ID: 933700944

View in Genome Browser
Species Human (GRCh38)
Location 2:85255208-85255230
Sequence CATGCGATTGTTCACTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700940_933700944 12 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71
933700941_933700944 11 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71
933700938_933700944 20 Left 933700938 2:85255165-85255187 CCTCTTGACCCAGACTGCATCTT 0: 1
1: 0
2: 0
3: 9
4: 243
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71
933700937_933700944 30 Left 933700937 2:85255155-85255177 CCACGACACACCTCTTGACCCAG 0: 1
1: 0
2: 0
3: 4
4: 124
Right 933700944 2:85255208-85255230 CATGCGATTGTTCACTTCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700944 Original CRISPR CATGCGATTGTTCACTTCCA GGG Intronic