ID: 933700946

View in Genome Browser
Species Human (GRCh38)
Location 2:85255221-85255243
Sequence ACTTCCAGGGCCTCTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700942_933700946 2 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700946 2:85255221-85255243 ACTTCCAGGGCCTCTGGTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 209
933700941_933700946 24 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700946 2:85255221-85255243 ACTTCCAGGGCCTCTGGTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 209
933700940_933700946 25 Left 933700940 2:85255173-85255195 CCCAGACTGCATCTTAACAGGAT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 933700946 2:85255221-85255243 ACTTCCAGGGCCTCTGGTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700946 Original CRISPR ACTTCCAGGGCCTCTGGTTC AGG Intronic