ID: 933700445

View in Genome Browser
Species Human (GRCh38)
Location 2:85251661-85251683
Sequence CACAGGGAACTATCAAAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700445 Original CRISPR CACAGGGAACTATCAAAAAG CGG (reversed) Intronic
903023799 1:20412754-20412776 CACAAGAAAATGTCAAAAAGTGG + Intergenic
903255247 1:22093576-22093598 TGCAGAGAACTATCAAAATGAGG - Intergenic
906847128 1:49205301-49205323 CACAGGGAACAATGAAGAAGAGG - Intronic
909132379 1:71754057-71754079 CAGAGGGTACTATCAAAAAGAGG + Intronic
910784975 1:90987106-90987128 CTCAAGGAACTAGAAAAAAGAGG + Intronic
912221056 1:107675977-107675999 ACCAGAGAACTATCAAACAGAGG + Intronic
914767272 1:150649708-150649730 CACATAGATCTATCAAAAAAGGG + Intronic
915937932 1:160099634-160099656 CACAGGAAACTAACACAAAATGG + Intergenic
916293665 1:163193002-163193024 CACAAGAAAATATCAAAAAGTGG + Intronic
918661182 1:187090740-187090762 CACTGGGAAGTGTCAGAAAGTGG - Intergenic
919559446 1:199098594-199098616 CAGAGGGAAGTATCACACAGAGG + Intergenic
920816675 1:209340950-209340972 CACAGAGAGCTTTCCAAAAGAGG - Intergenic
921127113 1:212187790-212187812 CACAGGGCACTGTCAAATATTGG - Intergenic
922400954 1:225254979-225255001 CACAGGGAACTAACTGAAAGGGG + Intronic
922467028 1:225851310-225851332 CACAGGGGACCAACAGAAAGTGG + Intronic
922814113 1:228437097-228437119 CACAGGAAAGAATCTAAAAGTGG + Intergenic
923641311 1:235764074-235764096 GACAGGGAACTAGGAGAAAGTGG - Intronic
1066187178 10:33021492-33021514 TACAGGGAAATCTCAAAAAGAGG + Intergenic
1069052153 10:63806730-63806752 CAAAGGAAACTATCAACAAAGGG - Intergenic
1069096337 10:64263960-64263982 CACATTAAACTAACAAAAAGGGG - Intergenic
1069691173 10:70353921-70353943 CCCATGGAACTATATAAAAGGGG + Intronic
1075566018 10:123504918-123504940 CACAAGGAACTGTCCATAAGCGG - Intergenic
1077925578 11:6679409-6679431 CACAGGGAAACATCCAAAATAGG + Intergenic
1079939671 11:26663723-26663745 CATAGCCAACTGTCAAAAAGAGG + Intergenic
1081043179 11:38237006-38237028 CACTGGGGCCTATCAGAAAGTGG - Intergenic
1081216189 11:40401587-40401609 CAAAGGAAACTATCACAAATTGG + Intronic
1081706302 11:45183643-45183665 CACAGGGTACTATCAATAGATGG + Intronic
1082933340 11:58631635-58631657 CAGAAGGAAATATCAAAGAGGGG + Intergenic
1082968823 11:58997183-58997205 CACAGGGAACAATGATAAATGGG - Intronic
1083642781 11:64154351-64154373 CACGGGGATCAATCCAAAAGAGG - Intronic
1084801898 11:71549443-71549465 CCCATGGAATTATCAAGAAGGGG - Exonic
1085019719 11:73198091-73198113 GTCAGGGGCCTATCAAAAAGAGG + Intergenic
1086991599 11:93309809-93309831 CACAGGGTCCTATCAAAGGGGGG + Intergenic
1086998344 11:93385488-93385510 CACAGAGAATTATTAAAAATAGG + Exonic
