ID: 933708236

View in Genome Browser
Species Human (GRCh38)
Location 2:85307106-85307128
Sequence TGCCCTCGATTTCATAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933708235_933708236 -7 Left 933708235 2:85307090-85307112 CCTTTGAACTGGACTCTGCCCTC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 933708236 2:85307106-85307128 TGCCCTCGATTTCATAACACAGG 0: 1
1: 0
2: 0
3: 3
4: 69
933708232_933708236 23 Left 933708232 2:85307060-85307082 CCTGAGGACGGACTTCAGTTGAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 933708236 2:85307106-85307128 TGCCCTCGATTTCATAACACAGG 0: 1
1: 0
2: 0
3: 3
4: 69
933708234_933708236 -6 Left 933708234 2:85307089-85307111 CCCTTTGAACTGGACTCTGCCCT 0: 1
1: 0
2: 4
3: 18
4: 198
Right 933708236 2:85307106-85307128 TGCCCTCGATTTCATAACACAGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933708236 Original CRISPR TGCCCTCGATTTCATAACAC AGG Intronic
910922302 1:92361457-92361479 TGGCATAGATTTGATAACACTGG + Intronic
911428650 1:97755275-97755297 TGCCCTGGATTTTATACCCCAGG - Intronic
911456277 1:98128172-98128194 TGCCCTTGTTTTCAGAACAGAGG - Intergenic
921084608 1:211777297-211777319 TGCTCTCCATTTCTGAACACAGG + Intronic
1062835098 10:630103-630125 TACCTTTGATTTCCTAACACAGG - Intronic
1063292573 10:4764638-4764660 CGCCCTCAATTTCATACCAGTGG + Intergenic
1075015080 10:118904482-118904504 TGCGCTGGAATTCAAAACACAGG - Intergenic
1086061629 11:82706016-82706038 TGCCCTGGATTTTATACCCCAGG + Intergenic
1087826898 11:102775454-102775476 TGCCATCGATTTCATTACCCTGG - Intronic
1090719131 11:129456512-129456534 TGCCCTCGGTTTGCTTACACAGG + Intergenic
1092126142 12:6076214-6076236 TGCCCTCAACCTGATAACACAGG + Intronic
1092493589 12:8969415-8969437 TGCCCTCAAATCCATGACACTGG - Intronic
1106456766 13:29934661-29934683 TGCCCTCTCTTTTATGACACAGG - Intergenic
1107709404 13:43137052-43137074 TGCCCTGGAGTTCACAGCACTGG - Intergenic
1110151262 13:72257376-72257398 TTTCCTAGATTTCCTAACACTGG + Intergenic
1113771701 13:112913808-112913830 TGCACTCCATTTCATACAACAGG + Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125151511 15:36537721-36537743 TGCCCTAGATTCCAGACCACTGG - Intergenic
1135853583 16:25986438-25986460 TGCCCTCAATATCACAAAACAGG + Intronic
1139250599 16:65491684-65491706 AGCTCTCAATTTCATCACACAGG + Intergenic
1143924364 17:10356823-10356845 AGCCCTCTATTTCATTTCACTGG - Intronic
1145291490 17:21550105-21550127 TGCCATCTATTTCATCATACAGG + Intronic
1145388591 17:22436929-22436951 TGCCATCTATTTCATCATACAGG - Intergenic
1155570077 18:27184207-27184229 TGCCATCGCTTTCAAAACGCTGG + Intronic
1156413172 18:36856321-36856343 TACCCTCGATGTCATTCCACAGG + Intronic
1158081369 18:53594783-53594805 TGCCCTTCATTTCATTACATAGG + Intergenic
928536925 2:32250021-32250043 TGCCCTGGACTTCATTAAACTGG - Exonic
932456485 2:71852774-71852796 TGCCCTTGACCTCAAAACACCGG - Intergenic
933569203 2:83989179-83989201 TGTCTTCCAATTCATAACACAGG + Intergenic
933708236 2:85307106-85307128 TGCCCTCGATTTCATAACACAGG + Intronic
