ID: 933716334

View in Genome Browser
Species Human (GRCh38)
Location 2:85363825-85363847
Sequence GAGAACAGCACAGCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888
Summary {0: 1, 1: 1, 2: 19, 3: 203, 4: 664}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933716332_933716334 23 Left 933716332 2:85363779-85363801 CCTGTTTTTAAAACCATCAGATC 0: 296
1: 1388
2: 3049
3: 2710
4: 2200
Right 933716334 2:85363825-85363847 GAGAACAGCACAGCAGAGACTGG 0: 1
1: 1
2: 19
3: 203
4: 664
933716333_933716334 10 Left 933716333 2:85363792-85363814 CCATCAGATCTTGTGAGACTTAT 0: 1337
1: 2885
2: 5481
3: 5461
4: 4813
Right 933716334 2:85363825-85363847 GAGAACAGCACAGCAGAGACTGG 0: 1
1: 1
2: 19
3: 203
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933716334 Original CRISPR GAGAACAGCACAGCAGAGAC TGG Intronic
900466820 1:2829830-2829852 GAGAGGAGCACCGCAGAGCCTGG - Intergenic
900567098 1:3338867-3338889 GAGGACAGGCCAGCAGAGAAAGG + Intronic
900640728 1:3687009-3687031 GACACCAGAACAGCAGAGCCAGG + Intronic
901175320 1:7294523-7294545 GAGACCAGCTCTGCAGAGAAAGG + Intronic
901365195 1:8741500-8741522 GAGAACAGCATGGGAGAAACCGG - Intronic
901572204 1:10170099-10170121 GAAAACATCACAGCAGGCACAGG - Intronic
901650687 1:10741330-10741352 GAAAACAGCAAAGCAAAGCCTGG + Intronic
901674882 1:10877307-10877329 GAGGACAGAACATCAGAGAGAGG + Intergenic
902271088 1:15305650-15305672 GAGAACAGCACAGGAAATACTGG - Intronic
902273427 1:15323055-15323077 GAGAACAGCACGGGAAAGTCCGG + Intronic
902918663 1:19653694-19653716 GAGGACGGCACAGCCGAGAAAGG - Intronic
903843641 1:26263220-26263242 GTCAACAGCACAGCAGAGGTGGG - Intronic
904374511 1:30071743-30071765 CAGAGCAGCTAAGCAGAGACTGG + Intergenic
904427468 1:30438243-30438265 GAGAATAGCACAGGAAAGACTGG - Intergenic
904571902 1:31472627-31472649 GAGAACAGCACAGGAAAGACCGG + Intergenic
904572223 1:31474847-31474869 GAGAATAGCACGGGAAAGACTGG + Intergenic
905001118 1:34671048-34671070 GAGAACAGCACGGGGGAAACTGG + Intergenic
905087178 1:35391178-35391200 GTGAGCAGCACAGCAGAGAAGGG + Intronic
905512846 1:38536427-38536449 TATAACAGAACACCAGAGACTGG - Intergenic
905959028 1:42027853-42027875 GAGAATAGCACAGGAAAGACTGG + Intronic
906020926 1:42628595-42628617 GAGAATAGCACAGGAAAGACTGG - Intronic
907222356 1:52916278-52916300 AAGAACAGGAAAGCAGAGAGAGG - Intronic
907314241 1:53558434-53558456 GAAAGCAGCAGAGCAGCGACTGG - Intronic
907392397 1:54166830-54166852 GAGAACAGCATGGGAAAGACTGG + Intronic
907437928 1:54461451-54461473 CAGAATAGCAAAGCTGAGACTGG + Intergenic
907453164 1:54560191-54560213 CAGCACAGCACAGCACAGCCAGG + Intronic
907624991 1:56021463-56021485 GAGAATAGCACAGGAAAGACTGG + Intergenic
907726785 1:57027415-57027437 GTGGGCAGCACAGCAGAGAAGGG - Intronic
907984318 1:59515631-59515653 GAGAACAGCATGGGAAAGACTGG - Intronic
908091883 1:60695071-60695093 GAGAAGTGCACAGCAAAGGCAGG + Intergenic
908158912 1:61386799-61386821 CAGAACAGAACACCATAGACTGG + Intronic
908417195 1:63924750-63924772 GAGAGCAGCACAGGAGGGCCTGG + Intronic
908792011 1:67792105-67792127 AAGAAAAGCAAAGCAGAGTCTGG - Intronic
909092272 1:71241176-71241198 GAGAAAATTACAACAGAGACAGG - Intergenic
909192724 1:72573906-72573928 AAGAACAGCACAGTAAAGACCGG - Intergenic
909274265 1:73665152-73665174 GAGAATAGCACAGGAAAGACTGG - Intergenic
909695717 1:78465877-78465899 GAGAAATGCAGAGCTGAGACTGG + Intronic
909816009 1:79994514-79994536 CAGAACAACACAGCAGAGAAAGG - Intergenic
909878884 1:80847891-80847913 GGGACCAGCACAGGAGAGACAGG + Intergenic
910022584 1:82610358-82610380 GAGAATAGCACGGGAAAGACCGG - Intergenic
910491192 1:87773557-87773579 GAGACCAGCAGTGCAGAGTCTGG + Intergenic
910774675 1:90863001-90863023 GAGAACAGCATAGGAAAGACAGG + Intergenic
911258701 1:95662019-95662041 GAGAATAGCACGGGAAAGACCGG - Intergenic
911612044 1:99968563-99968585 GAGAATAGCACAGGAAAGACTGG + Intergenic
911643418 1:100313350-100313372 AAGGGCAGCACAGCAGAGAACGG + Intergenic
912892719 1:113552030-113552052 GAGAAAAGCACAGCAAAGTGTGG - Intronic
913061888 1:115216287-115216309 TAGGACAGCAGAGCACAGACAGG - Intergenic
913081715 1:115394661-115394683 GAGAATAGCACGGGAAAGACCGG + Intergenic
913489330 1:119364312-119364334 GAGAATAGCACAGGAAAGACTGG + Intergenic
913559208 1:120000992-120001014 GAGAATAGCACAGGAAAGACTGG - Intronic
913638657 1:120789550-120789572 GAGAATAGCACAGGAAAGACTGG + Intergenic
914279802 1:146160435-146160457 GAGAATAGCACAGGAAAGACTGG - Intronic
914540840 1:148611353-148611375 GAGAATAGCACAGGAAAGACTGG - Intronic
914625800 1:149459893-149459915 GAGAATAGCACAGGAAAGACTGG + Intergenic
916160100 1:161902812-161902834 GAGAAAAGTAAAGCAGAGAAAGG + Intronic
917505839 1:175625995-175626017 GAGAATAGCACAGGAAAGACAGG - Intronic
918718778 1:187825815-187825837 GAGAACACCACATCAAAGAATGG - Intergenic
918724545 1:187902723-187902745 GAAAATAGCACAGCACAGAAAGG + Intergenic
919539964 1:198834056-198834078 GAGAGCAGCATAAAAGAGACTGG - Intergenic
919736774 1:200957564-200957586 GAGGCCAGTACAGCACAGACAGG + Intergenic
919900049 1:202037503-202037525 GAAAATAGCACAGGAAAGACGGG - Intergenic
919912434 1:202119874-202119896 GAGGATCCCACAGCAGAGACAGG + Intergenic
920050486 1:203161943-203161965 GAGAGCAACAGAACAGAGACGGG - Intronic
920502832 1:206496316-206496338 GGAAGCAGCACAGCTGAGACTGG + Exonic
920555513 1:206901387-206901409 AAGATAAGCACAGCAGAGATAGG - Intronic
920648662 1:207821243-207821265 GGCAAAAGCACAGCAGAGGCAGG - Intergenic
920839119 1:209539025-209539047 GAGCTCAGCACAGGAGAGAGAGG - Intergenic
920950333 1:210566581-210566603 CAGAACAGCATGGCAGAGAAGGG + Intronic
921598256 1:217078655-217078677 TAGGTCAGGACAGCAGAGACAGG - Intronic
921702209 1:218281396-218281418 GAGAAAAGCACATCAGAACCAGG + Intergenic
921716240 1:218419432-218419454 GAGAAAAGCACAGTAGACATTGG - Intronic
921840975 1:219827862-219827884 AAGAAGAGAACAGCAGATACTGG - Intronic
922071955 1:222203674-222203696 GGGACCAGGACATCAGAGACGGG - Intergenic
922152484 1:223017837-223017859 GAGAATAGCACGGGAAAGACCGG + Intergenic
922872935 1:228917674-228917696 GAGGACTGCACAGCAGACACAGG + Intergenic
923091410 1:230743909-230743931 AAGAACAGCACAGAAAAGAGAGG + Intergenic
923663781 1:235980990-235981012 GAGGAGAGCACAGCAGACCCAGG + Intronic
924430316 1:243990850-243990872 GAGAATAGCACAGGAAAGACTGG + Intergenic
924785836 1:247198499-247198521 GAGAATAGCACGGGAAAGACTGG - Intergenic
924798184 1:247308188-247308210 AAGAACACCACAGCAGAGGTCGG + Intronic
1063910024 10:10820021-10820043 AAGAATAGCACAGGAAAGACAGG - Intergenic
1064133751 10:12732625-12732647 GAGAATAGCACAGGAAAGATGGG + Intronic
1064332868 10:14410202-14410224 GAGAAGAGAACAGAAGAGAAAGG + Intronic
1064336891 10:14451585-14451607 GAGAATAGCACAGGAAAGGCCGG - Intronic
1065130171 10:22612576-22612598 GAGAGCAGCTCAGCAGAGGGCGG + Intronic
1065400603 10:25296027-25296049 GAGAAAAGCATAGCAGGGGCAGG + Intronic
1065987798 10:30973722-30973744 CGGAACAGCACAGAAAAGACTGG - Intronic
1066473082 10:35718312-35718334 GAGAATAGCACAGGAAAGACAGG + Intergenic
1067378891 10:45754183-45754205 GAGGTGAGCACAGCAGAGGCAGG - Intronic
1067882653 10:50060004-50060026 GAGGTGAGCACAGCAGAGGCAGG + Intergenic
1067886593 10:50094845-50094867 GAGGTGAGCACAGCAGAGGCAGG - Intronic
1067907907 10:50313167-50313189 AAGAACTGCACAGCAAAGACAGG + Intronic
1068049202 10:51927687-51927709 GGGAAAAGCACTGCAGAGATAGG - Intronic
1068972263 10:62972298-62972320 GAAAACAGCATAGAAGAGCCTGG + Intergenic
1069041392 10:63699235-63699257 CTGCACAGCACAGCAGAGGCTGG + Intergenic
1069099805 10:64306220-64306242 GAGAACAGCACAGGAAAAACCGG + Intergenic
1069175610 10:65285596-65285618 GAGAATTGCACAGGAAAGACCGG + Intergenic
1070331873 10:75423272-75423294 GAGAACAACGCAGCAGGGAAGGG - Intergenic
1070644610 10:78193005-78193027 AAGGGCAGCACAGCAGAGAAGGG - Intergenic
1070788790 10:79177513-79177535 GAGATCAGCAGAGCACAGAGAGG + Intronic
1071443012 10:85719604-85719626 GAGAATAGCACAGGAAAGACAGG + Intronic
1071486965 10:86108638-86108660 GAGAAAAGCAGAGCAGAGTCTGG - Intronic
