ID: 933700948

View in Genome Browser
Species Human (GRCh38)
Location 2:85255227-85255249
Sequence AGGGCCTCTGGTTCAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700941_933700948 30 Left 933700941 2:85255174-85255196 CCAGACTGCATCTTAACAGGATC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933700948 2:85255227-85255249 AGGGCCTCTGGTTCAGGACCAGG 0: 1
1: 0
2: 0
3: 30
4: 208
933700942_933700948 8 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700948 2:85255227-85255249 AGGGCCTCTGGTTCAGGACCAGG 0: 1
1: 0
2: 0
3: 30
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700948 Original CRISPR AGGGCCTCTGGTTCAGGACC AGG Intronic