ID: 933700939

View in Genome Browser
Species Human (GRCh38)
Location 2:85255171-85255193
Sequence GACCCAGACTGCATCTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700934_933700939 1 Left 933700934 2:85255147-85255169 CCTGGGCCCCACGACACACCTCT 0: 1
1: 0
2: 0
3: 16
4: 265
Right 933700939 2:85255171-85255193 GACCCAGACTGCATCTTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 63
933700935_933700939 -5 Left 933700935 2:85255153-85255175 CCCCACGACACACCTCTTGACCC 0: 1
1: 0
2: 0
3: 6
4: 146
Right 933700939 2:85255171-85255193 GACCCAGACTGCATCTTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 63
933700933_933700939 5 Left 933700933 2:85255143-85255165 CCATCCTGGGCCCCACGACACAC 0: 1
1: 0
2: 1
3: 18
4: 285
Right 933700939 2:85255171-85255193 GACCCAGACTGCATCTTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 63
933700937_933700939 -7 Left 933700937 2:85255155-85255177 CCACGACACACCTCTTGACCCAG 0: 1
1: 0
2: 0
3: 4
4: 124
Right 933700939 2:85255171-85255193 GACCCAGACTGCATCTTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 63
933700936_933700939 -6 Left 933700936 2:85255154-85255176 CCCACGACACACCTCTTGACCCA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 933700939 2:85255171-85255193 GACCCAGACTGCATCTTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700939 Original CRISPR GACCCAGACTGCATCTTAAC AGG Intronic