1072111690 10:92327180-92327202 GAGACCAGAACATCAGAGAGTGG - Intronic
1072487880 10:95873919-95873941 GAGAATAGCACAGAAAAGACTGG + Exonic
1073654292 10:105395841-105395863 GAGAGCAGGAGAGGAGAGACAGG + Intergenic
1073787522 10:106906591-106906613 CAGAATAGCACAGGAAAGACTGG + Intronic
1074041260 10:109792481-109792503 AAGAATAGCACAGGAAAGACTGG + Intergenic
1074178473 10:111034286-111034308 GAGAATAGCACGGGAAAGACTGG + Intergenic
1074619744 10:115106607-115106629 GAGAATAGCACGGGAAAGACTGG - Intronic
1074702029 10:116100922-116100944 GAGGACAGCTCAGCAGACAGTGG + Intronic
1074836652 10:117302744-117302766 GAGAATAGCACAGGAAAGACTGG - Intronic
1075348820 10:121705500-121705522 GGGAGGAGCACAGCAGTGACGGG + Intergenic
1075509134 10:123055353-123055375 GAGAATAGCACAGGAAAGACTGG + Exonic
1075509267 10:123056401-123056423 GAGAATAGCACAGGAAAGACTGG + Exonic
1075767948 10:124909437-124909459 GAGAACAGCAATTCAGAGACAGG - Intergenic
1075815317 10:125260505-125260527 GAGGACAGCACAGCATAGCGAGG + Intergenic
1076141323 10:128080647-128080669 AGGAAGAGCACAGCTGAGACGGG - Intronic
1076261778 10:129072152-129072174 GAGAACAGCATGGGAAAGACAGG - Intergenic
1076464966 10:130672983-130673005 GAGAATAGCACAGGAAAGACTGG + Intergenic
1076791886 10:132781038-132781060 GAGAACAGGAGAGGAGAGACTGG - Intronic
1077419610 11:2444383-2444405 GAGAACGGCACAGCGGGGGCAGG - Intergenic
1077547352 11:3180304-3180326 GAGAATAGCACCGGAAAGACCGG + Intergenic
1077871111 11:6262072-6262094 GATAACAAAACAGCAGAAACAGG + Intronic
1078058659 11:8029782-8029804 GAGAACAGGACAGCTGGGATTGG + Intronic
1078408156 11:11089242-11089264 GAGAATAGCACAGGAAAGACTGG - Intergenic
1078722158 11:13895225-13895247 GAGACCAGGAAAGCAGAGAGTGG - Intergenic
1079496637 11:21051968-21051990 GAGAAAAATACAGCAGAGTCAGG + Intronic
1080153502 11:29079563-29079585 AAGAATAGCACAGGAAAGACAGG - Intergenic
1080477310 11:32608001-32608023 AAGAACAGCATAGGAAAGACCGG + Intronic
1080739488 11:35050154-35050176 GATAAAAGCATACCAGAGACTGG - Intergenic
1080781323 11:35432522-35432544 GATATCTGCACTGCAGAGACAGG - Exonic
1080882846 11:36338921-36338943 GAGAATAGCACGGGAAAGACGGG - Intronic
1081077884 11:38697968-38697990 GAGAATAGCACAGGAAAGACTGG + Intergenic
1081437419 11:43042062-43042084 GAGAATAGCACAGGAAAGACTGG + Intergenic
1082766039 11:57168870-57168892 GAGAATAGCACGGGAAAGACCGG + Intergenic
1082822815 11:57556067-57556089 TAGCACAGGACAGCACAGACAGG - Intronic
1082941646 11:58711348-58711370 GAGAACTGAACAGAGGAGACAGG - Intronic
1084147190 11:67271320-67271342 GTAAACAGCAAAGCAGAGAAGGG - Intronic
1084652273 11:70496154-70496176 GCCAACAGCACAGCAGAGCCTGG - Intronic
1085097995 11:73776170-73776192 GAGAGCAGCACAGCAGATAAAGG + Intergenic
1085194472 11:74660196-74660218 GAGAATAGCACAGGAAAGACTGG + Intronic
1085754895 11:79194044-79194066 GAAAATAGCACAGGAAAGACCGG - Intronic
1086338606 11:85824904-85824926 GAGACTAGCACAGCTGAGATAGG + Intergenic
1086629988 11:89006129-89006151 GAGAACAGTATAGCAGAAAGAGG + Intronic
1086840482 11:91677462-91677484 GAGAATAACACAGGAAAGACTGG - Intergenic
1087357739 11:97116248-97116270 GAGAACAACAAAGCAGAGATGGG + Intergenic
1087997086 11:104822469-104822491 AAGAATAGCACAGAAGAGGCTGG - Intergenic
1088527677 11:110774300-110774322 TAAAACAGGACAGCAGAGAAAGG - Intergenic
1088715053 11:112541833-112541855 GTGGGCAGCACAGCAGAGAAGGG - Intergenic
1088937990 11:114423594-114423616 GAGAAGACCACAGAAGAGCCAGG - Intronic
1089533820 11:119149111-119149133 GTGCACAGCCCAGCAGAGTCAGG + Exonic
1089631584 11:119787636-119787658 GAGCAGAGACCAGCAGAGACTGG - Intergenic
1090460549 11:126887888-126887910 CAGCACAGCACAGGAGAGAGGGG + Intronic
1091269659 11:134298576-134298598 GAGAATAGCACGGGAAAGACTGG - Intronic
1091322480 11:134661830-134661852 GGGCACAGCACAGCAGAGTGAGG + Intergenic
1091831577 12:3554151-3554173 CAAAACAGCCCAGCAGTGACAGG - Intronic
1091878643 12:3958711-3958733 GAGAATAGCACAGGAAAGACCGG + Intergenic
1092326421 12:7535579-7535601 AAGAATAGCACAGGAAAGACTGG - Intergenic
1093362513 12:18248070-18248092 GAGAAAAGCACAGGTGAGACAGG + Intronic
1093493241 12:19727379-19727401 GAGAAGAGAACAGCAGACACTGG + Intergenic
1093898714 12:24605557-24605579 GAGAACAGCACCCCAGATAAGGG + Intergenic
1094830638 12:34298604-34298626 AAAAACAGTGCAGCAGAGACGGG + Intergenic
1095039573 12:37426373-37426395 GAGAATAGCACAGGAAAGACTGG - Intergenic
1095872378 12:47043859-47043881 GAGGAAAGCTCAGCAGAGCCAGG + Intergenic
1095983217 12:47984301-47984323 GAGAACAGCTAAGAAAAGACGGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1097250522 12:57630151-57630173 CAGACCAACACAGCAGACACAGG - Exonic
1097420261 12:59369427-59369449 GAGAGCAGCGCGGTAGAGACTGG - Intergenic
1097570673 12:61327210-61327232 GAGAATAGCACAGGAAAGACTGG + Intergenic
1097999246 12:65922818-65922840 GAGAATAGCACAGGAAAGACCGG - Intronic
1098832635 12:75381144-75381166 GAGAATAGCACAGGAAAGACTGG - Intronic
1098842322 12:75491294-75491316 GAGAACAGCAAGGCACACACGGG + Exonic
1099779947 12:87182051-87182073 GAGAATAGCACGGGAAAGACTGG - Intergenic
1100245488 12:92752760-92752782 TAGAACAACACACCATAGACTGG + Intronic
1100598325 12:96090501-96090523 GAGAACAGCATGGGAAAGACTGG - Intergenic
1100678315 12:96892387-96892409 GAGAATAGCACGGGAAAGACCGG - Intergenic
1100714173 12:97288744-97288766 GAGAATAGCACGGGAAAGACCGG + Intergenic
1101231146 12:102742766-102742788 GAGAATAGCACGGGAAAGACCGG - Intergenic
1101237660 12:102805717-102805739 GATAACAGGATAGCAGAGAAGGG - Intergenic
1101446492 12:104740510-104740532 GAAAGCAGCAGAGCAAAGACTGG - Intronic
1101729944 12:107418700-107418722 GAGAACTGCAAAGAAGGGACAGG - Intronic
1102211912 12:111133518-111133540 GAGAACAGCACAGGAAAGACTGG + Intronic
1102581356 12:113890291-113890313 GAAAACAGCAGAGCAGAGGAAGG - Intronic
1102758900 12:115367881-115367903 GAGAGTAGCACAGGAAAGACTGG - Intergenic
1102760520 12:115380870-115380892 GAGCACAGCACAGAGGAAACTGG + Intergenic
1103009437 12:117446967-117446989 GAGAACAGCACAGGAAAGGCTGG - Intronic
1103222418 12:119256864-119256886 AAGAACAGCACAGGAAAGACAGG - Intergenic
1103504242 12:121430578-121430600 TAGTGCAGCACAGCAGGGACTGG - Intronic
1103930819 12:124449881-124449903 GAGAGAAGCACATCAGAGCCTGG + Intronic
1103977500 12:124713066-124713088 GCGAGCGGCAGAGCAGAGACAGG - Intergenic
1104364235 12:128162550-128162572 GAGAATAGCACAGGAAAGACTGG - Intergenic
1104689383 12:130813852-130813874 GACAACAGGACTCCAGAGACGGG - Intronic
1104742623 12:131189543-131189565 GAGAATAGCACAGGAAAGACTGG + Intergenic
1104749121 12:131227365-131227387 GAGAATAGCACAGGAAAGACTGG - Intergenic
1105993301 13:25645287-25645309 CAGAATAGCACAGGAAAGACTGG + Intronic
1106116927 13:26825805-26825827 GAGAACAGCACAGGAAAGACTGG + Intergenic
1106835908 13:33635208-33635230 AAGAACAGCACAGCAGAGCAGGG + Intergenic
1106855222 13:33844379-33844401 GAGAGAAGAACAGCAGAAACTGG - Intronic
1106975306 13:35204485-35204507 GAGAATAACACAGGAAAGACCGG + Intronic
1108534864 13:51364731-51364753 GAGAACAGCAGAGCAGAACAAGG + Intronic
1108933836 13:55863400-55863422 AAGAATAGCACAGGAAAGACTGG - Intergenic
1109155809 13:58907136-58907158 GAGTTCAACAGAGCAGAGACAGG - Intergenic
1109221858 13:59647755-59647777 GAGAATAGCACAGGAAAGACTGG - Intergenic
1109286146 13:60409994-60410016 GAGACTAGCACAGGAAAGACTGG - Intronic
1109482586 13:62974945-62974967 AAGAATAGCACAGGAAAGACTGG + Intergenic
1109522380 13:63531026-63531048 GAGAATAGCACAGGAAAGACCGG - Intergenic
1109824029 13:67693480-67693502 GCGAATAGCACAGGAAAGACTGG + Intergenic
1110096029 13:71522243-71522265 GAGAACACCTCAGAAGACACTGG + Intronic
1110960216 13:81612246-81612268 AAGAACAGCACAGGAAAGACTGG + Intergenic
1111447081 13:88360852-88360874 GAGAACAGGAGAGCAGAGTGAGG - Intergenic
1111687092 13:91516000-91516022 GAGAATAGCACAGGAAAGACTGG + Intronic
1111687364 13:91517897-91517919 GAGAATAGCACAGGAAAGACTGG + Intronic
1111715875 13:91877897-91877919 GAGAAAAGCACAGGAAAGACCGG - Intronic
