Intronic
1093874960 12:24339471-24339493 ATGAGGTCACAGAGGAAGCCAGG + Intergenic
1095535435 12:43240519-43240541 TTGAGAACACAGAGGGAGTGGGG - Intergenic
1096074732 12:48795930-48795952 TAGTGAAGACTGAGGAAGTCTGG - Intergenic
1097015365 12:55982436-55982458 CTGTGAACAGGGAGGAAGGCAGG + Intronic
1098807040 12:75033514-75033536 TTTTGAACAAAGGGGAGGCCAGG + Intergenic
1099346741 12:81509627-81509649 TTGAGTCCACAGAGGAAGTCAGG - Intronic
1099955495 12:89349551-89349573 TTGTGTTCACAGATGAAGCCCGG - Exonic
1100161159 12:91862532-91862554 TTGTGAACCTAAAGGAAGGCTGG - Intergenic
1100541328 12:95560351-95560373 TTTTGAGCACAGAGGAAGAAAGG + Intergenic
1100618439 12:96249587-96249609 TTGTAAACACACAGGAGGCCAGG - Intronic
1101319637 12:103662252-103662274 GGGTGAAGACAGAGGAAGCCAGG + Intronic
1101581699 12:106047681-106047703 TTGGGAATATAGAGGAAGCAAGG - Intergenic
1102180930 12:110911650-110911672 TTGTGATCCCAGTGGAAGGCTGG - Intronic
1102607007 12:114075566-114075588 TTGTGGATACAGAAGATGCCCGG - Intergenic
1102905792 12:116674333-116674355 GTGAGGACACAGAGAAAGCCGGG - Intergenic
1104151489 12:126088199-126088221 TTGTGAAAACAGAGGATTCAGGG - Intergenic
1104814383 12:131637478-131637500 TTGTGGACACATGGGAAGGCGGG + Intergenic
1105566663 13:21555902-21555924 TTGAGAGCACAGTGGAAGCTTGG - Intronic
1105847191 13:24303321-24303343 GTGTGGACACAGACGATGCCAGG - Exonic
1106883005 13:34152286-34152308 TGGTGAACACAGAGGCAAGCAGG + Intergenic
1108224770 13:48277102-48277124 TTGTGAACAGATAGGTAGACAGG + Intergenic
1109278478 13:60328509-60328531 TCCTGCACACAGAGGAAGTCAGG - Intergenic
1110017922 13:70432424-70432446 TGTTGAAAACAGGGGAAGCCTGG + Intergenic
1110087509 13:71399978-71400000 TTGTGAACACAGACAAAACCTGG - Intergenic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1113096373 13:106668326-106668348 GTGTGAACATAGAGGAAGCTGGG - Intergenic
1114250515 14:20956062-20956084 TTGTCACCACAGTGGAAGCCAGG + Exonic
1116552291 14:46256656-46256678 GGGAGAGCACAGAGGAAGCCAGG - Intergenic
1116607414 14:47018913-47018935 ATGTGAACACAGAGGACGGACGG - Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1118075646 14:62295691-62295713 TTGTGGACAGGGAGGATGCCTGG + Intergenic
1118362595 14:65069019-65069041 TGCTGAACAGAGAGGTAGCCAGG + Intronic
1118652514 14:67912626-67912648 GTGAGAACACAGAGGAAGAAGGG + Intronic
1119137020 14:72230397-72230419 TTGTGAAAAGACAGGAAGGCAGG + Intronic
1119942967 14:78660612-78660634 TAGTGACCAAAAAGGAAGCCAGG + Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1120307216 14:82785969-82785991 TTCTAAAAAGAGAGGAAGCCTGG - Intergenic
1123058172 14:105582151-105582173 TTGTGAACACAGCCCAGGCCAGG - Intergenic
1127409164 15:58688137-58688159 TTGTGAACACTGAGGGAGACTGG + Intronic
1128537999 15:68505044-68505066 TTGTTCACACAGAGCAACCCTGG + Intergenic
1128847550 15:70914638-70914660 TAGTGAATACAGAGGAATCTAGG + Intronic
1130111128 15:80966614-80966636 GAGTGGACACAGAGGCAGCCTGG - Intronic
1130666137 15:85871660-85871682 TGGTGAACACAGAGGCAACCCGG + Intergenic