1088803077 11:113324902-113324924 CACAGGGAAGCTTCAGAAAGAGG - Intronic
1090691208 11:129184134-129184156 CCCAGGGTACTAACAAAAACTGG + Intronic
1093511722 12:19936882-19936904 CAGAGAGGACTATGAAAAAGTGG + Intergenic
1093969379 12:25360940-25360962 CACAGGGAAAGATCAAGGAGAGG + Intergenic
1094597551 12:31878982-31879004 CCCAGGGAACAGTCTAAAAGAGG + Intergenic
1094739587 12:33273854-33273876 AACAGGAAACTATCAAAACTGGG - Intergenic
1095163744 12:38947250-38947272 CAAAGGGAACAATCAACAATGGG + Intergenic
1095578595 12:43768408-43768430 CAAAAGGAACAATCAAAAAGAGG - Intronic
1099432845 12:82608578-82608600 AACCAGGAACTAGCAAAAAGCGG + Intergenic
1100691004 12:97038442-97038464 CACAGGGAAATAATAAAAATAGG - Intergenic
1103115802 12:118330562-118330584 AAGAGGAAACTATCACAAAGAGG + Intronic
1105059137 12:133131723-133131745 CAAATGTAACTTTCAAAAAGAGG - Intronic
1108186782 13:47895890-47895912 GCCAGGGAACTACCAAAAACTGG + Intergenic
1108852013 13:54741351-54741373 AACAAACAACTATCAAAAAGTGG - Intergenic
1109410357 13:61957503-61957525 CATAGGGTACTATCAATTAGTGG - Intergenic
1110245179 13:73315434-73315456 CAAAGGAAACAATCAACAAGCGG + Intergenic
1113559117 13:111263716-111263738 CACAGTGAAATATCAGGAAGAGG - Intronic
1116897994 14:50335889-50335911 CATAGGGAACTCTGAAACAGAGG - Intronic
1117631685 14:57699772-57699794 CCCAGGGAACTAGAAAAATGAGG + Intronic
1120722566 14:87904658-87904680 CCCAGGGAACTTTCTAAAAATGG + Intronic
1124158377 15:27248306-27248328 AACAGGGATCTACCAAAATGGGG - Intronic
1124360497 15:29033361-29033383 CACAGGGAACTATTAATACATGG - Intronic
1127726102 15:61751563-61751585 CACAGGGAAATAGCAATATGAGG - Intergenic
1129095618 15:73204429-73204451 CATGGGGCATTATCAAAAAGTGG - Intronic
1132085269 15:98903463-98903485 CCCAGGGAAATGTGAAAAAGCGG - Intronic
1132774884 16:1587888-1587910 CTCAGGGAACTCTCATCAAGGGG + Intronic
1140489255 16:75320496-75320518 CACAGGGAAAAATCAAAGAATGG - Intronic
1141518204 16:84560357-84560379 CACAGGGAACCTTCTAGAAGAGG + Intergenic
1141609320 16:85172107-85172129 CAGTGGGATCTATCAAACAGAGG + Intronic
1142934304 17:3314849-3314871 CACTGTGAACTACTAAAAAGAGG - Intergenic
1143102450 17:4511934-4511956 CACAGGGAAGTAGGAAAAAGTGG - Intronic
1143687317 17:8528335-8528357 CAGAGTGAACCAGCAAAAAGGGG - Intronic
1144129026 17:12228183-12228205 AACAGGAAACCATCAAAACGGGG - Intergenic
1144271957 17:13626084-13626106 AACAAGGAAATATCAAACAGTGG + Intergenic
1145849881 17:28082491-28082513 CAAAGGGAACTGATAAAAAGGGG - Intronic
1149854848 17:60073087-60073109 CACAGGGAACTACCTACAAAGGG + Intronic
1152705930 17:81843653-81843675 CAGACGGAATTTTCAAAAAGAGG + Exonic
1153086551 18:1295040-1295062 CACAGGGAACTTTCAGGATGAGG + Intergenic