1112101733 13:96197330-96197352 GAGAATAGCACAGGAAAGACAGG + Intronic
1112143777 13:96675025-96675047 GAGCACAGCACAGCAAAAGCTGG - Intronic
1112854133 13:103745679-103745701 TATAACAGAACACCAGAGACAGG + Intergenic
1113280375 13:108781771-108781793 GAGACCAGCACAGGAAAGACCGG - Intronic
1113540798 13:111107484-111107506 GAGAATGGAACAGCAGACACTGG + Intergenic
1113877435 13:113603140-113603162 GAGAAGAGCAGGGCAGAGAAGGG + Intronic
1113921976 13:113918402-113918424 GACACCAGGCCAGCAGAGACTGG + Intergenic
1114135401 14:19843115-19843137 GAGAAAAGCACAACTGGGACTGG - Intergenic
1114217341 14:20666849-20666871 AAGAATAGCACAGGAAAGACTGG + Intergenic
1114393700 14:22337772-22337794 GAGACCAGCACAGTCCAGACTGG - Intergenic
1114683267 14:24505308-24505330 GAGAAGAGAGCAGCAGAGAGGGG + Intronic
1114693237 14:24604888-24604910 GAGAACAGCACAGGAAAAACTGG - Intergenic
1114730853 14:24991081-24991103 GAGAAGAGGAAAGCAGAGAGGGG + Intronic
1114958983 14:27859213-27859235 AAGAGCAGCACAACAGACACTGG + Intergenic
1115110248 14:29812683-29812705 GAGAACAGCAGAGGGGAAACTGG + Intronic
1115115750 14:29879318-29879340 AAGAATAGCACGGGAGAGACCGG - Intronic
1115116026 14:29881232-29881254 GAGAATAGCACGGAAAAGACCGG - Intronic
1115148458 14:30254745-30254767 AAGAAGAGAACAACAGAGACTGG - Intergenic
1115503423 14:34069991-34070013 GAGAACAGCCCAGGAAAGGCAGG - Intronic
1115929892 14:38478887-38478909 GAGAATAGCACAGGACAGACCGG - Intergenic
1116147804 14:41098559-41098581 GAGAATAGCACAGGAAAGACTGG - Intergenic
1116388429 14:44361173-44361195 GAGAACAGAGCAGGAAAGACCGG - Intergenic
1116744966 14:48805926-48805948 GAGAACACCAAAGCAAAGCCAGG - Intergenic
1116823521 14:49648814-49648836 GAGGAAAGCAAAGTAGAGACAGG + Intronic
1117198363 14:53363423-53363445 GAGAATAGCATAGGAAAGACTGG + Intergenic
1117434219 14:55700759-55700781 GAGAATAGCACAGGAAAGACCGG - Intronic
1117595189 14:57320049-57320071 GGGGACAGCACAGAATAGACTGG + Intergenic
1117746215 14:58872153-58872175 GAGCACACCACAGTAGAAACTGG - Intergenic
1118005231 14:61559452-61559474 GACAACAGCTGAGCAGAGTCAGG - Intronic
1118124170 14:62881444-62881466 GAGAACAGAACAACACACACTGG + Intronic
1118468894 14:66056754-66056776 GAGAGCAGCCCAGCAGAGACCGG + Intergenic
1118727133 14:68636948-68636970 AAGAAAATCAAAGCAGAGACAGG - Intronic
1118933299 14:70263152-70263174 GAGAATAGCACAGGAAAGACTGG - Intergenic
1119150678 14:72356748-72356770 GAGAAGTGCAGAGCAAAGACAGG - Intronic
1119655855 14:76416452-76416474 AAGAACAAAAAAGCAGAGACGGG - Intronic
1120280483 14:82431877-82431899 CAGAACAGTGCAGCAGAGAAAGG - Intergenic
1120753729 14:88222208-88222230 GAGAATAGCACAGGAAAGACTGG + Intronic
1120895752 14:89530433-89530455 CAGAACAGCACAGGAAAGACTGG + Intronic
1121760170 14:96438319-96438341 GAAAACAACAGAGCAGAGAAAGG + Intronic
1122117621 14:99535642-99535664 GAGTCCAGCACGGCAGAGGCGGG + Intronic
1123046265 14:105517707-105517729 GAGAATAGCACGGGAAAGACTGG - Intergenic
1123189337 14:106553307-106553329 GAGAATAGCACGGGAAAGACAGG + Intergenic
1123795407 15:23765761-23765783 GAGAACAGCATAGGAAAGACTGG - Intergenic
1123892591 15:24796145-24796167 AAGAATAGCACAGGAAAGACCGG - Intergenic
1123974876 15:25543714-25543736 AGGAAAAGAACAGCAGAGACAGG - Intergenic
1124604716 15:31161600-31161622 CAGAGCAGCACAGAACAGACGGG - Intergenic
1124794333 15:32762450-32762472 GAGAATAGCACGGGAAAGACCGG + Intergenic
1125304353 15:38292640-38292662 GAGAATAGCACAGGAAAGACCGG + Intronic
1125449627 15:39795150-39795172 GAGGACAGCACAGTACAGACAGG - Intergenic
1126901200 15:53316258-53316280 GTGCGCACCACAGCAGAGACAGG + Intergenic
1126927970 15:53612374-53612396 GAGAACAGTACAACAGCGAAAGG + Intronic
1127094353 15:55497783-55497805 GAGAGCAGCAAAGCAAAGATTGG - Exonic
1127576412 15:60296346-60296368 GAGAATAGCACTGGAAAGACTGG + Intergenic
1128250588 15:66161276-66161298 ATCAACAGCACAGCAAAGACAGG + Intronic
1128543739 15:68554051-68554073 GAGCACAGCACAGCAGAGACAGG + Intergenic
1128630392 15:69259906-69259928 CTGATGAGCACAGCAGAGACTGG - Intronic
1129293168 15:74584202-74584224 GAGAATATCACAACAGATACTGG - Intronic
1130372443 15:83296414-83296436 GAGACTAGTACAGCAGAGAGGGG - Intergenic
1130671744 15:85918986-85919008 GAGAACAGCACACCACAGAAGGG - Intergenic
1130780450 15:87032552-87032574 GCGAACAGCATTGCAGATACAGG + Intergenic
1131593180 15:93770917-93770939 GAGAAGAAGACAGCAGAGAGAGG - Intergenic
1131644042 15:94322978-94323000 GACGGCATCACAGCAGAGACAGG - Intronic
1131765271 15:95668905-95668927 GAGGACAGAAAAACAGAGACAGG + Intergenic
1131842222 15:96449618-96449640 AAGTACAGCAAATCAGAGACTGG - Intergenic
1131919341 15:97306650-97306672 TATAACAGTACACCAGAGACTGG + Intergenic
1132057228 15:98661584-98661606 GAGAAGAGCAGAGCAAAGACAGG - Intronic
1132343513 15:101092780-101092802 GGGCACAGCACAGCAGTGCCTGG - Intergenic
1132407761 15:101554651-101554673 GGCCACAGCACAGCAGAGCCTGG + Intergenic
1132850918 16:2024603-2024625 GAGAACAGCATGGCAGAGGGAGG - Intergenic
1133332845 16:4987356-4987378 GAGCCCAACACAGCAGAGCCTGG - Intronic
1133533758 16:6680246-6680268 GAGAAAAGCAAAGCAAAGACAGG - Intronic
1134911655 16:18032515-18032537 GAGAATAGCACAGGAGAGACTGG + Intergenic
1135420239 16:22301019-22301041 GAGAAAACCAGAGCAGAGAAGGG + Intronic
1135571434 16:23552313-23552335 GAGAACAGCTCAGATAAGACAGG + Intronic
1136655857 16:31708827-31708849 GAGAACAGCACAGCTCAGCTGGG - Intergenic
1137229473 16:46550157-46550179 CAAAACAGCACAGCTGAAACAGG + Intergenic
1137271322 16:46904159-46904181 GAGAAATGCACAGAAGAAACGGG + Intronic
1137623337 16:49891561-49891583 TAGAACAGCTCAGAGGAGACTGG + Intergenic
1138055916 16:53833072-53833094 GAGAATAGCACGGGAAAGACCGG - Intronic
1138201418 16:55091456-55091478 GAGGGCAGCAAGGCAGAGACTGG - Intergenic
1138498712 16:57425173-57425195 GAGAACCCCACAGCGGAGCCTGG - Intergenic
1138955067 16:61961566-61961588 GGAAACAGGAGAGCAGAGACTGG - Intronic
1139091042 16:63648019-63648041 AAGAATAGCACAGGAAAGACCGG + Intergenic
1139374706 16:66489704-66489726 ACGGGCAGCACAGCAGAGACAGG + Intronic
1140620600 16:76726285-76726307 GAGAACAGCAAAGCAGAGTCAGG - Intergenic
1140910395 16:79446083-79446105 GAGAAAAGGAAAGCAGGGACGGG + Intergenic
1140991688 16:80219233-80219255 GAGAACAGCACTGGAAAGACTGG - Intergenic
1141600045 16:85120125-85120147 GAGTCCAGCAGAGGAGAGACAGG - Intergenic
1142194045 16:88731487-88731509 GAAAAGAGAACAGCAGAGCCTGG + Intronic
1142274271 16:89108104-89108126 GAGAATAGCACAGGAAAGACCGG + Intronic
1142680698 17:1546558-1546580 GAGGACAGGTCAGCAGAGGCTGG + Intronic
1142787846 17:2238246-2238268 GAGGACAGCTCAGCAGAGGAGGG - Intronic
1144028849 17:11302065-11302087 GAGAATAGCACAGGAAAGACCGG + Intronic
1144948128 17:18980218-18980240 GAGCAGAGCCCAGCAGAGACAGG - Intronic
1145378300 17:22372076-22372098 GAGACTAGCACAGGAAAGACTGG + Intergenic
1145898679 17:28475721-28475743 GAAGACAGCACGGCAAAGACGGG - Intronic
1145921471 17:28613361-28613383 GAGAACAGGCCAGTTGAGACTGG + Intronic
1146907331 17:36626142-36626164 GGGGACAGCATAGCAGAGGCAGG - Intergenic
1147839888 17:43363767-43363789 GGGAACAGCACAGAAGCTACCGG + Intergenic
1148340055 17:46867955-46867977 GAGAACAGAAGGGCACAGACTGG + Intronic
1149012002 17:51866422-51866444 GAGAAGAGCACAGGAAAGAAAGG - Intronic
1149110356 17:53020476-53020498 GAGAATAGCACAGGAAAGACTGG + Intergenic
1149633565 17:58147979-58148001 GAGAAGAGCAGATCAGAGATTGG + Intergenic
1149908248 17:60546486-60546508 GAGGAAAGCACAGCAGTGATGGG + Intergenic
1151399562 17:73847062-73847084 GAGAACAGCATGGCGGAAACTGG - Intergenic
1151876803 17:76871448-76871470 GAGAACCCCAAAGCAGAGAGGGG - Intronic
1151900434 17:77008942-77008964 CACAGCAGGACAGCAGAGACTGG + Intergenic
1152038763 17:77889961-77889983 GAGACCACCAAGGCAGAGACTGG + Intergenic
1152421660 17:80196611-80196633 GTGAACCACACAGCAGAGCCAGG - Intronic
1153011806 18:546514-546536 GAGAATAGCACAGGAAAGACAGG + Intergenic
1153449580 18:5212151-5212173 GAAAATAGCACAGGAAAGACGGG + Intergenic
1153569614 18:6455802-6455824 GAGAATAGGACAAGAGAGACTGG - Intergenic
