ID: 933703176

View in Genome Browser
Species Human (GRCh38)
Location 2:85270608-85270630
Sequence GTGTCTGCCACAAGCACGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933703170_933703176 15 Left 933703170 2:85270570-85270592 CCACCTTTAGCAAGAAAGAGTGC 0: 1
1: 0
2: 0
3: 14
4: 138
Right 933703176 2:85270608-85270630 GTGTCTGCCACAAGCACGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 105
933703169_933703176 16 Left 933703169 2:85270569-85270591 CCCACCTTTAGCAAGAAAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 126
Right 933703176 2:85270608-85270630 GTGTCTGCCACAAGCACGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 105
933703173_933703176 -7 Left 933703173 2:85270592-85270614 CCATGGTCTACTAGCAGTGTCTG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 933703176 2:85270608-85270630 GTGTCTGCCACAAGCACGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 105
933703171_933703176 12 Left 933703171 2:85270573-85270595 CCTTTAGCAAGAAAGAGTGCCAT 0: 1
1: 0
2: 1
3: 15
4: 135
Right 933703176 2:85270608-85270630 GTGTCTGCCACAAGCACGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933703176 Original CRISPR GTGTCTGCCACAAGCACGGA GGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900342495 1:2195461-2195483 GTGGCTGCCACCCTCACGGAAGG + Intronic
900391018 1:2433947-2433969 GTGTCTGCCTCATGCTCCGAAGG + Intronic
902200281 1:14828059-14828081 ATGTCTGCCACAGGCAGGGGAGG - Intronic
902984978 1:20149644-20149666 GTGACAGCCACCAGCAGGGACGG + Exonic
903642282 1:24868210-24868232 GTGTCTGGGACAAGCCTGGAAGG + Intergenic
904346436 1:29874371-29874393 GTGTCTTCCACAAATAAGGACGG - Intergenic
905911712 1:41659552-41659574 GTGTCTGCCAGATGCTAGGATGG - Intronic
907910900 1:58825163-58825185 GTGCCTGACCCAAGCACCGAGGG - Intergenic
914283936 1:146205230-146205252 GTGTATCCCAGAAGCACGGGAGG + Intronic
914544967 1:148655969-148655991 GTGTATCCCAGAAGCACGGGAGG + Intronic
918963837 1:191314695-191314717 GTGTCTGCCACTGACAAGGAAGG - Intergenic
924427841 1:243970218-243970240 GTGTCTGCCATATGAAAGGAAGG + Intergenic
1067190571 10:44064513-44064535 GTATCTGCCAGGAGCAGGGAGGG - Intergenic
1068926480 10:62544844-62544866 CTGTCTGCCATAAGCATGGGAGG + Intronic
1074388707 10:113038182-113038204 GAGTCTGCCCCAAACACTGAAGG - Intronic
1075171178 10:120116359-120116381 GTGTCTGCAACCAGCACAAAAGG + Intergenic
1075738020 10:124676012-124676034 ATGTCTGTCAAGAGCACGGAAGG + Intronic
1076121912 10:127943387-127943409 GTCTCTGCCACCAGCCTGGAAGG + Intronic
1076469802 10:130710453-130710475 GAGTTTGCCACAGGCAGGGATGG + Intergenic
1081600092 11:44486948-44486970 GTGTCAGCCCCAAGCGAGGATGG - Intergenic
1081668565 11:44930789-44930811 ATGTCTGCCACGGGCAGGGATGG + Exonic
1086399260 11:86447323-86447345 GCATCTGCCACAAGGACTGAAGG + Intronic
1095355405 12:41267265-41267287 ATGTCTGCCACAGGCACAGGAGG - Intronic
1101991128 12:109486092-109486114 GTGTCTCCCACAAGCTCTTAAGG + Intronic
1102162456 12:110780764-110780786 ATGTCTGCCACAATCAGGGAGGG + Intergenic
1102549951 12:113684309-113684331 GTCTCTGACATAAGCACTGACGG - Intergenic