1154131347 18:11739262-11739284 CACAGGGAAATGTGAACAAGAGG - Intronic
1155480458 18:26281125-26281147 CACTGGGAACTACTAGAAAGTGG + Intronic
1156297464 18:35805902-35805924 CACAGGCATCTACCAAGAAGAGG - Intergenic
1157389355 18:47288283-47288305 GACAGGAAACTTTCAAAAACAGG + Intergenic
1158245929 18:55431906-55431928 CATAGGGAGCTACCAAAAGGCGG + Intronic
1160074271 18:75657635-75657657 CACAGGGAACTATGAGAACGAGG + Intergenic
1162783825 19:13021877-13021899 CAAAGGGCTCTATCAAAAACAGG - Intronic
1164039072 19:21478574-21478596 CACTGGGGTCTTTCAAAAAGTGG + Intronic
1164152011 19:22562454-22562476 CACACTGAACTAGCAAAAATTGG - Intergenic
1167415042 19:49365568-49365590 CCCTGGGAACTACCACAAAGAGG + Exonic
925547794 2:5037223-5037245 CACAGGCAACTAAGAACAAGTGG - Intergenic
926326219 2:11786566-11786588 CACAGGGCCCTTTCAAAAATGGG - Intronic
931143814 2:59493916-59493938 CACTGGGAACTATGAGACAGGGG - Intergenic
931620456 2:64204871-64204893 CACAGGAAACATTCAACAAGTGG - Intergenic
932834931 2:75027461-75027483 CACTGGGAATTTACAAAAAGAGG - Intergenic
933593453 2:84259009-84259031 CACAGGGAGAAATCAAAAAAAGG + Intergenic
933700445 2:85251661-85251683 CACAGGGAACTATCAAAAAGCGG - Intronic
936431599 2:112469258-112469280 CAAAGGAAACCATCAAAAAGTGG + Intergenic
939765636 2:146245721-146245743 TACAGGCAACTACCAAAAACAGG + Intergenic
939786030 2:146514258-146514280 CACTGGGAACTACTAGAAAGGGG - Intergenic
940392811 2:153152267-153152289 CCCAGGGAAATATCATAAATGGG + Intergenic
941170163 2:162126391-162126413 CACAGAGAGCTGACAAAAAGAGG - Intergenic
941279071 2:163527205-163527227 CAAAGGACATTATCAAAAAGTGG + Intergenic
942468622 2:176235557-176235579 AACAGGCATGTATCAAAAAGTGG - Intergenic
943625897 2:190198984-190199006 CACAGGGAACAGTCAATAGGTGG + Intronic
944623057 2:201538824-201538846 CACTGGGACCTATCAGAGAGTGG - Intronic
948278728 2:236730046-236730068 CAAAACGAACTATCAGAAAGAGG + Intergenic
1168963152 20:1882339-1882361 CCCAGGGAAATATCTAGAAGGGG + Intergenic
1169474895 20:5922651-5922673 GGGAGAGAACTATCAAAAAGGGG + Exonic
1169645677 20:7806941-7806963 CACAGGTGACTGTGAAAAAGTGG - Intergenic
1170163338 20:13337877-13337899 CACATGGAACTTACAAAAGGGGG + Intergenic
1170798790 20:19572931-19572953 CACTTGAAACTATGAAAAAGAGG + Intronic
1171004041 20:21445575-21445597 CACAGAGAACTATCTACAAAAGG - Intergenic
1171780761 20:29415749-29415771 TACAGGGAACTGTCCAGAAGAGG - Intergenic
1172207998 20:33178116-33178138 CACAGGGAACTATTAAAGTCTGG - Intronic
1172317713 20:33969141-33969163 CACAGGGAAATAGAAAACAGGGG + Intergenic
1172660112 20:36562158-36562180 CTCAGGGAATTATCAAACTGAGG - Intergenic
1173379462 20:42526495-42526517 CACAGAGAAGTATCAAGCAGAGG - Intronic
