ID: 933700942

View in Genome Browser
Species Human (GRCh38)
Location 2:85255196-85255218
Sequence ACAATCGCATGCATTAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700942_933700953 30 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700953 2:85255249-85255271 GGTGCATGAGCATCACCTGGAGG 0: 1
1: 0
2: 23
3: 173
4: 712
933700942_933700952 27 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700952 2:85255246-85255268 CAGGGTGCATGAGCATCACCTGG 0: 1
1: 0
2: 10
3: 86
4: 580
933700942_933700948 8 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700948 2:85255227-85255249 AGGGCCTCTGGTTCAGGACCAGG 0: 1
1: 0
2: 0
3: 30
4: 208
933700942_933700949 9 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700949 2:85255228-85255250 GGGCCTCTGGTTCAGGACCAGGG 0: 1
1: 1
2: 0
3: 17
4: 166
933700942_933700946 2 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700946 2:85255221-85255243 ACTTCCAGGGCCTCTGGTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 209
933700942_933700945 -4 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700942 Original CRISPR ACAATCGCATGCATTAGCTG AGG (reversed) Intronic