ID: 933704669

View in Genome Browser
Species Human (GRCh38)
Location 2:85280846-85280868
Sequence CCGAGCAAAGAGAAGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933704665_933704669 11 Left 933704665 2:85280812-85280834 CCGTGCAAGACAGAGAAGGAGAG 0: 1
1: 2
2: 3
3: 46
4: 524
Right 933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 200
933704663_933704669 13 Left 933704663 2:85280810-85280832 CCCCGTGCAAGACAGAGAAGGAG 0: 1
1: 0
2: 4
3: 24
4: 218
Right 933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 200
933704661_933704669 17 Left 933704661 2:85280806-85280828 CCAGCCCCGTGCAAGACAGAGAA 0: 1
1: 0
2: 0
3: 19
4: 160
Right 933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 200
933704664_933704669 12 Left 933704664 2:85280811-85280833 CCCGTGCAAGACAGAGAAGGAGA 0: 1
1: 1
2: 8
3: 45
4: 491
Right 933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933704669 Original CRISPR CCGAGCAAAGAGAAGGCTGC GGG Intronic
900873707 1:5326050-5326072 AAGAGCAAAGAGACAGCTGCAGG + Intergenic
900991834 1:6101677-6101699 CCCAGGCAAGAGAAGGCTTCCGG + Intergenic
901508074 1:9699219-9699241 CCAAAAAAAGAGTAGGCTGCTGG + Intronic
902137918 1:14326674-14326696 CCAAGCACAGGGAAGGATGCAGG - Intergenic
902384163 1:16067026-16067048 CCGGGCACAGAGGAGGCTGGTGG + Intronic
902754761 1:18541578-18541600 CCAAGCAATGACAAGGCTGCCGG - Intergenic
903333918 1:22612584-22612606 GGGAGCTGAGAGAAGGCTGCGGG - Intergenic
904496289 1:30888663-30888685 CCCAGCAAACAGGAGGGTGCGGG - Intronic
905232521 1:36523126-36523148 CCGAGCACAGAGAGAGATGCAGG - Intergenic
906155433 1:43611472-43611494 CTGAGCCAAGAGAAGACTGGAGG + Intronic
907634731 1:56122630-56122652 CTGAGCAAAAAGAAAGCTGGAGG - Intergenic
910226144 1:84938630-84938652 CAGAGCAAAGACAGGCCTGCAGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913665979 1:121049225-121049247 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914017377 1:143832501-143832523 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914655988 1:149741033-149741055 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914750494 1:150531839-150531861 CTGAGGAAAGTGAAGGCTTCAGG - Intergenic
914916639 1:151823099-151823121 ACGGGGAAAGAGAAGGGTGCTGG + Intronic
917032307 1:170706961-170706983 CCTAGCAAAAAAAAGACTGCTGG + Intronic
920551564 1:206865872-206865894 CGCAGCAGAGAGAAGGCTGAAGG - Exonic
921051211 1:211513074-211513096 CTGAGGAAAGAGGAGGCTGTTGG + Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923471320 1:234293371-234293393 CCCAGCATAGAGAAAGCTCCTGG - Intronic
924110319 1:240692373-240692395 CTGGGTAAAGAGGAGGCTGCCGG - Intergenic
1063386264 10:5618032-5618054 CCTAGCAAAGAGAAGGCCCTGGG + Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1065328068 10:24568172-24568194 CCAGGCCAAGAGAAGGCTGCAGG - Intergenic
1065800668 10:29348958-29348980 GCGAGGAAAGTGAAGGCTGCTGG - Intergenic
1067031087 10:42879191-42879213 CTGGGCATAGAGCAGGCTGCAGG + Intergenic
1067156075 10:43782342-43782364 CAGGGCAAAGTGAAGGCTGGTGG - Intergenic