1131167009 15:90149516-90149538 ATGTAAACAAAGAGAAAGCCAGG - Intergenic
1131529551 15:93179969-93179991 GTGTGGACACGGAGGCAGCCAGG + Intergenic
1131546176 15:93317326-93317348 TAGTGAAAAAAGAGGAAGCTGGG + Intergenic
1131669145 15:94600653-94600675 CTGTGATCAAAGAGGAGGCCTGG + Intergenic
1133059198 16:3163526-3163548 TTGTGGACAAAGAGGAAGTTGGG + Intergenic
1133508254 16:6433066-6433088 TTGGGAACAGAGAGAAAGTCAGG + Intronic
1134013766 16:10874322-10874344 GTTTCAACAGAGAGGAAGCCTGG + Intergenic
1136519842 16:30788139-30788161 TTACAAACACAGAGGAATCCTGG + Intergenic
1137947076 16:52743821-52743843 TTGGGAACACAGATGATGCCTGG - Intergenic
1139387712 16:66584731-66584753 TTGTGGACAGAGAGGAAGGGAGG + Intronic
1140213423 16:72988485-72988507 GTGTGAGCTCAGAGGAAGGCTGG - Intronic
1140230977 16:73116860-73116882 ATGAGAACACAGAAAAAGCCTGG + Intergenic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1142646508 17:1317128-1317150 ATGAAAACACATAGGAAGCCGGG + Intergenic
1144441564 17:15287213-15287235 TTATGAATAAAGAGGAAACCAGG - Intergenic
1145030251 17:19499708-19499730 TTGTGAGCATTGAGGAAGCATGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146780619 17:35668250-35668272 TTGTGAATAAAAAGGAAGTCAGG - Intronic
1148320617 17:46748679-46748701 CTGTGAACACACAGGACTCCTGG + Intronic
1151850270 17:76685781-76685803 TGGTGGGCACAGAGGAAGCCAGG + Intronic
1152853770 17:82652077-82652099 GTGTGACCACAGAGGCAGACTGG + Intergenic
1153353437 18:4107997-4108019 TTGAGAAAACAGTGGAAGCAGGG + Intronic
1154087442 18:11321202-11321224 TTTGGCACACAGAGAAAGCCTGG + Intergenic
1155728381 18:29118596-29118618 TCGTGTAGACAGAGGAAGCAAGG - Intergenic
1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG + Intergenic
1161573194 19:5041403-5041425 TGGTGACGAAAGAGGAAGCCAGG + Intronic
1163177735 19:15576247-15576269 TTATGTAGACAGAGGAAGCAAGG + Intergenic
1165095457 19:33407468-33407490 GTGTGAGCACAGAGGTGGCCAGG - Intronic
1165269461 19:34692696-34692718 TGGTGGACACAGAGGAAGAGTGG - Intergenic
1165607089 19:37115058-37115080 TTGTGCGCTCAGAAGAAGCCAGG - Intronic
1166438024 19:42786080-42786102 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166466926 19:43040743-43040765 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166473057 19:43096818-43096840 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166486729 19:43220357-43220379 CAGTGAACACAGAGGAAGTTTGG - Intronic
1167578096 19:50327376-50327398 GAGTGAACACAGAGGGGGCCTGG + Intronic
1168171032 19:54589077-54589099 GTGTGAAGACAGAGGCAACCAGG - Intronic
925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG + Intronic
925554297 2:5113036-5113058 TTGTGAGCATATAGGAAGCAAGG + Intergenic
926050698 2:9742761-9742783 ATGTGAACAGTGAGAAAGCCAGG + Intergenic
926269546 2:11354911-11354933 ATGTGGCCACAGAGAAAGCCAGG - Intergenic
926937973 2:18105023-18105045 TTCTCAGCACAGAGGCAGCCTGG + Intronic
927086108 2:19675331-19675353 TTGGGAACCCAGTGGAAGGCCGG + Intergenic