1103866263 12:124054467-124054489 GTATCTGCCACGCTCACGGATGG - Intronic
1108703724 13:52966063-52966085 AGGTCTGCCAGAAGCACTGAGGG - Intergenic
1113228579 13:108186501-108186523 GTGTATGACACAAACCCGGACGG + Intergenic
1114429830 14:22651304-22651326 GTCTCTGCCACCACCACTGAAGG - Intergenic
1121899810 14:97683738-97683760 GTCTATGCCATAAGCAGGGATGG + Intergenic
1122410571 14:101523766-101523788 ATGTCTGCCATGAGTACGGAGGG - Intergenic
1124121056 15:26888881-26888903 GTGACTGCAACAGGCAAGGAGGG + Intronic
1131958479 15:97763521-97763543 TTATCTGCCACAAGAACAGACGG + Intergenic
1132403429 15:101527845-101527867 GTGTCTTCCACAAACCCTGAAGG + Intergenic
1133136166 16:3713640-3713662 GTGACTGCCACAATCACCAAGGG - Intronic
1136144766 16:28310070-28310092 GGCTCTGCCACAAGCTGGGAGGG - Intronic
1140982145 16:80120877-80120899 ATGTCTGCCACAGTCATGGAGGG + Intergenic
1141166724 16:81665779-81665801 ATGTCTGCCATGAGCATGGAAGG - Intronic
1141629260 16:85277813-85277835 GGGTCTGCCACAGGCATGGATGG - Intergenic
1143010957 17:3865945-3865967 GTTTGAGCCCCAAGCACGGAGGG - Exonic
1144254829 17:13457351-13457373 GTGTCAGCCACAGGTACGGTAGG - Intergenic
1144270868 17:13614238-13614260 GTGTCTGCAACAGTCACTGAAGG + Intergenic
1146448356 17:32951585-32951607 GTATCTCCCCCAAGCAGGGATGG - Intergenic
1150603127 17:66667710-66667732 GTGTCTGCCATGAGAACTGATGG + Intronic
1157469685 18:47979620-47979642 GTGTCTGTCACAGCCACAGAGGG + Intergenic
1160131071 18:76225394-76225416 GTGTGGGCCACATGCACAGATGG + Intergenic
1160551579 18:79696815-79696837 GTGTCTGCCTCAAGCACAGGAGG - Intronic
1161133956 19:2608696-2608718 GTGTCTGCCCCATGCAGGGAAGG - Intronic
1161283458 19:3457580-3457602 GTGGCTGCCACAGGCCCGGGAGG + Intronic
1161515143 19:4692349-4692371 GTGTCTGTCAGGAGCACGGGAGG + Intronic
1165212162 19:34244472-34244494 GTGTCTGTCTCTAGCACGGTTGG + Intergenic
1166574066 19:43820387-43820409 ATGTCTGTCACCACCACGGACGG + Intronic
1166802197 19:45465254-45465276 CTGTCTGCCACCAGCCAGGAGGG - Intronic
927171705 2:20375605-20375627 GGGTCTGAGACAAGCAGGGAGGG + Intergenic
927317023 2:21695735-21695757 CTGTCTGCCACAAGCATGCTTGG - Intergenic
929235941 2:39605665-39605687 GTATCTGCCATGAGCATGGAAGG + Intergenic
930368892 2:50479268-50479290 TTGTATACCACAAGCAAGGATGG - Intronic
933703176 2:85270608-85270630 GTGTCTGCCACAAGCACGGAGGG + Intronic
934966049 2:98723449-98723471 GTGTCAGCCCCAAGCAAGGATGG - Intronic
935594214 2:104867197-104867219 TTATCTGCCCCAGGCACGGAGGG + Intergenic
941253333 2:163195628-163195650 CTGTCTGTCACAAACACAGATGG - Intergenic
945973329 2:216251682-216251704 GTGTCTCCCACTAGCCCTGATGG + Intergenic
946660857 2:221997922-221997944 GTGTGGGCTACAAGCATGGATGG + Intergenic
948505269 2:238423795-238423817 GTGTCTGCCCCAAGCTAGGGAGG - Intergenic
1169292358 20:4363708-4363730 ATGTCTGCCACAGGCAAGGGAGG + Intergenic
1172664884 20:36592204-36592226 TTGTCTGCCGCAGGCACAGAAGG + Exonic
1174068374 20:47882441-47882463 GTGTCTACCAGAAGCTGGGAAGG + Intergenic
1174436114 20:50508296-50508318 GTGCCTGCCACAAGCACTCAAGG + Intergenic