1154132841 18:11751395-11751417 GAGCACTGCACAGGAGAAACGGG + Intronic
1154459537 18:14567117-14567139 GAGAAAAGCACAACTGGGACTGG - Intergenic
1155268618 18:24117882-24117904 TAAAACAGCACAGAAGAGAATGG - Intronic
1155631994 18:27905365-27905387 GAGAATAGCACGGGAAAGACTGG + Intergenic
1155880407 18:31140918-31140940 GAGAATAGCACAGGAAAGACTGG - Intronic
1158321375 18:56267942-56267964 GAGAACAGCAAAGCAGAAGCTGG - Intergenic
1158543256 18:58375276-58375298 GAGAACAGCAAAGCAGGAAAGGG - Intronic
1159003777 18:62995091-62995113 GAGAACAGCACAGGGGAAACCGG - Intergenic
1159072810 18:63645083-63645105 GAGAATAGCACAAGAAAGACCGG - Intronic
1159074255 18:63662720-63662742 GAGAATAGCACAAGAAAGACCGG - Intronic
1159083572 18:63761650-63761672 GAGAATAGCACAGGAAAGACTGG - Intronic
1159962564 18:74567066-74567088 GAGAATAGCACAGGAAAGACTGG + Intronic
1159967835 18:74613773-74613795 GAGAAAAGCACAGCATAAAAAGG - Intronic
1160243663 18:77140481-77140503 GAAAACAGCTCAGCAGACACAGG - Intergenic
1160284340 18:77526232-77526254 GAGAATAGCACGGGAAAGACTGG - Intergenic
1160601795 18:80019394-80019416 GAGAACAGCACAGGAAAGACTGG + Intronic
1161524804 19:4747291-4747313 GAGAAACACAGAGCAGAGACAGG - Intergenic
1161745386 19:6056504-6056526 GAGGAGAGCGCAGCAGAGAGTGG + Intronic
1161951276 19:7469428-7469450 GGGATCAGCACAGCCGGGACAGG + Intronic
1162790849 19:13062131-13062153 GAGAACAGCACAGCAGGGGAAGG - Intronic
1162857127 19:13477269-13477291 GGGAAGAGAACAGCAGAGAAAGG - Intronic
1163685287 19:18708936-18708958 GAGGACAGGACAGCAGGGAGCGG - Intronic
1163909257 19:20175078-20175100 GATGACAGAACAGCAGAGATGGG + Intronic
1164213812 19:23125194-23125216 GATAAAAACACACCAGAGACTGG - Intronic
1164274471 19:23704481-23704503 AAGAATAGCACAGGAAAGACTGG - Intergenic
1165599952 19:37046042-37046064 GAGAATAGCACAGGAAAGACTGG + Intronic
1165720273 19:38074044-38074066 GAGAGAAGCACAGCATAGGCAGG - Intronic
1165974907 19:39667189-39667211 GAGAATAGCACAGGAAAGACTGG + Intergenic
1168624998 19:57911090-57911112 GAGTACAACACAGCAGAGGGTGG + Intronic
925907543 2:8548187-8548209 GGGAACAGCACAGCACCGTCTGG - Intergenic
925938138 2:8787884-8787906 GAGAAAAGCACAGCTCAGAGAGG + Intronic
926170127 2:10547942-10547964 GAGCTCAGCACAGCAGCTACAGG + Intergenic
926196676 2:10768317-10768339 GAGATCGGCACAGCCGAGCCAGG + Intronic
926468116 2:13216208-13216230 GAGAACAGCACAGGAAAGCCTGG + Intergenic
926686614 2:15703243-15703265 TAGAATAGCACAGGAAAGACTGG + Intronic
926754163 2:16222385-16222407 GGGAACAGCACAGAAAAGGCAGG - Intergenic
927402022 2:22722411-22722433 CAGAATAGCACGGCAAAGACTGG + Intergenic
927612768 2:24558529-24558551 GAGAATAGCACAGGAAAGACTGG + Intronic
927640947 2:24844924-24844946 AAGAATAGCACAGAAAAGACCGG - Intronic
927749354 2:25653236-25653258 GAGAATAGCACGGGAAAGACCGG - Intronic
928465439 2:31518661-31518683 GAGAATAGCACGGGAAAGACTGG - Intergenic
928853701 2:35780252-35780274 GAGAATAGCACAGGAAGGACTGG - Intergenic
929528957 2:42733357-42733379 GAGAATAGCACAGGAAAGACTGG + Intronic
929851198 2:45592023-45592045 AAGAATAGCACAGGAGAGACTGG - Intronic
930006641 2:46903111-46903133 GAGAATAGCACGGGAAAGACTGG - Exonic
930766673 2:55091917-55091939 GAGAACAGCACAGGCAAGACTGG + Intronic
930941978 2:57024786-57024808 GAGAAAAACATATCAGAGACTGG + Intergenic
931267336 2:60672496-60672518 TAGAACAGCACAGCACTGATGGG + Intergenic
931660991 2:64562583-64562605 GAGAAAAGCAGAGCAGAAAGAGG - Intronic
931734433 2:65181133-65181155 AAGAATAGCACAGGAAAGACCGG - Intergenic
931766948 2:65465381-65465403 GATAACTGCACAGCAGAGCCTGG - Intergenic
931963187 2:67504215-67504237 AAGAATAGCACAGAAAAGACTGG - Intergenic
932264657 2:70357275-70357297 AAGAACAGCACAGCCAAGAAGGG + Intergenic
932904264 2:75733049-75733071 GAGAATAGAACAGGAAAGACTGG + Intergenic
932976312 2:76603493-76603515 GAGAATAGCACAGGGAAGACTGG + Intergenic
933313257 2:80686360-80686382 GAGAACCCCAAAGGAGAGACAGG - Intergenic
933435852 2:82249297-82249319 ATGGACAGAACAGCAGAGACAGG + Intergenic
933437013 2:82261070-82261092 GCGGGCAGCACAGCAGAGACAGG + Intergenic
933587025 2:84190325-84190347 GAGAACAGCACACCAGACCTTGG + Intergenic
933716334 2:85363825-85363847 GAGAACAGCACAGCAGAGACTGG + Intronic
933840879 2:86284679-86284701 GTGAGCAGCAGAGGAGAGACAGG + Intronic
933865260 2:86510177-86510199 GAGCTCAGCATAGCAGAGGCTGG - Intronic
933943766 2:87266897-87266919 TAGAACAAAACGGCAGAGACAGG + Intergenic
933981699 2:87555964-87555986 GAGAATAACACAGGAAAGACTGG + Intergenic
935232628 2:101112249-101112271 GAGAAAGACACAGCAGTGACTGG - Intronic
935332109 2:101984976-101984998 GAGAAAAGAATGGCAGAGACAGG - Intergenic
936312137 2:111394853-111394875 GAGAATAACACAGGAAAGACTGG - Intergenic
936336454 2:111594682-111594704 TAGAACAAAACGGCAGAGACAGG - Intergenic
936624104 2:114129431-114129453 TAGAACAGAAAAGCAGACACAGG - Intergenic
936903229 2:117507694-117507716 GAGAAAAGCAGAGCACAGAGGGG + Intergenic
937318252 2:120945638-120945660 GAGAACATCAGAGCTGAGAGAGG - Intronic
937554990 2:123143080-123143102 GAGAATAGCATGGGAGAGACTGG - Intergenic
938224780 2:129606392-129606414 GAGAAAGGCACAGCAGAGCTGGG - Intergenic
938618680 2:133026918-133026940 TAGAGCAGGACAGAAGAGACAGG - Intronic
938686537 2:133743298-133743320 GAGAATAGCATGGAAGAGACTGG + Intergenic
939037261 2:137148183-137148205 GAGAAATGCAGAGCAGAGAGGGG - Intronic
939287565 2:140153427-140153449 GAGAATAGCATAGGACAGACTGG + Intergenic
939686247 2:145204328-145204350 GAGAATATCACATCAGAGGCAGG - Intergenic
939900954 2:147848625-147848647 AAGAACAGAACAGCAGACACTGG + Intronic
940497571 2:154452916-154452938 GAGAAGACCACAGAAGAGATTGG - Exonic
941034729 2:160555805-160555827 TAGAACAGCACGGGAAAGACCGG + Intergenic
941477389 2:165966707-165966729 GAGAACAGCATGGGAAAGACTGG - Intergenic
941477719 2:165968933-165968955 GAGAATAGCACAGGAAACACTGG - Intergenic
941536125 2:166723950-166723972 GAGAATAGCATAGCAAAGGCCGG + Intergenic
942387954 2:175461633-175461655 GAGAATAGCACTGGAAAGACTGG - Intergenic
943072048 2:183153115-183153137 GAGAATAGCACAGGAAAGACTGG + Intronic
943205169 2:184885785-184885807 AAGAACAGCACAGGAAAGACCGG + Intronic
943205441 2:184887710-184887732 AAGAACAGCACAGGAAAGACTGG + Intronic
943251400 2:185524672-185524694 GAGAAGAGCACAGGAAAGACTGG - Intergenic
944430225 2:199625215-199625237 GAGCACAGCATAGCAAGGACAGG + Intergenic
944634487 2:201661550-201661572 GAGAACAGCACTGCAGAGGGAGG - Intronic
944713104 2:202353567-202353589 GATAACATCACAGCAGGAACAGG - Intergenic
945433925 2:209796610-209796632 GAGAATAGTACAGGAAAGACTGG - Intronic
945925223 2:215796430-215796452 GGGAACAGCACAGCAGGAACTGG - Intergenic
946339315 2:219057979-219058001 GAAGACAGCACAGGAGAGAGGGG - Intronic
946423000 2:219575396-219575418 GAGAGCAGCACAGCAGGGCTGGG - Exonic
946437032 2:219664068-219664090 GAGAATAGCACGGGAAAGACAGG + Intergenic
946538458 2:220657693-220657715 CAGAACAACACAGCAGAGAAAGG - Intergenic
946574146 2:221056517-221056539 GAGAATAGCACAGGAAAGACTGG + Intergenic
946712132 2:222517329-222517351 CAGAATGGCACAGCAGAGAAGGG + Intronic
946757696 2:222963704-222963726 GAGAATAGCACAGGAAAGACCGG - Intergenic
946805590 2:223468502-223468524 GAGAACAGCACAAGAAAGACAGG + Intergenic
947457876 2:230272444-230272466 GAGAATAGCACAGGAAAAACCGG - Intronic
947714888 2:232334471-232334493 CAGAACAGCAAAGAAGAGACTGG - Exonic
947912455 2:233810423-233810445 GAGAATAGCATGGGAGAGACTGG + Intronic
947953170 2:234165231-234165253 GAGAAGAGAACAACAGACACCGG - Intergenic
948055668 2:235007885-235007907 GAGACCAGCAGAGCAGGGATGGG + Intronic
948686951 2:239675784-239675806 AAGAACATCCCAGCAGAGTCGGG - Intergenic
1168889694 20:1286945-1286967 GAGCAAAGCACAGCACACACAGG + Intronic
1169388298 20:5169300-5169322 GAGACCAGCACAGCAGGGAGAGG - Intronic
1169488856 20:6054805-6054827 GAGAACAGCATGGGAAAGACTGG - Intergenic
1169717702 20:8639136-8639158 GTGGGCAGCACAGCAGAGAAGGG + Intronic
1169999103 20:11595690-11595712 AAGAATAGCACAGGAAAGACTGG + Intergenic