1069374499 10:67780312-67780334 CCTAGTAAAGAGATGGCTGGGGG + Intergenic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1075394362 10:122115919-122115941 AGGAGCATAGAGATGGCTGCAGG + Intronic
1075734520 10:124655662-124655684 CCCAGCAGAGAACAGGCTGCTGG - Intronic
1075892104 10:125960940-125960962 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1076451647 10:130560766-130560788 CTGAGCACAGAGGAGGCTGATGG - Intergenic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1078024586 11:7682668-7682690 AGGAGCAAAGAGAAAACTGCTGG - Intergenic
1078564584 11:12403425-12403447 CTGGGCACAGAGAAGGCTGGGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1080353599 11:31414785-31414807 CCAATCAAAAAGAAGGGTGCAGG - Intronic
1080908825 11:36574696-36574718 CCAAGCAAACAGCTGGCTGCAGG - Exonic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081760975 11:45576328-45576350 ACAAGCAAAGAGAAGGAGGCTGG + Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1084712768 11:70854328-70854350 TCCAGCAGAGAGAAGGCTGCTGG + Intronic
1085814528 11:79723133-79723155 CTGAGCAAAAAGAATGCTGGAGG + Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089620723 11:119720734-119720756 ACAGGCAGAGAGAAGGCTGCCGG + Intronic
1091681627 12:2531695-2531717 CCGAGGAAAGAGTCAGCTGCTGG - Intronic
1091783695 12:3229819-3229841 CCTGCCAGAGAGAAGGCTGCTGG - Intronic
1093728794 12:22544584-22544606 CCGAGGAAAGATAAGGGGGCGGG + Intergenic
1096393451 12:51247755-51247777 CCTAGCAAAGAGGAGGCAGTGGG - Intronic
1097016439 12:55990693-55990715 CCGAGCAAAGACATGGGTGAAGG + Exonic
1097058916 12:56267805-56267827 CCGAGGCAAGAGGAGGCTGCAGG - Exonic
1097243528 12:57592150-57592172 TTGACCAAAGAGAAGGCTGAGGG + Intronic
1098123968 12:67270236-67270258 GCGGGCAGAGAGGAGGCTGCCGG - Intronic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101534188 12:105602326-105602348 CCCAGGAAAGAGAAGCTTGCTGG - Intergenic
1101802172 12:108032013-108032035 CCGAGAAAAGAGAAGGACCCAGG + Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1108245872 13:48513144-48513166 AAGAGCAGAGAAAAGGCTGCTGG + Intronic
1110124715 13:71928350-71928372 CCCAGCAAAGATGAGGCTGCAGG - Intergenic
1110950246 13:81478494-81478516 GTGAACAAAGAGAAAGCTGCTGG + Intergenic
1111656814 13:91164346-91164368 CAGAGCTAAGAGAACCCTGCAGG - Intergenic
1113933031 13:113978395-113978417 CCCACTAAAGGGAAGGCTGCCGG - Exonic
1114387098 14:22266869-22266891 CCTAGAAAAGAGCAGGATGCTGG - Intergenic
1114549942 14:23526846-23526868 CCGAGCAGAGACCAGGCAGCAGG - Exonic
1115641651 14:35339106-35339128 CCTAGGAGACAGAAGGCTGCGGG + Intergenic
1118108088 14:62683415-62683437 ACGAGGAAAGAGAAGTGTGCCGG - Intergenic
1118600314 14:67467433-67467455 CAGGGCAAAAAGAAGGCTGTGGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120369103 14:83608770-83608792 CCAAGCAAAGAGAAGGATATAGG - Intergenic
1120814999 14:88846953-88846975 ACGAGCAAGGAGGAGGCTGATGG - Intronic
1122407235 14:101507877-101507899 CCTAGCAGAGAGATGGCTGTAGG + Intergenic