929904872 2:46036904-46036926 TTGTAAAACCAGTGGAAGCCTGG + Intronic
931091849 2:58894709-58894731 TTGTGCTCACAGAGGAAGGGAGG + Intergenic
932651909 2:73567010-73567032 TGGTGAACACAGGAGAAGCTGGG - Intronic
933075581 2:77921412-77921434 ATGTGAGCAAAGAGAAAGCCAGG - Intergenic
933464423 2:82634420-82634442 TTGTGAAGCCAGAGCAAGGCAGG + Intergenic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
934648390 2:96072587-96072609 TTGAGAAAACAGAGGACGCCGGG + Intergenic
935209601 2:100927512-100927534 TTGGGAAAGCAGAGGAAGACAGG - Intronic
935525768 2:104164668-104164690 GTGTGAAGACAGAGGAAGAAAGG - Intergenic
935563587 2:104583944-104583966 CTGGGAACACAGAGGATACCAGG - Intergenic
936024232 2:109019092-109019114 TTGTAGCCACAGAGGAGGCCCGG + Intergenic
936075207 2:109397425-109397447 TTGTGTACACAGAGGTGGCTGGG - Intronic
937327087 2:120996482-120996504 TTCTAAACCCAGAAGAAGCCAGG + Intergenic
937466836 2:122140221-122140243 TTGACATCACAGAGAAAGCCTGG - Intergenic
937565806 2:123287008-123287030 TTGTAAACACAGAGAAACACAGG + Intergenic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
940235975 2:151511195-151511217 TTGTGTTCACTGAGGGAGCCAGG - Intronic
941390507 2:164907558-164907580 TGATGAAGACAGAGGAGGCCAGG - Intronic
941619679 2:167762549-167762571 TTGTGAATACAAAGGAAGTCTGG + Intergenic
947640376 2:231704402-231704424 TTGTTATTACAGAGGAAGTCAGG - Intergenic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
1168885438 20:1249502-1249524 TTGAGAAGACAAAGGAAACCTGG - Intronic
1169064763 20:2688778-2688800 TGGTGATGACAGAGGAAGCGTGG - Intergenic
1169417533 20:5430467-5430489 CTGAGAACTCAGAGAAAGCCAGG - Intergenic
1172240174 20:33407964-33407986 CTGTGAGCACACAGGCAGCCCGG - Exonic
1172337399 20:34128647-34128669 TTGTGCACTCAGAGAAACCCAGG + Intergenic
1173804646 20:45916266-45916288 TTGTGTACCCAGATGAATCCAGG + Intergenic
1174263138 20:49311965-49311987 GTGACAACACAGAGGAATCCAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175988111 20:62774354-62774376 TTGTGCACACAAAGGAAGGAGGG - Intergenic
1180036905 21:45254767-45254789 TTGTGAAAGCAGAGGGAGCCTGG + Intergenic
1182282651 22:29226217-29226239 TTTTGGACACAGAGGCTGCCAGG + Intronic
1183106860 22:35621163-35621185 TTTTGCACACAAAGGCAGCCTGG - Intronic
1183713455 22:39520193-39520215 TTGTGAAGGCCGAGGACGCCAGG - Intronic
1184615514 22:45635506-45635528 TTGTGAGCACAATGGGAGCCTGG - Intergenic
951294858 3:20921463-20921485 CTGGGAACAAAGAGAAAGCCCGG - Intergenic
951432826 3:22628084-22628106 TTGTGGACTCTGAGGAATCCAGG - Intergenic
955658062 3:61265605-61265627 TTGTGATCACAGAGAAAGAGGGG - Intergenic
956252891 3:67253310-67253332 TTGTGAATGCAGAAAAAGCCAGG - Intergenic
956447109 3:69336303-69336325 TTGTGAACACACAGATTGCCGGG - Intronic
958813240 3:98887574-98887596 TTGTGAACACTAAAGAAGACTGG - Intronic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
962420721 3:135226326-135226348 CTGTGATAAAAGAGGAAGCCAGG - Intronic
962900917 3:139760758-139760780 TTGTTAACACAGAGAAAGGTAGG + Intergenic