1170165077 20:13353274-13353296 GGGAACACTACAACAGAGACAGG - Intergenic
1170365081 20:15589204-15589226 GAGAATAGCATAGGAAAGACTGG + Intronic
1170395741 20:15923379-15923401 GAGAATAGCACAAGAAAGACCGG + Intronic
1171208555 20:23299848-23299870 GAGAACCGCCCAGCTGAGCCCGG - Intergenic
1171524978 20:25801931-25801953 GAGAATAGCACAGGGAAGACTGG - Intronic
1171534161 20:25871594-25871616 GAGAATAGCACAGGGAAGACTGG - Intergenic
1171551849 20:26053952-26053974 GAGAATAGCACAGGAAAGACTGG + Intergenic
1171571340 20:26254479-26254501 GAGAATAGCACAGGAAAGACTGG - Intergenic
1171792961 20:29545255-29545277 GAGAATAGTACAGGAAAGACTGG + Intergenic
1171847201 20:30284386-30284408 GAGGAAAGCCCAGCGGAGACGGG + Intergenic
1172273301 20:33666689-33666711 CGGAACAGCAAAGCAGAGGCGGG + Exonic
1172425813 20:34855214-34855236 CAGCAGAGCACAGCAGAAACAGG + Intronic
1172594705 20:36142734-36142756 CAGCACAGCACAGCACAGCCCGG - Intronic
1173023676 20:39288251-39288273 GAGAATAGCACAGGAAAGACTGG - Intergenic
1173201718 20:40959775-40959797 GAGAAAGGCACAGCATAAACAGG + Intergenic
1173353124 20:42263000-42263022 GAGAACATCTCAGCAGAGAGAGG + Intronic
1173480910 20:43398600-43398622 GAGAAAAGCAAAGCACAGAAAGG - Intergenic
1174003726 20:47393685-47393707 AAGGGCAGCACAGCAGAGAAGGG + Intergenic
1174212145 20:48888249-48888271 GAGAATAGCACGGGAAAGACTGG + Intergenic
1174220850 20:48953973-48953995 GAAAACAGCACAGCTGACAACGG - Intronic
1174227472 20:49013764-49013786 GAGAACAACAGAGAAGAGAGTGG - Intronic
1174950893 20:55040620-55040642 AAGAATAGCACAGGAAAGACGGG - Intergenic
1175408494 20:58750866-58750888 GAGAACAGCACAAGAAAGACCGG - Intergenic
1175732832 20:61365691-61365713 GAGTCCAGCACAGCAGAGAGAGG + Intronic
1175793164 20:61755137-61755159 GAGAATAGCACGGGAAAGACTGG + Intronic
1176065090 20:63190338-63190360 GAGAACATCACGGCAGAAGCCGG + Intergenic
1176814613 21:13586221-13586243 GAGAAAAGCACAACTGGGACTGG + Intergenic
1176971505 21:15271240-15271262 GAGAATAGCACAGGAAAGACCGG - Intergenic
1177059559 21:16353824-16353846 GAGAATAGCACGGGAAAGACCGG - Intergenic
1177504168 21:21999904-21999926 GAGAATAGCACGGGAAAGACTGG + Intergenic
1177704397 21:24682609-24682631 GAGAATAGCACGGGAAAGACAGG + Intergenic
1177740434 21:25147328-25147350 GAGAATAGCATGGCAAAGACTGG + Intergenic
1178481026 21:32979284-32979306 GAGCAGAGCCCAGGAGAGACTGG + Intergenic
1178491590 21:33055968-33055990 CAGGACAGCACAGGAGAGGCTGG + Intergenic
1178663886 21:34529858-34529880 GAGAATAGCACAGGAAAGACTGG - Intronic
1178793547 21:35722482-35722504 GAGAACAGCACAGGAAAGATCGG + Intronic
1179015758 21:37593345-37593367 ATGGACAGCACAGCAGAGAAAGG - Intergenic
1179134201 21:38665492-38665514 GAGAATAGCACGGGAAAGACCGG - Intergenic
1179366085 21:40759608-40759630 GAGGGCAGCACAGAAGAGTCTGG - Intronic
1179567629 21:42259053-42259075 GAGAACAGGACAACTGAGGCAGG - Intronic
1180102184 21:45593567-45593589 GAGAATAGCACAGGAAAGACCGG - Intergenic
1180573525 22:16751484-16751506 GAGAATAGCACAGGAAAGACTGG - Intergenic
1181306956 22:21922543-21922565 GAGGAGAGCGCAGCAGAGCCAGG - Exonic
1181672018 22:24430138-24430160 GAGAAAGGCACAGCTGAGAGTGG + Intronic
1182330031 22:29545209-29545231 GAGAATAGCACGGGAAAGACTGG + Intronic
1182520774 22:30883432-30883454 GAGACCAGCTCAGCAGAGCCTGG + Intronic
1182620160 22:31614439-31614461 GTGAGGAGCACAGCAGGGACCGG - Intronic
1183254341 22:36752629-36752651 GAGACCAGGAGAGCAAAGACAGG - Intergenic
1183753324 22:39735148-39735170 GAGAAAAGCAGAGGAGAGGCTGG + Intergenic
1184571459 22:45327624-45327646 CAGGAAAGCACGGCAGAGACGGG - Intronic
1184835169 22:47016686-47016708 GAGGACAGCAGGGCAGACACAGG - Intronic
1185024997 22:48403759-48403781 GCGGACAGCACAGCAGGGAAGGG + Intergenic
949363275 3:3254218-3254240 CAGAACAGCACAGGAAAGACTGG + Intergenic
949934534 3:9106588-9106610 GAGAATAGCACGGGAAAGACTGG - Intronic
950179983 3:10904597-10904619 GGGAGCAGCTCAGCAGAGAAAGG - Intronic
950646980 3:14383123-14383145 GGGAACAGCACTGCAGAAAGAGG + Intergenic
950696075 3:14702270-14702292 GAGAATAGCACGGGAAAGACCGG + Intronic
950953236 3:17023447-17023469 AAGAATAGCACAGGAAAGACTGG - Intronic
951358812 3:21701381-21701403 GAGAATAGCACGGGAAAGACTGG + Intronic
951765802 3:26197300-26197322 GAGGAAAGGACAGCAGAGAAAGG + Intergenic
951802524 3:26611993-26612015 AAGAATAGCACAGGAAAGACTGG - Intergenic
952195584 3:31072477-31072499 GATAATAGCACAGGAAAGACTGG - Intergenic
952715233 3:36473184-36473206 AAGAATAGCACAGGAAAGACCGG + Intronic
953042022 3:39264245-39264267 GGGCACAGCACAGCAGTGCCAGG + Exonic
953151870 3:40332353-40332375 GAGAGGAGAACATCAGAGACAGG + Intergenic
954441640 3:50525435-50525457 GGGCACAGCACAGCAGAGGCGGG + Intergenic
954681058 3:52346222-52346244 GAGGACAGGACAGCAGAAGCAGG - Intronic
954707565 3:52489173-52489195 GAGAACAGAACAGCACGGCCGGG - Intronic
954732482 3:52676367-52676389 GAGAATAGCACGGGAAAGACTGG - Intronic
954980348 3:54740111-54740133 GAGAAAAGGACACCAAAGACAGG + Intronic
955052649 3:55427530-55427552 GATAACAGCACAGCAAGCACAGG + Intergenic
955128879 3:56143443-56143465 GAGAACAGCATGGGAAAGACTGG - Intronic
955943929 3:64172991-64173013 GATAACAGAATAGCACAGACTGG - Intronic
956184859 3:66552769-66552791 AAGAACAGCACAGTACTGACTGG - Intergenic
956185545 3:66559092-66559114 AAGAACAGCACGGGAAAGACTGG + Intergenic
956412266 3:68991969-68991991 GAGAATAGCATAGGAAAGACTGG + Intronic
956503401 3:69911078-69911100 GAGAATAGCACGGGAAAGACTGG - Intronic
956910173 3:73808499-73808521 GAGAATAGCATAGGAAAGACTGG - Intergenic
957312685 3:78540744-78540766 AAGAATAAGACAGCAGAGACTGG - Intergenic
957703104 3:83743932-83743954 GAGAACAGCACAGTAGTAATTGG - Intergenic
957762040 3:84571859-84571881 GAGAATAGCACAGAAAAGACTGG + Intergenic
958525072 3:95246694-95246716 GAGAACAGCACACGAAAGACTGG - Intergenic
959149831 3:102595329-102595351 GATAAAGACACAGCAGAGACTGG + Intergenic
959172392 3:102859253-102859275 GAGAACAGCATGGGAAAGACTGG + Intergenic
959225651 3:103580470-103580492 GAGAAAAGCACAGAAGATAAAGG - Intergenic
959695869 3:109247941-109247963 GAGAACAGCACAAGAAAGACAGG + Intergenic
959905988 3:111712019-111712041 GAGAAAAACACAGCAGACAGAGG + Intronic
960148921 3:114231887-114231909 GAGGGCTTCACAGCAGAGACTGG - Intergenic
960496878 3:118384954-118384976 GAGAATAGCACAGGAAAGACTGG - Intergenic
960984030 3:123260262-123260284 GAGAACAGCACAGTAAAAACAGG + Intronic
961135566 3:124507020-124507042 GCTATCAGCACAGCAGAGAAAGG - Intronic
961314604 3:126026061-126026083 GAGACCTGCAGAGCAGGGACAGG + Intronic
961330247 3:126134162-126134184 CAGCTCAGCACAGCAGAGGCTGG - Intronic
961458076 3:127034052-127034074 GAGGACAGCTGAGCAGGGACCGG + Exonic
961718210 3:128873332-128873354 GAAACCAGGACAGCAGAGATGGG - Intergenic
961783945 3:129338113-129338135 GAGAATAGCACAGGGAAGACTGG - Intergenic
962033747 3:131629167-131629189 GAGAATAGCACGGGAAAGACTGG + Intronic
962410475 3:135137210-135137232 GAGAGGAGCAAAGCAGAGCCAGG + Intronic
962569656 3:136700091-136700113 TAGAACAGCACAGAGGAGAAAGG - Intronic
962644581 3:137423797-137423819 GAGAATAGGACAGGAAAGACCGG - Intergenic
962769812 3:138601825-138601847 GAGAATAGCACAGCAAAGACTGG - Intergenic
963095627 3:141536323-141536345 GAGAATAGCACAGGAAAGACTGG + Intronic
963261964 3:143201967-143201989 GTGACCAGCACAGCAGAGGCTGG - Intergenic
963280933 3:143384198-143384220 GAGAACAGCAGTGTAGAGAGGGG + Intronic
963339904 3:144021230-144021252 AAGAATAGCACAGGAAAGACTGG + Intronic
963394435 3:144714552-144714574 GAGAATAGCACGGGAAAGACTGG + Intergenic
963553101 3:146749877-146749899 AAGAAGAGCATAGCAGACACTGG - Intergenic
963964469 3:151350182-151350204 AAGAAGAGCACCACAGAGACAGG + Exonic
964202561 3:154134492-154134514 GAGAACAGCACAGGAAAGACTGG + Intronic
964385511 3:156143386-156143408 GAAACCACCAGAGCAGAGACGGG + Intronic
964479344 3:157126604-157126626 GAGCTGAGCACAGCAGAGAAAGG + Intergenic
964589330 3:158342357-158342379 GAGAATAGCACGGGAAAGACTGG - Intronic
964785139 3:160388171-160388193 CATAAAAGCACAGCAGAGAATGG + Intronic