1122848744 14:104515264-104515286 CCGTGCAGAGACAAGGCTGCCGG + Intronic
1122854969 14:104555712-104555734 CAGAACAAAGAGGAGGCTGGAGG + Intronic
1122918812 14:104871215-104871237 CCGAGGACAGAGCAGGCTCCAGG - Intronic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1124345373 15:28918520-28918542 GCGACCAAAGGGAAGGCTGGTGG - Intronic
1125109888 15:36020054-36020076 CTGAGCCAAGACAAGACTGCAGG - Intergenic
1125112556 15:36050379-36050401 TCTATCAAAGAGAAGTCTGCAGG - Intergenic
1125513787 15:40306938-40306960 CACAGCAGAGAGAGGGCTGCAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126431708 15:48592587-48592609 CCAAGCAAAGAGAAGGCAAAGGG + Intronic
1128668860 15:69559269-69559291 CAGCGCAAAGAGAAGGCTGTGGG - Intergenic
1134176116 16:12007815-12007837 AAGAGCAAAGACAAGGCAGCTGG - Intronic
1142829286 17:2535677-2535699 CCATGCAAAGTGAAGGCTGCTGG + Intergenic
1143268153 17:5656130-5656152 CCAACCAAAGAGGAGGGTGCGGG - Intergenic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1148125211 17:45233194-45233216 CCGAGAACAGGGAAGGCTGGTGG - Intronic
1151353103 17:73543149-73543171 CCCAGTAAATGGAAGGCTGCCGG - Intronic
1151549330 17:74812903-74812925 TGGAGTGAAGAGAAGGCTGCTGG + Intronic
1152278161 17:79370011-79370033 CCCACCAAAGAGAAGGCTCTTGG + Intronic
1152495569 17:80669027-80669049 CCGAGCAAAGCCCTGGCTGCAGG - Intronic
1152706578 17:81846679-81846701 CCGAGCAAAGTCAGGGCTGGAGG - Intronic
1154303836 18:13217301-13217323 CCGAGCGCAGAGTACGCTGCAGG - Intergenic
1157905296 18:51564174-51564196 CTGGGCAAGGAGGAGGCTGCAGG + Intergenic
1158219378 18:55134528-55134550 ACTAGGAAATAGAAGGCTGCAGG - Intergenic
1158735982 18:60080054-60080076 CTGAGCAAAGAGAACGAAGCTGG + Intergenic
1159075779 18:63680257-63680279 CCCAGCAAAGAGGAGACTGAAGG + Intronic
1160246706 18:77165424-77165446 CCAGGCACAGTGAAGGCTGCAGG - Intergenic
1161159726 19:2755157-2755179 CCGGGCACAGGGAAGGCAGCTGG - Exonic
1162802390 19:13118561-13118583 CCGGGCACAGTGCAGGCTGCGGG - Intronic
1164734510 19:30530987-30531009 CCAAGCACAGTGAAGGCTGGGGG - Intronic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1166301233 19:41913155-41913177 CCGAGTGAGGAGGAGGCTGCGGG - Intronic
1166778375 19:45326231-45326253 CCGAACATAGAAAAGGCTTCTGG - Intergenic
1168353525 19:55689196-55689218 CCGAAGAAAGAGAGGGCTGGGGG - Intronic
925283476 2:2701187-2701209 CCGAGGACAGTGAAGGCTGGTGG - Intergenic
925305651 2:2846532-2846554 CTGAGCCAAGATAAAGCTGCAGG + Intergenic
925664736 2:6240640-6240662 CGGAGCACAGAGAAGGCAACGGG + Intergenic
926053373 2:9758671-9758693 AAGAGCAAAGAGAAGGTTGTAGG + Intergenic
926112008 2:10189508-10189530 CCCAGCAAGGGGCAGGCTGCTGG - Intronic
926760128 2:16271113-16271135 CCAGGCAAAGAGAAGACTGTGGG + Intergenic
927018968 2:18997869-18997891 CCAGGCAAAGAGAAGGCTTAGGG - Intergenic
928877235 2:36054210-36054232 CCGAGGAATGGCAAGGCTGCTGG + Intergenic
929441812 2:41970947-41970969 CCCAGCAAGGAGAAGGATGGTGG - Intergenic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932895533 2:75636159-75636181 CCTTGGAAAGAGATGGCTGCAGG - Intergenic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