965991437 3:174823734-174823756 TTTTAATCTCAGAGGAAGCCAGG + Intronic
966324951 3:178743515-178743537 TTGTCAACACAGCAGGAGCCTGG - Intronic
967084513 3:186081816-186081838 TTGTAAGCACAAAGGTAGCCAGG - Intronic
967112998 3:186311819-186311841 TTAAGAACACAGAGTAGGCCGGG + Intronic
967256596 3:187599220-187599242 TTGTGTACAATGAGGAAGACAGG - Intergenic
967655256 3:192040712-192040734 TAGTGCATACAGAGGAACCCAGG - Intergenic
968041833 3:195595312-195595334 TTGAGACCACAGAGGGACCCTGG + Intergenic
969202753 4:5618706-5618728 CTCTTAACACAGAGAAAGCCTGG + Intronic
969752582 4:9122924-9122946 TTGTGCGCTCAGAGGAATCCAGG + Intergenic
971230653 4:24798446-24798468 TGGTGCACACAGAGGAGGCATGG - Intronic
971652257 4:29293371-29293393 CTTTGAAGATAGAGGAAGCCAGG - Intergenic
973638298 4:52879776-52879798 TGCTGAACACAGAGGAAGCAGGG + Intronic
974422663 4:61697778-61697800 TTCAGAACAGAGAGGAATCCAGG - Intronic
976757809 4:88516897-88516919 CTGTGAACAGATATGAAGCCAGG + Intergenic
976825931 4:89260231-89260253 TAGAGAACACAGAGAAACCCAGG + Intronic
979342515 4:119543368-119543390 TTGTTTACACAGAGGTAGGCTGG - Intronic
979351662 4:119650660-119650682 TTGTGAACAAAGAGAACTCCAGG + Intergenic
980882231 4:138723636-138723658 TGGTGAACACAAATGAAGTCAGG - Intergenic
980930696 4:139179613-139179635 TCTTGAACACAGAGGAAACCTGG + Intergenic
980992775 4:139752441-139752463 TTGTGAGCACAGAGAGAGCCAGG - Intronic
981748716 4:148073757-148073779 TTGAGACCACAGAGGAGCCCAGG + Intergenic
982166098 4:152614772-152614794 TTGGGTACAAAAAGGAAGCCAGG - Intergenic
983215277 4:164996765-164996787 TTGTGCACTCGGAAGAAGCCAGG + Intergenic
985129816 4:186727756-186727778 TTCTGAGCACAGAGGAAACTGGG + Intergenic
985638182 5:1050490-1050512 TTGACAACACAAAGGATGCCTGG + Exonic
986160832 5:5226877-5226899 GGGTGACCACAGAGGAACCCAGG - Intronic
986825040 5:11511397-11511419 GTGGTAACAAAGAGGAAGCCAGG + Intronic
988102487 5:26699476-26699498 TTGTGAAGTCAAAGAAAGCCTGG - Intergenic
988235781 5:28542185-28542207 TTGTTCACACAGAGGAGGCAAGG + Intergenic
989837307 5:46008800-46008822 TTGTGTGCTCAGAAGAAGCCAGG - Intergenic
990128068 5:52543506-52543528 TTGTAAAGACAGAGAAAGCCAGG - Intergenic
990894238 5:60680873-60680895 TTGTGAAAATAGAGGCAGCCTGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991720495 5:69491248-69491270 TTGTTAACACTGGGGAAGTCAGG - Intergenic
992660442 5:78954941-78954963 TTGTGACCATAGAGGATGTCTGG + Intronic
994179968 5:96753401-96753423 TGGTGAACACAGAGGACGAATGG - Intronic
994756619 5:103800993-103801015 TTGGGAACACAGCCAAAGCCTGG + Intergenic
994994362 5:107041006-107041028 TTGTGAACAGAGATGAACCTAGG + Intergenic
995171931 5:109124479-109124501 TTCTGAATACAGAGGAAGAGAGG - Intronic
996772398 5:127098921-127098943 GAGGGAACAGAGAGGAAGCCTGG + Intergenic
997074875 5:130661899-130661921 TTTTGAACCCAGATGAAGACAGG + Intergenic
998167908 5:139855041-139855063 AAGTGAACAGAGAGGGAGCCGGG - Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