1173962632 20:47086891-47086913 AACAGGCAAATATTAAAAAGAGG - Intronic
1177459485 21:21392107-21392129 CACTGGGAACTATCAAAGGGTGG - Intronic
1179348189 21:40581270-40581292 CCCATGGAACTAGCAAAAGGTGG - Intronic
1183568128 22:38631371-38631393 CACGGGGGACTCTCAAAAGGGGG + Intronic
953401289 3:42620787-42620809 CACAAGGAACAACCACAAAGTGG - Intronic
954013269 3:47662493-47662515 CAATGGGAAGTCTCAAAAAGTGG + Exonic
954767589 3:52933517-52933539 CAAAGGGACATATGAAAAAGTGG + Intronic
956075323 3:65498788-65498810 CACATGTAGCTATTAAAAAGTGG + Intronic
956548078 3:70428729-70428751 AACAGTGATCTATCTAAAAGTGG + Intergenic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
960615169 3:119589712-119589734 CACAGGCACATTTCAAAAAGAGG + Exonic
962576321 3:136758398-136758420 CACTTGGAACTCTGAAAAAGGGG - Intergenic
962812915 3:138974353-138974375 TCCAGGGAACTATAAAGAAGTGG - Intergenic
963100868 3:141602549-141602571 TACAGTGTACTATCTAAAAGAGG - Intronic
963373074 3:144426974-144426996 CACATGGAACACGCAAAAAGTGG - Intergenic
963659831 3:148111747-148111769 CACAGTGACTTTTCAAAAAGTGG - Intergenic
964917563 3:161854925-161854947 CACAGGGATCCATCAGGAAGGGG - Intergenic
966078210 3:175964759-175964781 CACTGGGGACTATAAAAAGGGGG - Intergenic
967230452 3:187332856-187332878 CACAGGAAACTAGAAAACAGAGG + Intergenic
968432876 4:569039-569061 AAAAGGGAACTAGCAAAACGTGG + Intergenic
969215752 4:5720937-5720959 CACAGGGCACATTCAAATAGGGG - Intronic
969441655 4:7220643-7220665 CACATGGAACTTTCCAAAACTGG - Intronic
969926604 4:10591550-10591572 CAGAGGGAAATATACAAAAGAGG + Intronic
970712609 4:18880998-18881020 CACAGGGTATTATCACAAAGAGG - Intergenic
971151700 4:24039555-24039577 CAAAGGGAGGTCTCAAAAAGAGG + Intergenic
971735849 4:30450987-30451009 AAGAGTGAACTATGAAAAAGGGG - Intergenic
972029536 4:34436291-34436313 CACTGGGAACTCTAAAAGAGGGG + Intergenic
973047852 4:45556766-45556788 CACTGTGAAGCATCAAAAAGAGG - Intergenic
973126276 4:46589408-46589430 CACTGGGGACTATCAGAAGGTGG - Intergenic
974765183 4:66335501-66335523 CAAAGGGAATTAGTAAAAAGAGG - Intergenic
976320997 4:83715523-83715545 CACAGGGGAATTTCAAAATGTGG - Intergenic
977132587 4:93261028-93261050 CCCAGGGAACTATGATGAAGAGG - Intronic
978514422 4:109556338-109556360 AAAAGGTAACTTTCAAAAAGAGG - Intergenic
978797117 4:112719370-112719392 CTCAGGGAACTATGATACAGTGG + Intergenic
979212874 4:118127214-118127236 CACAGGCAACCAACAAAAAATGG - Intronic
981658263 4:147136957-147136979 CACAGGGAGCTTTCAAAACTAGG - Intergenic
982947659 4:161646958-161646980 CAAAGGAAACAATCAAAAAGTGG - Intronic
983459153 4:168005675-168005697 CACAGGGAACTTGGAAAAGGAGG - Intergenic
984083975 4:175285388-175285410 TAAAGTGAACTATCAAAAAGTGG + Intergenic
