ID: 933700952

View in Genome Browser
Species Human (GRCh38)
Location 2:85255246-85255268
Sequence CAGGGTGCATGAGCATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 10, 3: 86, 4: 580}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933700950_933700952 -8 Left 933700950 2:85255231-85255253 CCTCTGGTTCAGGACCAGGGTGC 0: 1
1: 1
2: 3
3: 7
4: 134
Right 933700952 2:85255246-85255268 CAGGGTGCATGAGCATCACCTGG 0: 1
1: 0
2: 10
3: 86
4: 580
933700947_933700952 -2 Left 933700947 2:85255225-85255247 CCAGGGCCTCTGGTTCAGGACCA 0: 1
1: 1
2: 0
3: 10
4: 215
Right 933700952 2:85255246-85255268 CAGGGTGCATGAGCATCACCTGG 0: 1
1: 0
2: 10
3: 86
4: 580
933700942_933700952 27 Left 933700942 2:85255196-85255218 CCTCAGCTAATGCATGCGATTGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 933700952 2:85255246-85255268 CAGGGTGCATGAGCATCACCTGG 0: 1
1: 0
2: 10
3: 86
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933700952 Original CRISPR CAGGGTGCATGAGCATCACC TGG Intronic