965087051 3:164112943-164112965 GAGAATAGCACAGGAAAGACAGG + Intergenic
966838829 3:184071403-184071425 GAGAATAGCACAGGAAAGACTGG + Intergenic
966948562 3:184795629-184795651 GGGAGCAGCAGAGCAGAGAAGGG - Intergenic
967120510 3:186378562-186378584 GTGAACAGCAGATCAGAGATAGG + Intergenic
967197575 3:187041979-187042001 AAGAAGAGCACTGCTGAGACAGG - Intronic
967229526 3:187324283-187324305 GTGGGCAGCACAGCAGAGAAAGG - Intergenic
967300435 3:188007105-188007127 GAGAGCAGAGCAGCAGAGCCTGG - Intergenic
967413993 3:189196592-189196614 GAGAACAGCATGGAAAAGACTGG + Intronic
967439631 3:189491712-189491734 CAGAAAAGCAAAGCAGTGACAGG - Intergenic
967449882 3:189612304-189612326 GAGAATAGCACAGGAAAGACTGG - Intergenic
967450163 3:189614228-189614250 GAGAATAGCACAGGAAAGACTGG - Intergenic
967754123 3:193149413-193149435 TAGAACAGAACAGCAGAGAAAGG + Intergenic
968709924 4:2107023-2107045 TAGAATAGCACAGAAAAGACAGG - Intronic
969149959 4:5160947-5160969 GAGAACAGCATGGCAGGTACAGG + Intronic
969194770 4:5551791-5551813 AAGAACAGCACGGGAAAGACCGG - Intronic
969658687 4:8513362-8513384 GAGAACAGCACAGGAAAGACTGG + Intergenic
969843658 4:9902179-9902201 GAAAACAGTAGAGCAGAGAAAGG - Intronic
970217911 4:13778890-13778912 GAGAATAGCACAGGAAAAACTGG + Intergenic
970322455 4:14888260-14888282 AAGACCAGCACAGGAAAGACCGG + Intergenic
970707873 4:18826720-18826742 AAGAACAGCACGGGAAAGACCGG + Intergenic
970978900 4:22074269-22074291 GAGAATAGCACAGGAAAGACTGG - Intergenic
971037922 4:22715308-22715330 CAGAAGACAACAGCAGAGACTGG + Intergenic
971455003 4:26835893-26835915 GAGAACAGGAAAGAAGAGAATGG - Intergenic
971571627 4:28219151-28219173 GAGACCAATACAGCAGAGAAAGG + Intergenic
971793786 4:31200719-31200741 GAGAACAACACATGAAAGACTGG + Intergenic
971940386 4:33207411-33207433 GAGAATAGCACAGGAAAGACTGG - Intergenic
972403419 4:38725579-38725601 GATAAAAGCACACCGGAGACTGG + Intergenic
972882385 4:43441839-43441861 GGGAAAAGCATAGCAGAGAAAGG - Intergenic
973718289 4:53699587-53699609 GAGAATAGCACGGGAAAGACTGG + Intronic
974013175 4:56625559-56625581 GAGAATAGCACGGGAAAGACTGG - Intergenic
974051619 4:56947144-56947166 GAGTACAGCCCAGGAGAGTCTGG - Intergenic
974170028 4:58254595-58254617 GAGAGCAGAAGTGCAGAGACTGG - Intergenic
974388559 4:61234360-61234382 GAGAATAGCATAGGAAAGACCGG + Intronic
974592037 4:63964162-63964184 GAGAATAGCACAGGAAAGACTGG - Intergenic
974825979 4:67131603-67131625 GAAAACAGGATAACAGAGACTGG + Intergenic
975311867 4:72912581-72912603 GAGAATAGCACAGGAAAGACGGG - Intergenic
975312157 4:72914463-72914485 GAGAATAGCACAGGAAAGAATGG - Intergenic
976200482 4:82573114-82573136 TATAACAGAACAGCACAGACTGG + Intergenic
976494910 4:85716917-85716939 CAGAAGAGCACAAGAGAGACAGG - Intronic
976660400 4:87534719-87534741 GAGAAGAGGGAAGCAGAGACTGG - Intergenic
976811922 4:89107802-89107824 GAGAATAGCACAGGAAAGACTGG - Intronic
977025951 4:91820146-91820168 AAGAATAGCACAGGAAAGACTGG + Intergenic
977163205 4:93662277-93662299 GAGAACAACAAAGCAGAAAGAGG - Intronic
977189264 4:93978714-93978736 GAGAACAGTACAGGAGAGACCGG - Intergenic
977669984 4:99684435-99684457 GAGAATAGCACAGAAAAGACTGG - Intergenic
977943607 4:102884450-102884472 GAAAAGAGCCCAGCAGAGGCAGG + Intronic
978284348 4:107058017-107058039 GAGAATAGCACAGGAAAGACTGG + Intronic
979795214 4:124837979-124838001 GAGAATAGCACAGGAAAGACTGG + Intergenic
980071328 4:128245409-128245431 GAGAATAGCACAGGAAAGACTGG - Intergenic
980083464 4:128368395-128368417 GAGAATAGCACAGGAAAGACAGG + Intergenic
980216663 4:129860688-129860710 CCAAACAGCACAGCAGACACTGG - Intergenic
980416653 4:132497026-132497048 GAGAACAGAACACCAAAGAGAGG - Intergenic
980548634 4:134303541-134303563 AAGAACAGAACAACAGACACTGG - Intergenic
980828180 4:138096902-138096924 AGTAGCAGCACAGCAGAGACTGG - Intergenic
981040900 4:140220569-140220591 GAGCACAGCACAGCAGAAACAGG + Intergenic
981366331 4:143907851-143907873 GGAAACAGAACAACAGAGACAGG - Intergenic
981376437 4:144021628-144021650 GGAAACAGAACAACAGAGACAGG - Intergenic
981386950 4:144142972-144142994 GGAAACAGAACAACAGAGACAGG - Intergenic
981861638 4:149362478-149362500 GAGAATAGCACAAGAAAGACTGG - Intergenic
982481026 4:155909950-155909972 GAGAAGAGCAGAGAAGAGAAAGG - Intronic
982679253 4:158409218-158409240 GAGAATAGCACGGGAGAGACTGG - Intronic
982948758 4:161663041-161663063 GAGAATAACACAGGAAAGACCGG + Intronic
982966224 4:161912413-161912435 GAGAATAGCACAGGAAAGACTGG - Intronic
982968762 4:161951039-161951061 GAGAACAGCACGGAAAACACTGG - Intronic
983067991 4:163234905-163234927 GAGAATAACACAGGAAAGACTGG + Intergenic
983463050 4:168049828-168049850 GAGAATAGCACAGGAAAGACTGG - Intergenic
983920887 4:173343258-173343280 GAGCACAGCATTGCAGAGGCCGG + Intergenic
984411385 4:179403041-179403063 AAGATCATCACTGCAGAGACAGG + Intergenic
984964544 4:185128607-185128629 GGGAAGAGCGCAGCAGAGGCGGG + Intergenic
985503419 5:263319-263341 GAGAACAACACATCACACACAGG + Intergenic
985734274 5:1568966-1568988 GAGAACAACACATCACACACAGG - Intergenic
985888697 5:2699605-2699627 GAGAAAGGCAGAGCAGAGACGGG + Intergenic
986263919 5:6176325-6176347 AAGAGAAGCAGAGCAGAGACAGG + Intergenic
986298440 5:6458996-6459018 GAGAAGAGCACAGCAAAGCCAGG + Intronic
986559247 5:9044281-9044303 GAAACCACCACAGCAGAGAAAGG + Intronic
987457320 5:18163629-18163651 AAGAATAGCACAGAAAAGACTGG + Intergenic
987469919 5:18315307-18315329 AAGAACAGAACAACAGACACCGG - Intergenic
988009068 5:25460692-25460714 GAGAATAGCACAGGAAAGACCGG - Intergenic
988009354 5:25462625-25462647 GAGTATAGCACAGGAAAGACTGG - Intergenic
988026826 5:25705494-25705516 AATAACAGCACAGCAGTGATTGG - Intergenic
988624124 5:32852664-32852686 GAGCAGAGGCCAGCAGAGACGGG - Intergenic
988900754 5:35729770-35729792 GAGAACAGCATGGTAAAGACTGG - Intronic
989212366 5:38868473-38868495 GAGAATAGCACAGAAAAGACCGG - Intronic
989532695 5:42525749-42525771 GAGAACAGCACAGGAAAGACTGG - Intronic
989750798 5:44890727-44890749 GAGAACAGCACAGGAAAGACTGG - Intergenic
989777985 5:45232318-45232340 GAGAATAGCACAGGAAAGACTGG + Intergenic
990264728 5:54062456-54062478 AAGAACAGCGCAGGAAAGACTGG - Intronic
990268530 5:54107189-54107211 GAGAATAGCACAGGAAAGACTGG + Intronic
990350448 5:54910516-54910538 CAGAACAGCACTGCAGACAGTGG - Intergenic
990508842 5:56471539-56471561 GGGCCCAGCACAGCAGATACAGG - Intronic
990524486 5:56611317-56611339 GAGAACAGCATGGGAAAGACTGG + Intergenic
991006786 5:61835710-61835732 GAGAATAGCACAGGAAAGACTGG - Intergenic
991195268 5:63924751-63924773 GAGAATAGCATGGCAAAGACTGG - Intergenic
991203167 5:64017927-64017949 GAGAACAGTGGAGCAGAGTCTGG + Intergenic
991404031 5:66284264-66284286 GAGAACAACACAACTGAGAAAGG + Intergenic
991520382 5:67490728-67490750 GAGAATAGCACGGGAAAGACCGG + Intergenic
992398247 5:76387177-76387199 GGGAAAAGCAAGGCAGAGACAGG + Intergenic
992475575 5:77098647-77098669 TATAACAGAACACCAGAGACTGG + Intergenic
992479566 5:77137266-77137288 CAGAACACCCCAGGAGAGACTGG + Intergenic
993861327 5:93140400-93140422 GGGAACAGTGCAGAAGAGACTGG - Intergenic
994615062 5:102093463-102093485 GAGAATAGCACAGGAAAGACTGG + Intergenic
995312547 5:110730700-110730722 GAGAATAGCACAGGAAAGACTGG + Intronic
995680548 5:114713682-114713704 GAGAACAGCACAGGAAAGACCGG + Intergenic
995770161 5:115660648-115660670 GAGGAAAGCAGAGCAGAGATGGG + Intergenic
996172837 5:120316145-120316167 GAGAACAGCACAGGAAAGATTGG + Intergenic
996238448 5:121164712-121164734 GAGAATAGCACAGGAAAGACTGG - Intergenic
996460329 5:123733484-123733506 AAGAACAGCACGGGAAAGACCGG - Intergenic
996490233 5:124086144-124086166 GAGAATAGCACGGGAAAGACGGG - Intergenic
996527015 5:124490314-124490336 GAGAACAGCATAGGAAAGACTGG + Intergenic
996617539 5:125458819-125458841 GAGAATAGCACAGGAAAGATGGG - Intergenic
997081565 5:130745938-130745960 GAGAATAGCACAGGAAAGACCGG - Intergenic
997181280 5:131831875-131831897 AAGAACAGCATAGGAAAGACTGG + Intronic
997477193 5:134150449-134150471 GAAAACAGCACAGAACAGAAGGG + Exonic
