ID: 933700949

View in Genome Browser
Species Human (GRCh38)
Location 2:85255228-85255250
Sequence GGGCCTCTGGTTCAGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700942_933700949 9 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700949 2:85255228-85255250 GGGCCTCTGGTTCAGGACCAGGG 0: 1
1: 1
2: 0
3: 17
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700949 Original CRISPR GGGCCTCTGGTTCAGGACCA GGG Intronic