ID: 933721082

View in Genome Browser
Species Human (GRCh38)
Location 2:85398206-85398228
Sequence CAGCCTGAGGAGGGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1304
Summary {0: 1, 1: 1, 2: 6, 3: 130, 4: 1166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933721068_933721082 0 Left 933721068 2:85398183-85398205 CCCCCACACACCAGCCCTCACCT 0: 2
1: 0
2: 4
3: 74
4: 763
Right 933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG 0: 1
1: 1
2: 6
3: 130
4: 1166
933721071_933721082 -3 Left 933721071 2:85398186-85398208 CCACACACCAGCCCTCACCTCAG 0: 1
1: 0
2: 10
3: 85
4: 922
Right 933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG 0: 1
1: 1
2: 6
3: 130
4: 1166
933721067_933721082 1 Left 933721067 2:85398182-85398204 CCCCCCACACACCAGCCCTCACC 0: 1
1: 0
2: 6
3: 125
4: 1043
Right 933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG 0: 1
1: 1
2: 6
3: 130
4: 1166
933721069_933721082 -1 Left 933721069 2:85398184-85398206 CCCCACACACCAGCCCTCACCTC 0: 1
1: 1
2: 7
3: 82
4: 770
Right 933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG 0: 1
1: 1
2: 6
3: 130
4: 1166
933721066_933721082 11 Left 933721066 2:85398172-85398194 CCTGATCTCACCCCCCACACACC 0: 1
1: 0
2: 2
3: 40
4: 454
Right 933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG 0: 1
1: 1
2: 6
3: 130
4: 1166
933721072_933721082 -10 Left 933721072 2:85398193-85398215 CCAGCCCTCACCTCAGCCTGAGG 0: 1
1: 0
2: 2
3: 56
4: 497
Right 933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG 0: 1
1: 1
2: 6
3: 130
4: 1166
933721070_933721082 -2 Left 933721070 2:85398185-85398207 CCCACACACCAGCCCTCACCTCA 0: 1
1: 0
2: 6
3: 52
4: 544
Right 933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG 0: 1
1: 1
2: 6
3: 130
4: 1166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933721082 Original CRISPR CAGCCTGAGGAGGGGGAGGC TGG Intronic
900093815 1:932295-932317 CAGACGGAGGAGGGGGCTGCAGG - Intronic
900173904 1:1283754-1283776 CAGCCTGTGGAGGGAGGGGGAGG - Intronic
900200097 1:1400742-1400764 CTGCCAGAGGAGTGGGAGGTTGG + Exonic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900404186 1:2485341-2485363 CAGGCAGCGGAGGGGAAGGCCGG + Intronic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
900697503 1:4021367-4021389 CAGGCTGAGTGGGGAGAGGCAGG - Intergenic
900883879 1:5401923-5401945 TAGAGTGAGGACGGGGAGGCGGG - Intergenic
900889012 1:5435762-5435784 GTGCCGGAGGAGGAGGAGGCAGG + Intergenic
900943811 1:5818075-5818097 CACACTGAGGCGGTGGAGGCTGG + Intergenic
901084642 1:6603026-6603048 CAGCCTGCGGAGCCGGGGGCGGG - Intronic
901226066 1:7613703-7613725 CAGCCTGAGGAGAGCGATGGCGG + Intronic
901233946 1:7657352-7657374 CTGCCTGAGAACGGGGAGTCAGG + Intronic
901399779 1:9007846-9007868 CAGCTACAGGAGGCGGAGGCAGG - Intronic
901464690 1:9413634-9413656 CCACCTGAGCAGGGTGAGGCCGG + Intergenic
901575718 1:10199159-10199181 TAGCCTTATAAGGGGGAGGCAGG - Intergenic
902237040 1:15064161-15064183 CAGAGTGAGGAGGGGGCTGCAGG + Intronic
902289947 1:15429151-15429173 CAGCCTGGGAAGGGGCTGGCAGG - Exonic
902371274 1:16008553-16008575 GAGGCCAAGGAGGGGGAGGCGGG + Exonic