998723127 5:144976366-144976388 GAGAATAGCACAGGAAAGACTGG - Intergenic
998989843 5:147803347-147803369 GAGAATAGCACAGGAAATACTGG - Intergenic
999154260 5:149447071-149447093 CAGGACAGCAGAGCAGAGAATGG - Intergenic
999381069 5:151121898-151121920 GAGGACAGCAGAGCCAAGACAGG + Intronic
999517696 5:152317500-152317522 GAAAACACCACTGCAGTGACAGG - Intergenic
999590715 5:153142874-153142896 GAGTGCAGCACAGAAGTGACAGG + Intergenic
999805035 5:155073214-155073236 GAGAACAGCATGGGAAAGACCGG + Intergenic
1000030635 5:157398309-157398331 GAGAACAGCAGGGGAAAGACTGG + Intronic
1000373988 5:160562392-160562414 GAGAACAAGACAGCAAAGAAGGG - Intergenic
1000725915 5:164770488-164770510 GACAACAACACAACAGAAACAGG - Intergenic
1000750960 5:165096773-165096795 GAGAATAGCACAGGAAAGAGAGG + Intergenic
1001966639 5:175914345-175914367 TTGAACAGCACAGCAGAGGGAGG + Intergenic
1002250308 5:177924859-177924881 TTGAACAGCACAGCAGAGGGAGG - Intergenic
1002300828 5:178256531-178256553 GAGAACAGCACTCCAGGAACGGG + Intronic
1003373142 6:5548144-5548166 GAGAATAGCACAGGAAAGACCGG + Intronic
1003751159 6:9057872-9057894 GAGAAGAGGAGAGCAGAAACTGG + Intergenic
1004059362 6:12177131-12177153 AAGAAGAGAACAGCAGACACTGG + Intergenic
1004192012 6:13472128-13472150 CAGAATAGCACAGGAAAGACCGG + Intronic
1004699381 6:18065030-18065052 GAGAATAGCACAGGAAAGACTGG + Intergenic
1004785697 6:18965217-18965239 GAGAATAGCACAGGAAAGACCGG + Intergenic
1004899852 6:20183984-20184006 GAGAATAGCATAGGAAAGACTGG + Intronic
1004999577 6:21227512-21227534 GGGCACAGCACAATAGAGACAGG + Intronic
1005194466 6:23266802-23266824 GAGAAGAACACCACAGAGACGGG + Intergenic
1006099357 6:31676576-31676598 GAGGACAGCTCAGCAGAGCTGGG + Intergenic
1006344015 6:33465369-33465391 GAGAATAGCACGGGAAAGACTGG - Intergenic
1006696999 6:35939687-35939709 GAGAATAGCACAGGAAAGACTGG - Intergenic
1008497130 6:52144926-52144948 AAGGACAGCAGAGCAGAGTCAGG - Intergenic
1008729820 6:54467834-54467856 GAGAATAGCACAGAAAAGACTGG - Intergenic
1008997273 6:57673440-57673462 GAAAATACCACAGCAGAGGCAGG - Intergenic
1009396758 6:63207687-63207709 AAGAATAGCACAGGAAAGACCGG - Intergenic
1009517850 6:64642518-64642540 GACAAGAGCACAGCACAGAAAGG - Intronic
1011495996 6:87937139-87937161 GAGAATAGCACAGGAAAGACAGG + Intergenic
1011626646 6:89288519-89288541 GAGAACTGCACAGCTGAGCCCGG + Intronic
1011807577 6:91089417-91089439 GAGAACAGAACAGGAGAGGTGGG - Intergenic
1014157965 6:118134134-118134156 GAAAACAGCACATCAGAAAAAGG + Intronic
1014576800 6:123083285-123083307 GAGAATAGCACGGGAAAGACTGG + Intergenic
1014742284 6:125159944-125159966 GAGAACAGCATGGGAAAGACCGG - Intronic
1014947097 6:127511887-127511909 GAGATAAGCACAGCAATGACAGG + Intronic
1015815541 6:137207563-137207585 GAAAATAGCACAGGAAAGACTGG - Intronic
1016190844 6:141261864-141261886 TAGAACAGCTCAGAAGAGACAGG - Intergenic
1016335720 6:143002987-143003009 GATAATAGCACAGGAAAGACCGG + Intergenic
1016460245 6:144274204-144274226 GAGAATAGCACAGGAAAGACCGG + Intergenic
1016643624 6:146378837-146378859 AAGAACAGCACAGGAAAGACTGG - Intronic
1016825180 6:148381931-148381953 TAGAAGAGCACAGAAGAGGCTGG - Intronic
1017980716 6:159399080-159399102 GGGAACCACACAGCAGGGACAGG + Intergenic
1018358437 6:163041412-163041434 GAGAACAGCATGGGAGAAACTGG - Intronic
1018509737 6:164512333-164512355 GAGAATAGCACGGGAAAGACTGG - Intergenic
1018872337 6:167792805-167792827 GAGAACAGCACAGGAAAGACCGG - Intronic
1018997710 6:168722877-168722899 GAGAATAGCACTGGAAAGACAGG - Intergenic
1019093498 6:169560161-169560183 GAGAACAGCACGGGAAAGACAGG - Intronic
1019101806 6:169637177-169637199 CAGAACAGGAAAGGAGAGACAGG - Intronic
1019115394 6:169757061-169757083 GAGAATAGCACGGGAAAGACCGG + Intronic
1020003402 7:4768497-4768519 CGGAAAAGCCCAGCAGAGACAGG - Exonic
1020345205 7:7154770-7154792 GAGAATAGCACGGGAAAGACTGG - Intergenic
1020497519 7:8875096-8875118 AAGAAGAGAACAGCAGACACTGG + Intergenic
1020547716 7:9554547-9554569 GAGAATAGCACATGAAAGACTGG - Intergenic
1021501626 7:21338242-21338264 GAGAATAGCACAGGAAATACAGG - Intergenic
1021682293 7:23146053-23146075 GAGAACAGCACAGAAAAGGATGG - Intronic
1021823873 7:24527738-24527760 GAGAATAGCACAGGAAAGGCCGG + Intergenic
1022391125 7:29945332-29945354 GAGAATAGCACAGGAAAGACCGG - Intronic
1022678527 7:32522838-32522860 GAGAATAGCACGGAAAAGACTGG - Intronic
1023784055 7:43687951-43687973 GAGAATAGCACAGCAAAGACTGG - Intronic
1023914784 7:44580993-44581015 GAGATCAGCTCTGCAGAGAATGG - Intronic
1024058151 7:45679351-45679373 GAGAATAGCTCAGCAAAGTCTGG + Intronic
1024218404 7:47267260-47267282 TAGGACAGCACAGCAGACATTGG - Intergenic
1024503140 7:50135033-50135055 GAGAGAAGCTCAGCAGAGAAAGG - Intronic
1025051445 7:55737626-55737648 GAGCAGAGCATATCAGAGACGGG + Intergenic
1025285638 7:57658516-57658538 GAGAATAGCACAGGAAACACTGG - Intergenic
1025300502 7:57816247-57816269 GAGAATAGCACAGGAAAGACTGG + Intergenic
1025708437 7:63887509-63887531 CAAAACAGCACAGAAGATACAGG - Intergenic
1026532718 7:71213166-71213188 GAGAATAGCACAGGAAAGACTGG - Intronic
1026666419 7:72343667-72343689 GAGAAAAGGTAAGCAGAGACAGG + Intronic
1026682243 7:72475833-72475855 GAGAACAGCACAAGAAAGACCGG - Intergenic
1027922718 7:84416208-84416230 GAGAATAGCACTGGAAAGACTGG - Intronic
1028253239 7:88559800-88559822 AAGAATAGCACGGCAAAGACGGG - Intergenic
1029903716 7:104069811-104069833 AAGAATAGCACAGGAAAGACCGG + Intergenic
1030583523 7:111388748-111388770 GAGAATAGCACAGGAAAGACCGG + Intronic
1030806678 7:113928645-113928667 GAGAATAGCACTGGAAAGACTGG - Intronic
1030915994 7:115314250-115314272 GAGAACAAAACACCATAGACAGG + Intergenic
1031145867 7:117995968-117995990 GAGACTAGCACAGGAAAGACTGG - Intergenic
1031288833 7:119907440-119907462 GAGAACAGCACAGGAAAGACCGG + Intergenic
1031299056 7:120041585-120041607 AATAACAGCACAGGAAAGACTGG - Intergenic
1031658232 7:124385482-124385504 GAGAATAGCACAGGAAAGACTGG - Intergenic
1033147736 7:138885448-138885470 GTGGCCAGCACAGCAGAGAAGGG - Intronic
1033419865 7:141195934-141195956 AAGAATAGCACAGGAAAGACCGG + Intronic
1033456235 7:141506522-141506544 GAGAATAGCACAGGGAAGACCGG + Intergenic
1033456564 7:141508758-141508780 GAGAATCGCACAGGAAAGACTGG + Intergenic
1033580158 7:142725874-142725896 GAGAATAGCTCAGGAAAGACTGG + Intergenic
1034399859 7:150855128-150855150 GTGAAAAGCACAGCTGAGACAGG + Intronic
1035050215 7:155994386-155994408 GATAGCAGCACAGGACAGACAGG - Intergenic
1035163170 7:156966244-156966266 GAAAACAGAACAGCAATGACTGG - Intronic
1035183177 7:157105584-157105606 GAGAATAGCACAGGAAAGACTGG - Intergenic
1036122390 8:6032630-6032652 TATAACAGAACAGCAGAGACTGG + Intergenic
1036700632 8:11011541-11011563 GAAAACAGCAGAGAAGAAACAGG + Intronic
1037167245 8:15846065-15846087 AAGAATAGCACAGGAAAGACTGG + Intergenic
1037524872 8:19714942-19714964 AAGAAAAGAACAGCAGACACTGG - Intronic
1037870798 8:22494364-22494386 AAGAATAGCACAGGAAAGACCGG + Intronic
1038328255 8:26588591-26588613 TAGCACCGCACAGCAGAGATGGG + Intronic
1038575404 8:28700514-28700536 AAGAACTGCACCCCAGAGACAGG - Intronic
1038752810 8:30312675-30312697 AAGAATAGCACAGGAAAGACTGG - Intergenic
1038940714 8:32301753-32301775 GAGAACAGTGCAGGAAAGACCGG + Intronic
1039392139 8:37189925-37189947 GAGAAGAGCAGAGAAGAGAAAGG + Intergenic
1040555350 8:48473193-48473215 GAGGAGAGCACAGGTGAGACGGG + Intergenic
1041466631 8:58163736-58163758 GAGAGCACCACAGCAGGGCCAGG + Intronic
1041731060 8:61063424-61063446 GAGAATAGCATTACAGAGACAGG + Intronic
1041792968 8:61716363-61716385 GAGAATAGCACAGGAAAGACCGG + Intergenic
1041844385 8:62311252-62311274 GAGATAGGCACAGCAGAGACGGG + Intronic
1042022182 8:64379606-64379628 GAAAACAAAACAGCAGAGAGAGG + Intergenic
1042256262 8:66807014-66807036 GGGCACAGCAGAGGAGAGACTGG + Intronic
1042432662 8:68726809-68726831 GAGAATAGCACAGTAAAGATTGG + Intronic
1042466223 8:69132611-69132633 GAGAATAGCACAGGAAAGACTGG + Intergenic
1044303147 8:90608479-90608501 GACAAAAGCACAGGAGAGAATGG - Intergenic