999474887 5:151889561-151889583 TCGTGAAAACACAGGTAGCCAGG - Intronic
999962734 5:156774832-156774854 TTCTGAACACAGAGAATACCTGG + Intergenic
1001055879 5:168449536-168449558 ATGTGAACACACAGGGAGACAGG - Intronic
1001585180 5:172829263-172829285 TTGTTATCACACAGGAATCCAGG + Intergenic
1002306537 5:178286929-178286951 CTGTGAATACAGAGTAACCCGGG + Intronic
1002651194 5:180696503-180696525 TTGTTAACAGATAGGAAGCAAGG - Intergenic
1003243442 6:4364437-4364459 TTATGACCACAGAAAAAGCCTGG - Intergenic
1004264345 6:14135957-14135979 TTGTGAACTGACAGGCAGCCTGG + Exonic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005622824 6:27635670-27635692 TTGTAAACTCTGATGAAGCCGGG - Intergenic
1006994464 6:38245471-38245493 GTGGGAAAACAGAGGATGCCAGG + Intronic
1007416016 6:41691731-41691753 TTGTGAGCAGAGGGGAAGACAGG - Intronic
1008068591 6:47076196-47076218 GTGAGCACACAGAGAAAGCCTGG - Intergenic
1008730123 6:54472105-54472127 TAGGGAACTCAGAGGAAGTCAGG - Intergenic
1008962223 6:57277563-57277585 TTGGGAACACAGCAGAAGCCGGG + Intergenic
1010288441 6:74107573-74107595 CTGTCACCACAGAGCAAGCCAGG - Intergenic
1011237231 6:85230847-85230869 TTCTGATCAGAGAGGAAGCAAGG - Intergenic
1013817592 6:114117317-114117339 TAGAAAACACAGAGGTAGCCTGG + Intronic
1015874463 6:137808918-137808940 CTGTGAGCACAGTGTAAGCCAGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017760716 6:157566000-157566022 TTGTGCACCCAGAGAAAGCCAGG - Intronic
1018899833 6:168045491-168045513 TGGTGAAGAAAGAGGGAGCCTGG - Intergenic
1019758361 7:2789816-2789838 TTGCAGCCACAGAGGAAGCCAGG + Intronic
1022297590 7:29070575-29070597 TTGTAAACACAAAGGAAGAGGGG - Intronic
1022505157 7:30905191-30905213 CTGGGAACACCGAAGAAGCCAGG + Intergenic
1023455110 7:40330130-40330152 TTGAGAACAGAAAGGAAGCAAGG + Intronic
1023726919 7:43152096-43152118 TTGTCTACACAAAGGAATCCAGG - Intronic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1031767117 7:125794630-125794652 GTGTTAACACAGAAGAGGCCAGG + Intergenic
1032803894 7:135337620-135337642 TTGAGCAGAGAGAGGAAGCCGGG + Intergenic
1035457939 7:159021391-159021413 TTGGGAATACAGAGGCAGACTGG - Intergenic
1036345775 8:7961559-7961581 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1036862910 8:12368565-12368587 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1037910304 8:22740133-22740155 TTGTGAACAGAAAGGAAGAAAGG + Intronic
1038113479 8:24526061-24526083 GTGTCATCACAGAGGTAGCCTGG - Intronic
1038327112 8:26579576-26579598 TTGTGCACGGAGAGGAAGCCGGG - Intronic
1041707232 8:60859543-60859565 TTGTGAGCCCAAAGGAAGCCTGG + Intronic
1043516916 8:81003137-81003159 TTGTTAATACAGAGGTTGCCGGG - Intronic
1043754717 8:83988564-83988586 ATGAGAACCCAGAGGAGGCCAGG - Intergenic
1044287129 8:90422151-90422173 TTGTGAGCAGAGAGGATACCAGG + Intergenic
1046760909 8:118019392-118019414 TTGTGGACAGAGAGAAAGACAGG + Intronic
1047164467 8:122421528-122421550 TTGTGGACCCCAAGGAAGCCTGG - Intergenic
1047757209 8:127927812-127927834 TCGTGAATTCAGAGGATGCCAGG - Intergenic