902395331 1:16129378-16129400 CAGCCTCTGGAGTGGGAGGCGGG + Intronic
902512895 1:16975779-16975801 CAGCCTCAGGTGGGTGAGGCTGG - Intronic
902568721 1:17332802-17332824 CAGGCTGGGGAGGGGGTGGTCGG + Intronic
902622523 1:17658842-17658864 CTCCCTGAGGAGGGGGATCCTGG + Intronic
902630411 1:17701384-17701406 AAGCCTGAGGATGCGGAGGGAGG + Intergenic
902642100 1:17773625-17773647 TAGCCTGATGAAGAGGAGGCGGG + Intronic
902675987 1:18008858-18008880 GAGCCTGAGAAGGTCGAGGCTGG + Intergenic
903182793 1:21613497-21613519 CAGCCTCAGGATAGGGCGGCAGG + Intronic
903323587 1:22556618-22556640 AAGCTTGGGGAGGGAGAGGCGGG + Intergenic
903360572 1:22774405-22774427 CAGCCAGAGCAGGAGGAGTCAGG + Intronic
903410498 1:23139483-23139505 TAGGCTGAGGAGGGAGAGGAAGG - Intronic
903639329 1:24847990-24848012 CAGCAGGAGGTGGGGGATGCAGG - Intergenic
903724347 1:25430142-25430164 CAGCCTGTGGACGTGGAGCCCGG + Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
903858623 1:26352037-26352059 GAGGCTGAGGAGGGGGCGGGGGG + Intronic
904260258 1:29283879-29283901 CACCCTGGGGAGGGAGAGGTCGG + Intronic
904285056 1:29448698-29448720 GAGGCAGAGAAGGGGGAGGCTGG - Intergenic
904315287 1:29656168-29656190 CCTCCTGAGGTGGGGGAGGCAGG - Intergenic
904335962 1:29798281-29798303 CAGGCTGGGGAAGAGGAGGCAGG - Intergenic
904450037 1:30605234-30605256 CAGCCTGAGGTGGGGAAGTTGGG - Intergenic
904575156 1:31500798-31500820 AAGACTCAGAAGGGGGAGGCTGG - Intergenic
904683000 1:32241637-32241659 GAGCGTCAGGAGGGGCAGGCTGG + Intergenic
904744614 1:32703036-32703058 CAGCCTGGGAGGGTGGAGGCAGG + Exonic
904766583 1:32853358-32853380 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
904929208 1:34073006-34073028 CAGGCTTTGGAGTGGGAGGCTGG - Intronic
905037289 1:34926439-34926461 CAGACTGGGGAGGGGCAGGGTGG + Intronic
905224881 1:36472472-36472494 GAGCCTGAGGTGGTGGGGGCAGG - Intronic
905581151 1:39083185-39083207 CAGCATGAGGATGGGGTGGGGGG - Intronic
905629731 1:39511892-39511914 GAGACTGAGGACGGTGAGGCTGG + Exonic
905668028 1:39774298-39774320 GAGACTGAGGACGGTGAGGCTGG - Exonic
906048409 1:42850995-42851017 CTGCCTGAGGAAGGGGAAGGGGG + Exonic
906223613 1:44103264-44103286 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
906280416 1:44549631-44549653 CAGCAGGAGGAAGGGGAGGAAGG - Intronic
906288338 1:44602978-44603000 CGGCCCGAGGAGGAGGAGGAGGG - Intronic
906391854 1:45424312-45424334 AAGGCTGTTGAGGGGGAGGCCGG + Intronic
906465117 1:46071580-46071602 CAGACTCAGGAGGCTGAGGCAGG + Intronic
906636991 1:47416433-47416455 GAGCCAGAGGAGGCGGCGGCTGG + Exonic
906652434 1:47522199-47522221 CAGGCTGAGGATGGGGTGGCAGG - Intergenic
906660458 1:47578070-47578092 CAGGCAGAGGAGGGGTTGGCAGG - Intergenic
907132943 1:52112966-52112988 TAGCCTCAGGAGGCTGAGGCAGG - Intergenic
907143585 1:52211591-52211613 CAGCCTCAGGAGGCTGAGGCCGG + Intronic
907246890 1:53114468-53114490 CAGCCTGTAGGGTGGGAGGCTGG - Intronic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
907409885 1:54276362-54276384 CAGCCTGAGGAGGCTGAGGTGGG + Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907797533 1:57732408-57732430 CAGCCTGAGCAGGCGGAGAGAGG + Intronic
908131201 1:61077136-61077158 CAGCCTGCGGCGGAGGGGGCAGG - Intronic
