ID: 933700941

View in Genome Browser
Species Human (GRCh38)
Location 2:85255174-85255196
Sequence GATCCTGTTAAGATGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700941_933700948 30 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700948 2:85255227-85255249 AGGGCCTCTGGTTCAGGACCAGG 0: 1
1: 0
2: 0
3: 30
4: 208
933700941_933700946 24 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700946 2:85255221-85255243 ACTTCCAGGGCCTCTGGTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 209
933700941_933700943 10 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
933700941_933700945 18 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163
933700941_933700944 11 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700941 Original CRISPR GATCCTGTTAAGATGCAGTC TGG (reversed) Intronic