ID: 933714607

View in Genome Browser
Species Human (GRCh38)
Location 2:85350866-85350888
Sequence TGTACATGGGGTACTCCTTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933714602_933714607 1 Left 933714602 2:85350842-85350864 CCTGAATGTAGGCTTTCTCTCCA 0: 1
1: 0
2: 0
3: 15
4: 165
Right 933714607 2:85350866-85350888 TGTACATGGGGTACTCCTTTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
933714597_933714607 25 Left 933714597 2:85350818-85350840 CCTGTGGAAACTTCTCCTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 933714607 2:85350866-85350888 TGTACATGGGGTACTCCTTTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
933714601_933714607 2 Left 933714601 2:85350841-85350863 CCCTGAATGTAGGCTTTCTCTCC 0: 1
1: 0
2: 2
3: 22
4: 275
Right 933714607 2:85350866-85350888 TGTACATGGGGTACTCCTTTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
933714600_933714607 10 Left 933714600 2:85350833-85350855 CCTTGAGGCCCTGAATGTAGGCT 0: 1
1: 0
2: 2
3: 21
4: 241
Right 933714607 2:85350866-85350888 TGTACATGGGGTACTCCTTTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
933714596_933714607 28 Left 933714596 2:85350815-85350837 CCTCCTGTGGAAACTTCTCCTTG 0: 1
1: 0
2: 3
3: 12
4: 194
Right 933714607 2:85350866-85350888 TGTACATGGGGTACTCCTTTCGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933714607 Original CRISPR TGTACATGGGGTACTCCTTT CGG Exonic
903390428 1:22959943-22959965 TGTACATGGTGTACTCATTGGGG + Exonic
912412369 1:109487835-109487857 TGTAGAGTGGGGACTCCTTTGGG + Intronic
919488811 1:198178540-198178562 TCTGCATCGGGTACTCTTTTGGG + Intronic
922993567 1:229938278-229938300 GGGACATGGGGTACTTCTTGGGG - Intergenic
1063189300 10:3678774-3678796 TGTATATGGGGTGCCCATTTGGG - Intergenic
1070168905 10:73917788-73917810 TGTACATGGTGGTCTTCTTTAGG + Intronic
1079100396 11:17538128-17538150 TGTAGATGGTGGGCTCCTTTAGG - Intronic
1079504396 11:21137259-21137281 TCTACATGGGGTTCTCCTCCAGG - Intronic
1080931328 11:36814447-36814469 TATACACGAGGTACTCTTTTAGG - Intergenic
1088653602 11:111978355-111978377 TGTCCATGAGGTACTTCTTTAGG + Intronic
1090566047 11:127993270-127993292 GGAAAATGGGATACTCCTTTTGG + Intergenic
1095056157 12:37603921-37603943 TGTATATTGGGAACTCCTTCAGG + Intergenic
1097407024 12:59201528-59201550 TGTACATGTGGTAAGGCTTTGGG - Intergenic
1100191690 12:92199778-92199800 TGTATATAGGCTTCTCCTTTGGG + Intergenic
1101044137 12:100787190-100787212 TGGAGATGGGTTACTCCATTGGG + Intronic
1105288916 13:19033441-19033463 TGTAGATGGGGTAATACTTCTGG - Intergenic
1105716199 13:23067692-23067714 AGAACATGGGCTACTGCTTTGGG - Intergenic
1106017126 13:25880091-25880113 TGTCCATGGGGTACTGTTTTGGG + Intronic
1108735604 13:53280646-53280668 TTGAAATGGGGTACTCCCTTTGG + Intergenic
1113077198 13:106478657-106478679 TGTACAATGTGTACTCCTCTTGG + Intergenic
1125028342 15:35052707-35052729 TGTACATTGGCGACTTCTTTGGG + Intergenic
1125225686 15:37393187-37393209 TGTCCATTGGGAACTCCTTCAGG + Intergenic
1129883904 15:79025604-79025626 TGCCCCTGGGATACTCCTTTAGG + Intronic
1131376242 15:91926223-91926245 TGGAGAGGGGATACTCCTTTTGG - Intronic
1132379775 15:101358415-101358437 TGAACTTGGGGCACTCCTCTGGG + Intronic
1151004483 17:70418119-70418141 TGTATTTGATGTACTCCTTTTGG + Intergenic
1153794244 18:8608667-8608689 AGTAAATGGCATACTCCTTTGGG - Intergenic
1154470806 18:14699187-14699209 TGTAGATGGGGTAATACTTCTGG + Intergenic
1155875441 18:31081045-31081067 AATACATGAGATACTCCTTTAGG + Intronic
1157254428 18:46125624-46125646 TGTACATTGGGTATCCCTCTGGG + Intronic
1158594469 18:58804151-58804173 TGTACATGAGGTACCCAGTTGGG - Intergenic
930818994 2:55626684-55626706 TGGACTTGGGGTACTTTTTTGGG + Intergenic
931985275 2:67735865-67735887 TCTAAATGGGTTTCTCCTTTGGG - Intergenic
933285206 2:80377954-80377976 AGTACAAGGGAAACTCCTTTTGG + Intronic