933865338 2:86510831-86510853 ACTAGGAAAGAGAAGGCTTCAGG + Intronic
934937241 2:98474278-98474300 CCAAGCACTGGGAAGGCTGCGGG - Intronic
939572756 2:143860339-143860361 CTGAGCACAGTGAAAGCTGCAGG + Intergenic
940865634 2:158815158-158815180 CCCAGTGAAGAGAAGGCTGAGGG - Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944243854 2:197512070-197512092 CCGAGCAAAGTTGAGGCAGCAGG - Intronic
945849687 2:214990984-214991006 CCAGGCAAAGAAATGGCTGCAGG + Exonic
947094867 2:226554779-226554801 AAGAGCAAAGGGAAGGCTTCAGG + Intergenic
1169068783 20:2709292-2709314 CCCAGGAAAGGGCAGGCTGCAGG - Intronic
1169978351 20:11355713-11355735 CCCAGCAAAGAGAAGGGCTCTGG - Intergenic
1172762388 20:37331839-37331861 TCCAGGAATGAGAAGGCTGCAGG + Intergenic
1172772761 20:37391252-37391274 CAGATGAAAGAGGAGGCTGCAGG - Intronic
1172782018 20:37442418-37442440 CCCAGAAAAGAGAGAGCTGCAGG - Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174402693 20:50284374-50284396 CCAAGCAAAGGGAAGGGCGCAGG - Intergenic
1175227294 20:57451971-57451993 CCCCGCAAAGACAAGGCTCCTGG - Intergenic
1175495488 20:59411382-59411404 CCGAGCAAAAATAAGGGTCCCGG + Intergenic
1180132199 21:45834023-45834045 CCAAGCACAGGGAAGGCTGGGGG + Intronic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1184155069 22:42662157-42662179 CCGAGCCAGGAAAAGGCTCCCGG + Intergenic
1185182311 22:49370369-49370391 CAGAGCAGAGACAGGGCTGCAGG + Intergenic
949166311 3:945700-945722 CAGAGCAAAGACAAGAATGCTGG + Intergenic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
953100760 3:39824293-39824315 CAGAGCAAAGAGAACAATGCTGG - Intronic
953465869 3:43118998-43119020 TCCATCAAAGAGAAGGCTGTAGG + Intergenic
953770678 3:45776863-45776885 GTGAGAAAAGAGAAGGCTCCAGG + Intronic
953820472 3:46203747-46203769 GTGAGGAAAGTGAAGGCTGCAGG + Exonic
954658750 3:52215032-52215054 TGCAGCAAAGAGATGGCTGCAGG - Intergenic
958561912 3:95758782-95758804 ACGAGCCAAGCGAAGCCTGCAGG - Intergenic
959565316 3:107826997-107827019 AGGAGCAAAGAGAAGCCTTCGGG - Intergenic
961093843 3:124138152-124138174 AGGGGCAAAGAGAAAGCTGCAGG - Intronic
965174033 3:165307583-165307605 CTGAGCAAAAAGAAGACAGCTGG + Intergenic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
968571635 4:1345322-1345344 CCAAGCGAACAGAAGGATGCAGG + Intergenic
976391796 4:84513283-84513305 CTGATCAGAGAGAAAGCTGCGGG + Intergenic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
984852967 4:184169480-184169502 CCAGGCAGAGAGAGGGCTGCTGG - Intronic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
985848856 5:2373947-2373969 CCCAGCAAAGAGAAAACTTCTGG + Intergenic
986171803 5:5320451-5320473 CTGAGTGAAGAGGAGGCTGCAGG + Intergenic
993168244 5:84384095-84384117 CCGAGCGGGGAGAAGGGTGCGGG - Intronic
994881728 5:105506559-105506581 GCCACCAAAGAAAAGGCTGCTGG - Intergenic
995600457 5:113790168-113790190 CCAAGCAAAGAGAATGGGGCTGG + Intergenic