908168028 1:61477271-61477293 CAGCCTGAGCAGGGTGATGTAGG + Intergenic
908375974 1:63541674-63541696 CAGCCTCAGGAGGCTGAGGTAGG - Intronic
908574926 1:65449449-65449471 CAGCCGCAGGAAGGGTAGGCTGG + Intronic
908766096 1:67555728-67555750 CAGCGTGAGGAGGGAGGGGAGGG + Intergenic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
910421548 1:87069082-87069104 CAGGCTGAGGAGGAAGAGGTGGG + Intronic
911275382 1:95853093-95853115 CAGCCTGAGGAGGGGGCTCCAGG - Intergenic
911704762 1:100998395-100998417 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
912806063 1:112758105-112758127 CAGCCTGAGGGAGGGCAGGGTGG - Intergenic
913217075 1:116629573-116629595 GAGCCTGAAGTGGGGGAGGGGGG + Intronic
913671111 1:121097865-121097887 CAGCCGGAGGCGGCGGCGGCAGG + Intergenic
914022878 1:143885286-143885308 CAGCCGGAGGCGGCGGCGGCAGG + Intergenic
914661365 1:149793230-149793252 CAGCCGGAGGCGGCGGCGGCAGG + Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915307373 1:154988361-154988383 AAGCCCTAGGAGGGGAAGGCTGG + Exonic
915482596 1:156197254-156197276 CAGGCTGAGGCTGGGGAGGAGGG + Intronic
915527840 1:156487175-156487197 CAGCATGAGGCGGGGGTGGGGGG - Intronic
915585984 1:156844265-156844287 CTGCCAGAGGAGGAGGATGCTGG - Exonic
915832061 1:159140469-159140491 GAAGCTGAGGTGGGGGAGGCGGG - Intronic
915887479 1:159738593-159738615 TAGACTGAGGAAGGGGAGGAAGG - Intergenic
916159734 1:161897328-161897350 CAGGCTGAGGCGGGGGTGGGTGG + Intronic
916487484 1:165272468-165272490 CAGACTGAGGGGGAAGAGGCAGG - Intronic
916716874 1:167454281-167454303 GAGCCACGGGAGGGGGAGGCTGG + Intronic
917311775 1:173686115-173686137 CAGCCTGAGGAGAGTCAGGAGGG + Intergenic
917808503 1:178635544-178635566 CAGACTGGGGAGGCTGAGGCGGG + Intergenic
917812729 1:178675391-178675413 CACCCTCAGGAGGCTGAGGCAGG + Intergenic
917843739 1:179003265-179003287 CAGCCTAAGCAGGGGCAGGCAGG + Intergenic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
919746935 1:201014552-201014574 CGGGCTTAGGAGGGGGAGGATGG + Intronic
919939464 1:202276362-202276384 CAGCCAGAGGTGGCGGAGGGAGG - Exonic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920052370 1:203171771-203171793 CAGCCTGTGGATGGGCAGGTGGG - Intronic
920376701 1:205512592-205512614 GAGTGTGAGGAGGGAGAGGCGGG + Intronic
920408764 1:205741050-205741072 CCGCCTCAGGAGGCCGAGGCGGG + Intronic
920512254 1:206559875-206559897 TGGACTGAGGAGGGTGAGGCAGG + Intronic
920693317 1:208163371-208163393 CAGCCTGGGCTGGGGGAGGGAGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
922013951 1:221623833-221623855 CAGCCTTGGGAAGCGGAGGCAGG - Intergenic
922099740 1:222470777-222470799 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
922416676 1:225428242-225428264 CTGCCTGGGGGCGGGGAGGCCGG + Intronic
922680790 1:227593558-227593580 CAGTCTGAGGAGGGTCAGGAGGG + Intronic
922690136 1:227682546-227682568 CAGTCTGAGGAGGGTCAGGAGGG - Intergenic
922723853 1:227913607-227913629 AAGGCTGAGGAGGAGGAGGGAGG + Intergenic
922735305 1:227975473-227975495 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
922801614 1:228367200-228367222 CGGCTTGAGGAGGGGCAGGCAGG + Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
