ID: 933700943

View in Genome Browser
Species Human (GRCh38)
Location 2:85255207-85255229
Sequence GCATGCGATTGTTCACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700940_933700943 11 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
933700938_933700943 19 Left 933700938 2:85255165-85255187 CCTCTTGACCCAGACTGCATCTT 0: 1
1: 0
2: 0
3: 9
4: 243
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
933700937_933700943 29 Left 933700937 2:85255155-85255177 CCACGACACACCTCTTGACCCAG 0: 1
1: 0
2: 0
3: 4
4: 124
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
933700936_933700943 30 Left 933700936 2:85255154-85255176 CCCACGACACACCTCTTGACCCA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
933700941_933700943 10 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700943 2:85255207-85255229 GCATGCGATTGTTCACTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700943 Original CRISPR GCATGCGATTGTTCACTTCC AGG Intronic