ID: 933700937

View in Genome Browser
Species Human (GRCh38)
Location 2:85255155-85255177
Sequence CTGGGTCAAGAGGTGTGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700937_933700944 30 Left 933700937 2:85255155-85255177 CCACGACACACCTCTTGACCCAG 0: 1
1: 0
2: 0
3: 4
4: 124
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71
933700937_933700939 -7 Left 933700937 2:85255155-85255177 CCACGACACACCTCTTGACCCAG 0: 1
1: 0
2: 0
3: 4
4: 124
Right 933700939 2:85255171-85255193 GACCCAGACTGCATCTTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 63
933700937_933700943 29 Left 933700937 2:85255155-85255177 CCACGACACACCTCTTGACCCAG 0: 1
1: 0
2: 0
3: 4
4: 124
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700937 Original CRISPR CTGGGTCAAGAGGTGTGTCG TGG (reversed) Intronic