ID: 933700945

View in Genome Browser
Species Human (GRCh38)
Location 2:85255215-85255237
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700938_933700945 27 Left 933700938 2:85255165-85255187 CCTCTTGACCCAGACTGCATCTT 0: 1
1: 0
2: 0
3: 9
4: 243
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163
933700942_933700945 -4 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163
933700941_933700945 18 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163
933700940_933700945 19 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700945 2:85255215-85255237 TTGTTCACTTCCAGGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type