1176376292 21:6088372-6088394 GTCTCTGCCACGTGCAGGGATGG - Intergenic
1177433520 21:21020910-21020932 GTCTTTGCAACAAGCATGGACGG - Intronic
1179747183 21:43449872-43449894 GTCTCTGCCACGTGCAGGGATGG + Intergenic
1179955272 21:44734940-44734962 GTGCCTGGGACAGGCACGGAGGG - Intergenic
1180900584 22:19369179-19369201 GTGTCAGGCAGAAGCACGTAGGG - Intronic
1181257460 22:21573033-21573055 GTGTCTACCACAAACAGGGATGG - Intronic
1182024416 22:27106813-27106835 GTTTCTGCCACAAGCAAAGTGGG + Intergenic
1182796533 22:32995115-32995137 CTGTCCGCCACCAGCAGGGAGGG - Intronic
1184227475 22:43137410-43137432 GTGTCTGCCACCAGCCAGCAGGG + Intronic
1184236102 22:43183811-43183833 CTGTCTGCCACAAGCCGGCAAGG + Intronic
949732431 3:7129361-7129383 TTATCTGCCACAATCATGGACGG - Intronic
953726085 3:45400403-45400425 TTGTCTGCCACACGCAGGGTTGG + Intronic
954639391 3:52089031-52089053 CTTTCTGCCACAACCACAGACGG + Intronic
954878241 3:53817378-53817400 GTGCCTGCCAGACCCACGGAGGG - Exonic
961329979 3:126132625-126132647 GTGTCTGAAACAAGTACAGAAGG - Intronic
962154023 3:132925078-132925100 GTATGTCCCACAAGCACAGAAGG + Intergenic
962315952 3:134359627-134359649 GTCCCTGCTACAAGCACAGAAGG - Intronic
963042218 3:141078229-141078251 GTGTCTTCCACATGCCCTGAAGG - Intronic
968235703 3:197029200-197029222 GTTTCTGGCACATGCAGGGATGG - Intronic
968872136 4:3247543-3247565 GTGCCAGCCCCCAGCACGGAGGG + Exonic
972187952 4:36554839-36554861 GTGTATGCCACAAGAACAGTAGG + Intergenic
979937540 4:126716515-126716537 GAGTCTGCAACAACCACAGAGGG + Intergenic
982290339 4:153774594-153774616 GTGTCTGCCATAGGCATGGGAGG - Intergenic
988465204 5:31483803-31483825 GTAACTGCCACAAGCACCCAAGG + Intronic
997700808 5:135897809-135897831 GTGTCTGCAAAGAGCAGGGATGG - Intergenic
1005856831 6:29869145-29869167 GTGTCTGCCACCAACCCGGGTGG - Intergenic
1006731609 6:36240239-36240261 GTGTGTGCCACAGGCACGAGTGG - Intergenic
1009788388 6:68367529-68367551 GTGTCTTCCACATGCACTGCTGG + Intergenic
1009905020 6:69859565-69859587 GTGTCTGCCACCAGCTGGCAGGG - Intergenic
1014270591 6:119331728-119331750 TTGTCTGCCACAAGCTGGGGTGG + Intronic
1017206527 6:151808605-151808627 GGGTCTGCCTCTCGCACGGACGG - Intronic
1018475403 6:164135348-164135370 GTGTTTGCAAGAAGCACCGATGG + Intergenic
1019078216 6:169408779-169408801 GCGTCTGCCACAGGCGAGGAAGG - Intergenic
1029612961 7:101637103-101637125 GGGTCTGCCAGAAGCAGGGAGGG + Intergenic
1029882707 7:103833501-103833523 GTGTCTGCCATACGTACAGAAGG - Intronic
1030759956 7:113338158-113338180 TTGTCTGCCAGAAGCTCAGAAGG - Intergenic
1035567894 8:653851-653873 GTGGCTGCCACATGCGCGCAGGG + Intronic
1048228698 8:132615933-132615955 GTGCCTGCCACAAGCAGAAATGG - Intronic
1055914884 9:81390937-81390959 GACTCTTCCACAAGCAAGGAGGG - Intergenic
1062141766 9:134963086-134963108 GTCTCAGCCACAGGCACAGATGG + Intergenic
1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG + Intronic
1186517473 X:10176657-10176679 GAGTCTCCAACAAGCAAGGAAGG - Intronic
1189049248 X:37627108-37627130 GTGTATGCCCCAAGAAAGGATGG - Intronic
1192176026 X:68886058-68886080 GTGACTGCTCCAAGCACAGAGGG + Intergenic