998038720 5:138937488-138937510 GCGAGCATAAAGGAGGCTGCAGG - Intergenic
998043952 5:138971495-138971517 CCCTGCAAAGAGTTGGCTGCTGG - Intronic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
1000001470 5:157142740-157142762 CCCAGCACAGAGGAAGCTGCGGG + Intronic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001632798 5:173188791-173188813 CCCAGGAAAGTGAAGGCTGCAGG - Intergenic
1001697859 5:173685737-173685759 CCGAGCAACAAGAAGCCTGGGGG - Intergenic
1007260279 6:40558545-40558567 AAGAGCAGAGAGAAGGCTGGAGG + Intronic
1008045739 6:46849588-46849610 CAGAGCCAAGTGAAGGATGCCGG - Intergenic
1010993862 6:82511091-82511113 TGCAGCAAAGAGAAGGCAGCAGG + Intergenic
1014328466 6:120029041-120029063 CAGAGCAACAAGAAGGCTTCTGG + Intergenic
1017464485 6:154681769-154681791 GGGAGCATAGAGAAGGCTTCTGG - Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1019135227 6:169903676-169903698 CCCCGCAAAGAGAAGGGTTCAGG - Intergenic
1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG + Intergenic
1023045213 7:36204634-36204656 CCCAGCAGAGTGAAGCCTGCAGG + Intronic
1026457853 7:70588521-70588543 TCCAGCAAAGAGAAAGCAGCAGG + Intronic
1027505460 7:79012366-79012388 CAGAGCAGAGAGAAGACTTCCGG - Intronic
1027753968 7:82186475-82186497 CAGAGCAAAGTTAAGGTTGCAGG + Intronic
1028470118 7:91196826-91196848 GTGAGAAGAGAGAAGGCTGCTGG + Intronic
1028583691 7:92432650-92432672 TAGAGCCAAGAGAGGGCTGCAGG - Intergenic
1029571674 7:101373918-101373940 TCGAGCCAAGAGAAGCCTGGAGG - Intronic
1032501110 7:132400629-132400651 CCCAGGAAAGAGAAGCCTCCAGG + Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1034263623 7:149771745-149771767 CGGGGCAGAGGGAAGGCTGCCGG - Intronic
1034395773 7:150824083-150824105 AAGAACAAAGAGAAGGCTGGAGG - Intergenic
1035073013 7:156158592-156158614 GCGAGAAGACAGAAGGCTGCAGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035283275 7:157790833-157790855 CCGAGCAGAGAAAATGCTCCTGG - Intronic
1036121825 8:6026147-6026169 TCTAGCAACGAGAATGCTGCTGG - Intergenic
1039810561 8:41044293-41044315 CCAACCAAAGAGAAGTCTCCTGG - Intergenic
1043347672 8:79318728-79318750 CAGATCAAAGAGAATTCTGCTGG + Intergenic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1048377428 8:133834781-133834803 AAGGTCAAAGAGAAGGCTGCAGG + Intergenic
1052625538 9:30972231-30972253 CGAAGCATAGAGAAGGCTGTAGG + Intergenic
1053651834 9:40177120-40177142 CAGAGCCAAGTGAAGGATGCCGG + Intergenic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1056400033 9:86217925-86217947 AAGAACAAAGAGAAGGTTGCAGG - Intergenic
1059192728 9:112342193-112342215 CTGAGAAACTAGAAGGCTGCTGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062142283 9:134966206-134966228 CACAGTAAAGAGAAGCCTGCAGG - Intergenic
1189722540 X:43934763-43934785 AAAAGAAAAGAGAAGGCTGCAGG - Intergenic
1189848853 X:45159506-45159528 CCCAGTAAAGATAAGGGTGCAGG - Intronic
1197261021 X:124318184-124318206 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199785329 X:151100132-151100154 CCATGCACAGAGAAGGCAGCTGG + Intergenic