984956738 4:185052749-185052771 CACAGGAAAGTTTGAAAAAGTGG - Intergenic
988549414 5:32186567-32186589 AACAGGAAGCCATCAAAAAGGGG + Intergenic
990038197 5:51348779-51348801 CACAGGGGAGTGTCAGAAAGTGG + Intergenic
990375786 5:55169191-55169213 CACTGGGCAACATCAAAAAGAGG + Intronic
990390310 5:55312508-55312530 GACAGGGATGTATTAAAAAGGGG - Intronic
990434498 5:55774488-55774510 CAAAGGGTACTATCAAGAAAGGG - Intronic
990550894 5:56877247-56877269 GAAAAGGAACTAGCAAAAAGAGG - Intronic
992344955 5:75867246-75867268 CACACGGACCTATCAACCAGAGG + Intergenic
993249481 5:85500057-85500079 CATAGTGTAATATCAAAAAGAGG - Intergenic
994598186 5:101866231-101866253 CACTGGGGACTATCAAAAGGTGG + Intergenic
994718068 5:103347583-103347605 TACAGGCAACTCTCAATAAGTGG - Intergenic
996767630 5:127050198-127050220 GACAGGGAATTATCCAAGAGTGG + Intronic
997107292 5:131034723-131034745 CACTGGGGAGTGTCAAAAAGTGG - Intergenic
999115412 5:149159014-149159036 CACAGGGAAATATCTAGGAGAGG - Intronic
1002257638 5:177970393-177970415 CAAAGGAAACAATCAAAAAAAGG + Intergenic
1004315125 6:14580145-14580167 CACATGGATCCATCAACAAGGGG + Intergenic
1004332752 6:14736606-14736628 CCCAGGGAATTACAAAAAAGTGG - Intergenic
1006713655 6:36098785-36098807 CCAAGGGAAATAACAAAAAGGGG - Intronic
1009968695 6:70604233-70604255 CACAGGGATCCATCGAAGAGTGG + Intergenic
1010878408 6:81138143-81138165 CACAAGGAACTATGCAAAACTGG + Intergenic
1013205308 6:107939462-107939484 CAAATTGAACTATCAAAAAAAGG + Intronic
1014032372 6:116720243-116720265 GAGAGGGAACTACCAATAAGAGG - Intronic
1014794939 6:125713977-125713999 CAGAGAGAACTATCAAGGAGTGG - Intergenic
1015436468 6:133195367-133195389 CACTGGTAACTCTGAAAAAGTGG + Intergenic
1016743862 6:147557554-147557576 CACAGGGACATACCAACAAGAGG - Intronic
1016924839 6:149334233-149334255 CACAGGGAATAATGAAAAAAAGG - Intronic
1018718010 6:166549852-166549874 CACAGGGCAGTATGAAAACGAGG - Intronic
1021406238 7:20270477-20270499 CACGGGGAATTATGTAAAAGTGG + Intergenic
1021450872 7:20783592-20783614 CTCAGGGAACAAAGAAAAAGAGG + Intronic
1021779680 7:24090808-24090830 CACAGGGAACTCTTCAAAAGTGG - Intergenic
1025997144 7:66535092-66535114 CAAAGGGAACTGTCTTAAAGTGG - Intergenic
1027885943 7:83904902-83904924 CAAAGAGAATTACCAAAAAGAGG - Intergenic
1028643892 7:93073821-93073843 CACTGGGAAGTGTCAGAAAGTGG - Intergenic
1029807319 7:103010615-103010637 CACAGGGACCTATGCAAAACTGG - Intronic
1030481029 7:110103940-110103962 CACAGGGAAATATGAAGAAGAGG + Intergenic
1031908253 7:127485559-127485581 CTCAGGCAACTTTCAAATAGAGG + Intergenic
1036776286 8:11615021-11615043 GAAAGGGAACAATTAAAAAGAGG + Intergenic
