ID: 933700940

View in Genome Browser
Species Human (GRCh38)
Location 2:85255173-85255195
Sequence ATCCTGTTAAGATGCAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700940_933700945 19 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163
933700940_933700946 25 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700946 2:85255221-85255243 ACTTCCAGGGCCTCTGGTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 209
933700940_933700943 11 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
933700940_933700944 12 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700940 Original CRISPR ATCCTGTTAAGATGCAGTCT GGG (reversed) Intronic