1048920731 8:139227533-139227555 TTGGGAATAAAGAGGAATCCAGG + Intergenic
1049876667 8:145027686-145027708 TTGTGCACTCAGAGGAATCCAGG - Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051191772 9:14520379-14520401 TTATGAACACAGACCCAGCCCGG + Intergenic
1051522652 9:18007149-18007171 TTGTTAACACAGTTTAAGCCAGG + Intergenic
1054455979 9:65430652-65430674 TTCTGTGCACAGGGGAAGCCTGG - Intergenic
1054971952 9:71098390-71098412 GTGTGGAAACAGAGCAAGCCAGG + Intronic
1058105663 9:100968538-100968560 TTGTTAACACTGAGGAGGCAGGG + Intergenic
1058590252 9:106557890-106557912 TGGTGAACAAGGAGGAAGCCAGG - Intergenic
1059239615 9:112792905-112792927 ATGGGAACACAGAGTAAGTCTGG + Intronic
1059912410 9:119059849-119059871 TGGAGACCACATAGGAAGCCTGG + Intergenic
1060658976 9:125391951-125391973 TTGTGAGCACAGAGCATGCCTGG - Intergenic
1061091945 9:128431531-128431553 CTGAGAACACAGAGGAGGACAGG + Intronic
1061894117 9:133638092-133638114 TAGGGAAGCCAGAGGAAGCCAGG + Intronic
1062487712 9:136788674-136788696 TTGTGCACTCGGAGGAACCCAGG - Intergenic
1186123216 X:6384914-6384936 TTATGAACACAGAGATCGCCTGG - Intergenic
1186147607 X:6641269-6641291 TTCTGATCAGAGAGGAAGGCTGG - Intergenic
1186650281 X:11552285-11552307 ATGTGGAGACAAAGGAAGCCTGG + Intronic
1189155760 X:38755446-38755468 TTGTTAACACAGAGATGGCCAGG - Intergenic
1189607948 X:42699859-42699881 TTGATATCACAGAGGAAGCCTGG + Intergenic
1192778822 X:74273499-74273521 TTTTGAACACAGAAAAAGGCCGG + Intergenic
1193006692 X:76626705-76626727 TCGTGATCACAGAGGCTGCCTGG - Intergenic
1194862037 X:99011413-99011435 TTGTAAGCACTGAGGAAGCAGGG - Intergenic
1195164654 X:102207256-102207278 TAGTTAACACAGAGGTAGCAAGG + Intergenic
1195194205 X:102479835-102479857 TAGTTAACACAGAGGTAGCAAGG - Intergenic
1195285171 X:103376730-103376752 TTGGGAACACAGAGGCCCCCAGG + Intronic
1197599945 X:128517327-128517349 TACTGAAGACAGAGGAAGCTGGG + Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1198831208 X:140752481-140752503 CTGTTCACACAGAGAAAGCCAGG - Intergenic
1199471330 X:148199052-148199074 TTGTCCACTCAGAGGAAGCCTGG + Intergenic
1200055826 X:153460152-153460174 TTGTGCTCAGTGAGGAAGCCAGG + Intronic
1200257238 X:154589764-154589786 TTGTGCACACGGAGGAACCCAGG + Intergenic
1200260532 X:154614638-154614660 TTGTGCACACGGAGGAACCCAGG - Intergenic
1200426223 Y:3023281-3023303 TTGGGTACAGAGAGGAGGCCTGG + Intergenic
1200792636 Y:7313280-7313302 TTGTCCGCACAGAGGAAACCTGG - Intergenic
1200988624 Y:9327932-9327954 GAGTGAACAGAGAGGAGGCCAGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1202119366 Y:21508260-21508282 GAGTGAACAGAGAGGAGGCCAGG - Intergenic
1202121818 Y:21531800-21531822 GAGTGAACAGAGAGGAGGCCAGG - Intronic
1202157188 Y:21897582-21897604 GAGTGAACAGAGAGGAGGCCAGG + Intronic
1202159634 Y:21921123-21921145 GAGTGAACAGAGAGGAGGCCAGG + Intergenic
1202186081 Y:22186038-22186060 GAGTGAACAGAGAGGAGGCCAGG + Intergenic
1202205278 Y:22400358-22400380 GAGTGAACAGAGAGGAGGCCAGG - Intronic