939235778 2:139490385-139490407 TCCCCCCCATTTCATAACTCTGG - Intergenic
942865570 2:180670363-180670385 TGCCCAAGATTACATAATACTGG + Intergenic
942937665 2:181577448-181577470 TGCCATACATTTCATACCACTGG - Intronic
944274595 2:197821590-197821612 TGCCTTCTATTTCATAAGAAGGG + Intronic
1170511665 20:17083908-17083930 TGCCCACCATTTCAGAACCCAGG + Intergenic
1175249044 20:57597935-57597957 TGGCCTCGATGTCATCACAGGGG + Intergenic
1182151658 22:28031416-28031438 TGCCCTCCACTTCTTCACACCGG - Intronic
1183639372 22:39083806-39083828 TGCGCTCCACCTCATAACACAGG - Exonic
953935191 3:47035509-47035531 TGACCTGGATTTCCTAACACAGG + Intronic
954720394 3:52556985-52557007 TGCCCTTGACTTCAAAACCCAGG - Intronic
962154387 3:132930116-132930138 TGGGCTCCATTTCATTACACAGG - Intergenic
967185681 3:186942557-186942579 TGCCCTCGATTCCAGCACAGAGG - Intronic
969715426 4:8866002-8866024 TGCCCACGCTGTCATGACACAGG + Intronic
973739805 4:53908893-53908915 TGTCCAGCATTTCATAACACAGG + Intronic
978283387 4:107044478-107044500 TCTCCTCTATTTAATAACACTGG - Intronic
983151668 4:164290467-164290489 TGCCCTCCATTTCACAACTTTGG + Intronic
987198101 5:15547660-15547682 TGCCCTTGATTTTATACCCCAGG + Intronic
987376450 5:17239726-17239748 TGCCCTTCATTTGAAAACACAGG + Intronic
988329949 5:29823713-29823735 GGTCCTAGATTTCACAACACGGG - Intergenic
990949607 5:61285682-61285704 TGGTCTTGATTTCATAACAGTGG - Intergenic
992583229 5:78203726-78203748 TGCACTTGATGTCATCACACAGG + Intronic
1001711156 5:173779253-173779275 TGCTCTGGATTTCATGACTCTGG + Intergenic
1003671064 6:8160575-8160597 TGCCCTGAATTTCAAAAGACAGG + Intergenic
1010897475 6:81382263-81382285 TGCCCTCTTTCTCATAACATAGG - Intergenic
1015270962 6:131338661-131338683 TGCCCTGGATTTAGTAACAGGGG - Intergenic
1018766443 6:166936991-166937013 TGCCCTCTGTTTCAAAACAGGGG - Intronic
1028737636 7:94235409-94235431 TGCCCTCTATTTCATCAAAGGGG + Intergenic
1036780646 8:11644636-11644658 TGCCCTGGATTTCAGAGCAGCGG - Intergenic
1039116905 8:34101313-34101335 TGCCCTGGGTTTCTTCACACTGG - Intergenic
1039462261 8:37755161-37755183 AGCCCTGGATTTAAAAACACAGG - Exonic
1040623321 8:49115031-49115053 TGCCCTGGATTTGATACCCCAGG - Intergenic
1042676161 8:71324777-71324799 TCCCCTCTATTTCATGACTCAGG + Intronic
1043379222 8:79684851-79684873 AGTCCTCTATTTCTTAACACAGG - Intergenic
1047766982 8:127998040-127998062 TACCCTTGATTTCATAAAAGCGG - Intergenic
1048036373 8:130681205-130681227 TGATCTCCATTTCATAACAGAGG - Intergenic
1049338630 8:142100108-142100130 TGCCCTCGAAATCATCACGCAGG - Intergenic
1051698848 9:19797383-19797405 TGGCCTGGTTTTCATATCACAGG + Intergenic
1052498452 9:29258460-29258482 TGCCCTTGAGTTCACAACTCTGG - Intergenic
1187291301 X:17956034-17956056 AGCACTCGATTTTATGACACTGG + Intergenic
1187329858 X:18327813-18327835 TGCCCACGTGTTCATAACATAGG + Intronic
1190414804 X:50170443-50170465 TGCCCTCAAACCCATAACACTGG + Intergenic
1193603756 X:83540941-83540963 TGCCCACCAGTTCATAAAACAGG + Intergenic
1197129019 X:122982280-122982302 TGCCCTAGAGTTCATAAAACTGG + Intergenic