ID: 933719114

View in Genome Browser
Species Human (GRCh38)
Location 2:85385650-85385672
Sequence GGTCGTAGATGATGGGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933719107_933719114 11 Left 933719107 2:85385616-85385638 CCAGAGGCCTGACAGGAAGGGCA 0: 1
1: 0
2: 3
3: 30
4: 282
Right 933719114 2:85385650-85385672 GGTCGTAGATGATGGGCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 60
933719106_933719114 12 Left 933719106 2:85385615-85385637 CCCAGAGGCCTGACAGGAAGGGC 0: 1
1: 0
2: 3
3: 19
4: 236
Right 933719114 2:85385650-85385672 GGTCGTAGATGATGGGCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 60
933719109_933719114 4 Left 933719109 2:85385623-85385645 CCTGACAGGAAGGGCAGTAGGAG 0: 1
1: 0
2: 1
3: 28
4: 248
Right 933719114 2:85385650-85385672 GGTCGTAGATGATGGGCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933719114 Original CRISPR GGTCGTAGATGATGGGCCAG AGG Intronic