1044664223 8:94619594-94619616 GAGAATAGCACAGGAAAGACTGG - Intergenic
1044930919 8:97251104-97251126 GAGAGGAGCATGGCAGAGACTGG + Intergenic
1045672170 8:104567398-104567420 GAGAATAGCACGGGAAAGACTGG + Intronic
1046126720 8:109919446-109919468 TAGAACAGGACAGAGGAGACAGG + Intergenic
1046175356 8:110568885-110568907 AAGAATAGCACAGGAAAGACTGG + Intergenic
1046454402 8:114439895-114439917 GAGAATGGCACAGGAAAGACTGG - Intergenic
1047218228 8:122896720-122896742 GAGGGCAGCAGAGCAGGGACTGG - Intronic
1047273780 8:123389270-123389292 GAAAACAGCAAAGCACAGGCCGG - Intronic
1047562738 8:126007373-126007395 GAGAATAGCACAGGAAAGATCGG + Intergenic
1047580844 8:126213673-126213695 GAGAAATGCACAGTAGACACAGG + Intergenic
1047668893 8:127123031-127123053 GATTACAGCACTGCTGAGACAGG - Intergenic
1047794794 8:128243561-128243583 GAGAATAGCACAGGAAAGGCTGG - Intergenic
1048091658 8:131247703-131247725 GAGAATAGCACAGGAAAGACTGG - Intergenic
1048163252 8:132039763-132039785 GAGAAGAGCAAAGCAGACAGAGG - Intronic
1048173034 8:132126675-132126697 AAGACCAGGACAGCAGAGATTGG - Exonic
1048923481 8:139251096-139251118 GAGAATAGCATGGGAGAGACTGG - Intergenic
1049006196 8:139857170-139857192 GGGATCAGCACAGCAGAGGAGGG + Intronic
1049040639 8:140110133-140110155 GAGCAGAGCAGAGCAGAGCCTGG - Intronic
1049616937 8:143579643-143579665 GGGAACAGCAGGGCAGAGATGGG + Intergenic
1049977767 9:876169-876191 GAGAACAGCACAACATAGTTAGG + Intronic
1050077542 9:1880812-1880834 GAAAACAGTAAAGAAGAGACAGG + Intergenic
1050091881 9:2023690-2023712 GAGAACAGCAATGCAGATAAAGG - Intronic
1050904963 9:10992800-10992822 AAGAATAGCACAGGAAAGACTGG - Intergenic
1050929171 9:11302255-11302277 AAGAATAGCACAGGAAAGACTGG + Intergenic
1051429998 9:16972065-16972087 GAGACTAGCACAGGAAAGACTGG - Intergenic
1051726208 9:20089811-20089833 CAGAACACCACAGCACAGAGAGG + Intergenic
1051771270 9:20582765-20582787 GAGAATAACACAGGAAAGACCGG + Intronic
1052381681 9:27778417-27778439 GAGAACAGCATGGGAAAGACTGG - Intergenic
1052614646 9:30822042-30822064 GAGCATAGCACAGGAAAGACTGG - Intergenic
1052747991 9:32460051-32460073 AAGAATAGCACAGGAAAGACTGG - Intronic
1052782425 9:32795197-32795219 GACAATAGCACAGGAAAGACGGG + Intergenic
1053784802 9:41646177-41646199 GAGGAAAGCCCAGCGGAGACGGG - Intergenic
1053793324 9:41702440-41702462 GAGAATAGCACAGGAAAGACTGG - Intergenic
1054151854 9:61612390-61612412 GAGAATAGCACAGGAAAGACTGG + Intergenic
1054173528 9:61860122-61860144 GAGGAAAGCCCAGCGGAGACGGG - Intergenic
1054181731 9:61914455-61914477 GAGAATAGCACAGGAAAGACTGG - Intergenic
1054448384 9:65389187-65389209 GAGGAAAGCCCAGCGGAGACGGG - Intergenic
1054471625 9:65543529-65543551 GAGAATAGCACAGGAAAGACTGG + Intergenic
1054664013 9:67720659-67720681 GAGGAAAGCCCAGCGGAGACGGG + Intergenic
1055257757 9:74392624-74392646 GGGAAATCCACAGCAGAGACTGG + Intergenic
1055701200 9:78947647-78947669 AAGAATAGCACAGAAAAGACTGG - Intergenic
1055879672 9:80985510-80985532 GAGATCAGCACATCAGAAAAAGG + Intergenic
1056841198 9:89999361-89999383 CAGAACAGCTCAGCACAGCCTGG - Intergenic
1057040255 9:91842782-91842804 CAGAGCAGCACATCAGTGACAGG - Intronic
1057199484 9:93132639-93132661 GAGAGCAGCCCAGCCCAGACAGG - Intronic
1057316318 9:93971169-93971191 GAGAATAGCACAGGAAAGACTGG + Intergenic
1057438858 9:95067191-95067213 GAGAACCTCACAGCACAGATAGG + Intronic
1058181866 9:101808609-101808631 GAGAATAGCACAGGAAAGACCGG - Intergenic
1058401669 9:104626112-104626134 GAGAATAGCACAGGAAAGACTGG - Intergenic
1058621641 9:106889297-106889319 GAGCACAGCGAAGGAGAGACAGG - Intronic
1059920700 9:119157131-119157153 GAGAATAGCACAGGACAGACTGG - Intronic
1059986145 9:119822578-119822600 GAGAATAGCATGGCAAAGACTGG - Intergenic
1059986432 9:119824510-119824532 GAGAATAGCACAGAAACGACTGG - Intergenic
1060821132 9:126662121-126662143 GCAAACAGCAAAGCAGGGACTGG - Intronic
1060909665 9:127339478-127339500 GAGAATAGCACGGGAAAGACTGG + Intronic
1061341408 9:129984741-129984763 GAGAATAGCACGGGAAAGACCGG - Intronic
1061790253 9:133055365-133055387 GAGATGAGTGCAGCAGAGACGGG + Intronic
1061804587 9:133131014-133131036 GGGAGCAGAACAGCAGAGGCGGG + Intronic
1061868868 9:133509562-133509584 GAGAAGAGAATAACAGAGACAGG + Intergenic
1062617129 9:137402957-137402979 GAGAACAGCATGGGAAAGACCGG + Intronic
1203532745 Un_GL000213v1:163219-163241 GAGAAAAGCACAACTGGGACTGG - Intergenic
1185627331 X:1492088-1492110 GAGAACCACACAGCCCAGACAGG - Intronic
1185775207 X:2797507-2797529 CAGAACAGCCCAGCACAGACAGG - Intronic
1185893504 X:3839727-3839749 CAGAATAGCACAGGAAAGACCGG - Intronic
1185898621 X:3878151-3878173 CAGAATAGCACAGGAAAGACCGG - Intergenic
1185903736 X:3916580-3916602 CAGAATAGCACAGGAAAGACCGG - Intergenic
1186144657 X:6612803-6612825 TATAACAGCACACCATAGACTGG + Intergenic
1186298658 X:8175830-8175852 GAGATTAGCACAGGAAAGACCGG - Intergenic
1186860024 X:13663805-13663827 GAGAACAGCCCAGCATAAACTGG + Intronic
1188631516 X:32368182-32368204 GTGAATAGCACAGTACAGACTGG - Intronic
1188765146 X:34081500-34081522 GAGAATAGCACAGGAAAGACCGG + Intergenic
1188860362 X:35248217-35248239 GAGAACAGCACAAAAAAGACCGG - Intergenic
1188976056 X:36676920-36676942 TAGAACAGCACGGGAAAGACAGG + Intergenic
1189028688 X:37428048-37428070 GAGAACAGCACGGGAAAGACTGG + Intronic
1189028978 X:37429975-37429997 AAGAATAGCACAGGAAAGACTGG + Intronic
1189576896 X:42363656-42363678 GAGAACAGCACAAGAAAGACCGG + Intergenic
1191678968 X:63822055-63822077 GAGAATAGCACGGGAAAGACTGG + Intergenic
1192581707 X:72288401-72288423 GAGAATAGCACGGGAAAGACTGG - Intronic
1193501932 X:82287481-82287503 AAGAAGAGAACAGCAGACACTGG - Intergenic
1193797375 X:85892406-85892428 GAGAATAGCACAAGAAAGACCGG - Intronic
1194139203 X:90188775-90188797 TAGAACAGCAGAACAGAGAGAGG - Intergenic
1194297530 X:92144412-92144434 GAGAATAGCACGGGAAAGACTGG - Intronic
1194566283 X:95493322-95493344 GAGAATAGCACAAGAAAGACCGG - Intergenic
1195062385 X:101208926-101208948 GAAAACAGCAGAGCTGATACAGG + Intergenic
1195210230 X:102647232-102647254 GAGAATAGCACTGGAAAGACTGG + Intergenic
1195563218 X:106310178-106310200 GAGAATAGCACGGGAAAGACTGG + Intergenic
1195745549 X:108113785-108113807 GAGAATAGCACGGGAAAGACTGG + Intronic
1196558508 X:117120218-117120240 TAGAATAGCACAGGAAAGACTGG + Intergenic
1197045484 X:121992251-121992273 AAGAGCAGTACAGCAGACACTGG + Intergenic
1197336313 X:125213278-125213300 CAGAAAAGCACAGGAAAGACCGG + Intergenic
1197511268 X:127371963-127371985 GAGAATAGCACAGGAAAGACTGG + Intergenic
1197914414 X:131519970-131519992 GAGAATAGCACGGGAAAGACTGG - Intergenic
1198423160 X:136487994-136488016 GAGAACAGAACAGAACAGAATGG - Exonic
1198734473 X:139771160-139771182 GAGAACAGCACAGGAAAGACCGG - Intronic
1198871226 X:141178603-141178625 GATTAGAGCACAGCAGAAACTGG - Intergenic
1199113420 X:143960543-143960565 GAGAATAGCGCAGGAAAGACTGG + Intergenic
1199208691 X:145180438-145180460 GAGAATAGCACAGGAAATACTGG - Intergenic
1199319571 X:146422591-146422613 GAGCACAGCACAGCAGTTATGGG + Intergenic
1199325624 X:146494503-146494525 GGGAATAGCACAGGAAAGACTGG - Intergenic
1199925538 X:152459462-152459484 GAGAATAGCACAGGAAAGACTGG - Intergenic
1200484947 Y:3757755-3757777 TAGAACAGCAGAACAGAGAGAGG - Intergenic
1200615102 Y:5369313-5369335 GAGAATAGCACGGGAAAGACTGG - Intronic
1201295160 Y:12455979-12456001 CGGAACAGCCCAGCACAGACAGG + Intergenic
1201437752 Y:13977764-13977786 AAGAAAAGCACAGGAAAGACCGG - Intergenic
1201439352 Y:13991716-13991738 GAGATTAGCACAGGAAAGACCGG - Intergenic
1201445221 Y:14050992-14051014 GAGATTAGCACAGGAAAGACCGG + Intergenic
1201857952 Y:18566225-18566247 GGAAACTGCCCAGCAGAGACAGG + Intronic
1201875369 Y:18754156-18754178 GGAAACTGCCCAGCAGAGACAGG - Intronic
1202169082 Y:22021837-22021859 GGAAACTGCCCAGCAGAGACAGG - Intergenic
1202222279 Y:22564531-22564553 GGAAACTGCCCAGCAGAGACAGG + Intergenic
1202320836 Y:23631130-23631152 GGAAACTGCCCAGCAGAGACAGG - Intergenic
1202549931 Y:26038926-26038948 GGAAACTGCCCAGCAGAGACAGG + Intergenic