933714607 2:85350866-85350888 TGTACATGGGGTACTCCTTTCGG + Exonic
935828744 2:106977209-106977231 TGTGGATGGGCTACACCTTTGGG + Intergenic
1169181908 20:3576885-3576907 AGTACATGGGGTTATCCTTGGGG - Exonic
1170379016 20:15735878-15735900 TGAATTTGGGGTATTCCTTTGGG - Intronic
1174267716 20:49344069-49344091 TTTACCTTGGGTACTCCCTTTGG + Intergenic
1176108107 20:63399043-63399065 TGCCCATGGGGTTCTCCTCTGGG + Intergenic
1176803678 21:13458750-13458772 TGTAGATGGGGTAATACTTCTGG - Intergenic
1178233179 21:30811124-30811146 TGTACCTCCTGTACTCCTTTGGG + Intergenic
1178389135 21:32184431-32184453 GTTACATGGGCTCCTCCTTTAGG + Intergenic
1181168426 22:20995270-20995292 TGGACATGGGGCACCTCTTTCGG + Intronic
961330989 3:126137882-126137904 TGTACATGGCATCCACCTTTGGG - Exonic
962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG + Intergenic
963925190 3:150943940-150943962 AGTAAATGGGGTACCCCTGTTGG + Intronic
964539360 3:157762072-157762094 TGGACATGGGATGCTCCTGTTGG - Intergenic
968402233 4:307665-307687 TGTAGATGAGGTTTTCCTTTTGG + Intergenic
969081537 4:4622428-4622450 TCTACATGGGGTTCTCCACTGGG - Intergenic
972630841 4:40840635-40840657 AGTACCTGGGATACTCCTTTCGG - Intronic
973374425 4:49277414-49277436 TCTACTTGGGGTACCCCTTCCGG - Intergenic
973382986 4:49332827-49332849 TCTACTTGGGGTACCCCTTCCGG + Intergenic
978399225 4:108313506-108313528 AGTACATGGGGTAGGCCCTTTGG - Intergenic
982455546 4:155605229-155605251 GGAACATGGGAGACTCCTTTGGG - Intergenic
983256578 4:165407175-165407197 TGTAAATGGTGTAGTCATTTTGG - Intronic
984789250 4:183599885-183599907 TGTACATTGGGCACACCTTTAGG + Intergenic
987007247 5:13723256-13723278 TGTACATGGAGTAGACATTTGGG - Intronic
988487979 5:31682718-31682740 TGTACATGGTTTACACATTTTGG + Intronic
991226520 5:64279481-64279503 TGTACATGTGTGTCTCCTTTAGG + Intronic
997522089 5:134529404-134529426 TGGAGATGGGGTACACCTTCTGG + Intronic
999917909 5:156283986-156284008 TGTACATGGGTAACTTCTTAGGG + Intronic
1000374562 5:160567473-160567495 TGTTCATGGCTTAATCCTTTGGG + Intronic
1004418431 6:15446346-15446368 TATGCATGAGGTACTGCTTTAGG + Intronic
1006168557 6:32080016-32080038 GCTACATGGGGGACTACTTTGGG + Intronic
1006293528 6:33159024-33159046 TCTACATGGGCTTCTCCTTTAGG - Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1018763500 6:166910700-166910722 TGTTCCTGGTGTTCTCCTTTTGG - Intronic
1021800342 7:24299191-24299213 TGAACATGGGGGCCTCATTTTGG + Intergenic
1021899272 7:25267145-25267167 GGTAAAAGGGGTACTCCTTGAGG + Intergenic
1033134520 7:138773603-138773625 TATACATGGGGTATTGCTTCTGG - Intronic
1036553216 8:9833420-9833442 TGTACATGGGCTTCTCCATAGGG + Intergenic
1042782774 8:72510134-72510156 TGTACCTGGGGTCCTCCCTTTGG - Intergenic
1042881959 8:73503200-73503222 TGTACATGGGAGACACCATTTGG + Intronic
1050316907 9:4411724-4411746 TGTCCATGGGTTATTTCTTTGGG - Intergenic
1053701923 9:40702763-40702785 TGAACTTGGTGTACTCTTTTAGG - Intergenic
1054411985 9:64826218-64826240 TGAACTTGGTGTACTCTTTTAGG - Intergenic
1055428959 9:76224664-76224686 TGGAGATGGGGTAATCTTTTGGG + Intronic
1059411968 9:114138268-114138290 TGTATAGGAGGTGCTCCTTTAGG - Intergenic
1060384333 9:123209540-123209562 TGTACATGGTGAACTTCTTGTGG - Intronic
1061283763 9:129611093-129611115 TGTGGATGGGGGACGCCTTTTGG - Intronic
1203551112 Un_KI270743v1:165659-165681 TCTACTTGGGGTACCCCTTCCGG + Intergenic
1186331766 X:8542024-8542046 GACACATGGGGCACTCCTTTTGG + Intronic
1188371706 X:29377734-29377756 TGTACAGAGGGAACTCCATTAGG - Intronic
1193347741 X:80423733-80423755 TGTACATGGGGTGCTCCAGTAGG - Intronic
1193927756 X:87509740-87509762 TGTACATGTGGGCCTACTTTTGG + Intergenic
1194420958 X:93672529-93672551 TTTACCTGGGGGACTTCTTTAGG + Exonic
1199803492 X:151274232-151274254 TCTACAAGAGCTACTCCTTTAGG - Intergenic
1201430849 Y:13900594-13900616 GACACATGGGGCACTCCTTTTGG - Intergenic