ID: 933700938

View in Genome Browser
Species Human (GRCh38)
Location 2:85255165-85255187
Sequence AAGATGCAGTCTGGGTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700938_933700943 19 Left 933700938 2:85255165-85255187 CCTCTTGACCCAGACTGCATCTT 0: 1
1: 0
2: 0
3: 9
4: 243
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
933700938_933700945 27 Left 933700938 2:85255165-85255187 CCTCTTGACCCAGACTGCATCTT 0: 1
1: 0
2: 0
3: 9
4: 243
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163
933700938_933700944 20 Left 933700938 2:85255165-85255187 CCTCTTGACCCAGACTGCATCTT 0: 1
1: 0
2: 0
3: 9
4: 243
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700938 Original CRISPR AAGATGCAGTCTGGGTCAAG AGG (reversed) Intronic