1037170682 8:15887735-15887757 CAAATGGAACTATCAGACAGGGG + Intergenic
1039195291 8:35024222-35024244 CACTGGGAACTACCAGAAGGAGG - Intergenic
1042319757 8:67461873-67461895 AACAGGGAAGAAGCAAAAAGAGG - Intronic
1042328198 8:67550201-67550223 CACTGGGGACTAACAAAAAGGGG - Intronic
1044015241 8:87042608-87042630 CACAGAAAACTCTCCAAAAGGGG - Intronic
1047200780 8:122764486-122764508 CACTGGGACCTACCAAAAGGTGG + Intergenic
1047356712 8:124129154-124129176 CACAGGGATCTATGAAAAACTGG + Intergenic
1048109334 8:131450693-131450715 CACTGGGGCCTATCAAAGAGTGG - Intergenic
1048437034 8:134427758-134427780 CCCAGGGAATTTTCAAGAAGAGG - Intergenic
1050720763 9:8586504-8586526 CAAAGGCAATTATCAAAAAAAGG + Intronic
1051036982 9:12759682-12759704 CACAGGGAAGTAGAACAAAGGGG - Intergenic
1051440368 9:17076517-17076539 CACAGAAAACTATGAAAAAGGGG - Intergenic
1051464015 9:17355393-17355415 CAAAGGATACTATCAAAAAGGGG - Intronic
1051709481 9:19915882-19915904 AAAAGGAAACTATCAAAAAAGGG - Intergenic
1057324767 9:94051225-94051247 CACTGGGGAGTGTCAAAAAGTGG - Intronic
1057642693 9:96840584-96840606 CACTGGTGTCTATCAAAAAGTGG + Intronic
1058194873 9:101960220-101960242 CACAGGGAACTGACAAAATCTGG + Intergenic
1058554508 9:106152660-106152682 CACTGGGACCTATCAGAAGGTGG + Intergenic
1058887864 9:109336333-109336355 CACTGGGAAATATTAAGAAGCGG + Intergenic
1059223983 9:112654187-112654209 CACAGGAAACTATCAAAGTTTGG + Intronic
1060240255 9:121897103-121897125 CACAGGAAAAGATCAAAAGGGGG + Intronic
1187100471 X:16186270-16186292 CACAGTGAACTATCATAATGAGG + Intergenic
1189766424 X:44377161-44377183 CACTGGGAACTACCAAAGCGGGG + Intergenic
1190040478 X:47067399-47067421 CAAAGGGAACAATCAACAAAGGG - Intergenic
1191697463 X:64004631-64004653 CACTGGGGACTACCAGAAAGGGG + Intergenic
1192057492 X:67787200-67787222 CAAGGGGAACTATCAAAGAGAGG + Intergenic
1194335268 X:92639348-92639370 CACTAGGGCCTATCAAAAAGTGG + Intergenic
1194896928 X:99454523-99454545 CACATGAAAGTATGAAAAAGAGG - Intergenic
1195101341 X:101557046-101557068 CAAAGGACACCATCAAAAAGTGG - Intergenic
1195309022 X:103612059-103612081 CAGAGGCAACTATCAATAATTGG + Intronic
1196346540 X:114667062-114667084 CTCTGGGCACTATCAAAATGAGG + Intronic
1196826631 X:119745835-119745857 GACAGGAAACTTTCCAAAAGTGG + Intergenic
1197344592 X:125317745-125317767 GACAGGGAGCTATCAAAAACAGG - Intergenic
1198283532 X:135167634-135167656 CAGAGGAAACAATCAAAGAGTGG + Intronic
1198411681 X:136375715-136375737 CAAAGGATCCTATCAAAAAGTGG - Intronic
1199388344 X:147249442-147249464 CACTGGGACCTATCAAAGGGTGG + Intergenic
1200326191 X:155242178-155242200 CACAGGGAACTGTTAAAAAGAGG - Intergenic
1200643737 Y:5756382-5756404 CACTAGGGCCTATCAAAAAGTGG + Intergenic