922932584 1:229402061-229402083 CATCCTTATGAGAGGGAGGCAGG - Intergenic
923052010 1:230395846-230395868 GAGCATGAAGAGGGGGAGGAGGG - Intronic
923055820 1:230425657-230425679 GAGCCGGAGGAGGACGAGGCCGG - Intronic
923109479 1:230879656-230879678 GTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109515 1:230879771-230879793 CTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109528 1:230879808-230879830 CTGATTGAGGAGGGGGAGGCCGG - Intergenic
923109576 1:230879958-230879980 GTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109596 1:230880032-230880054 TTGATTGAGGAGGGGGAGGCTGG - Intergenic
923506911 1:234611936-234611958 CAGCTTGGAGAGGGTGAGGCAGG - Intergenic
923512224 1:234662357-234662379 CAGCCTGGGGAGTGGCAGGGAGG + Intergenic
923548976 1:234946245-234946267 CAGCTTGGGGAGGCTGAGGCAGG + Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924403647 1:243718559-243718581 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
1062976901 10:1690772-1690794 CAGGCTGGGGAGGGGGTGACAGG - Intronic
1063114889 10:3066786-3066808 CAGCCTGAGGTCGGGAAGGACGG - Intronic
1063690310 10:8280946-8280968 CACCCTGAGATGGTGGAGGCAGG + Intergenic
1063714456 10:8513640-8513662 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1064392772 10:14955796-14955818 AATCTTGAGGAGGGGGAGGAGGG + Intergenic
1064803222 10:19099872-19099894 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
1064979670 10:21153430-21153452 GAGGCTGAGGAGGCTGAGGCTGG - Intronic
1065445108 10:25790181-25790203 CAGCCTGGGGTGGGGGTGGGTGG + Intergenic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065483452 10:26216038-26216060 GAGCCTGGGGAGGGGACGGCGGG - Intergenic
1065771830 10:29085106-29085128 CTACCTGAAGAGGTGGAGGCAGG + Intergenic
1066316866 10:34256398-34256420 CAGCCGGAGCAGGGCCAGGCTGG + Intronic
1066410617 10:35165219-35165241 CAGCAGGAGAAGGGGGAGCCAGG + Intronic
1066442202 10:35449531-35449553 AAGGCTGCAGAGGGGGAGGCTGG + Intronic
1066563379 10:36693478-36693500 CAGCCTTTGGAGGCCGAGGCGGG + Intergenic
1066733543 10:38453108-38453130 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1067065506 10:43101990-43102012 CCTCCTGAGGAGGGTGTGGCAGG + Intronic
1067742481 10:48906015-48906037 CAGCCTTAGGAGGGCTTGGCTGG + Intronic
1067876086 10:50009295-50009317 TAGCATGAGGAGAGGGGGGCGGG - Exonic
1067909641 10:50332870-50332892 AAGACAGAGGAGGTGGAGGCAGG - Intronic
1068726471 10:60308627-60308649 CAGGCTGAGGGAGGGGAGGAGGG + Intronic
1069362896 10:67663549-67663571 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
1069410261 10:68146195-68146217 CAGCCTGAGGTGGGGAAGGAAGG - Intronic
1070112031 10:73495820-73495842 CAGCCCCGGGAGGGGGCGGCGGG + Exonic
1070148445 10:73791227-73791249 CAGCAAGAGGAGGATGAGGCAGG - Intronic
1070151804 10:73809981-73810003 CAGACTCAGGAGGCTGAGGCCGG - Intronic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070398459 10:76032667-76032689 CTGCTGGTGGAGGGGGAGGCAGG + Intronic
1070767934 10:79067266-79067288 GAGCCGGAGGTGGGGGAGGAAGG - Intergenic
1070792160 10:79195982-79196004 CAGCTTGTTGAGGGGCAGGCTGG - Intronic
1070805090 10:79266215-79266237 AAGTCTTAGGAGTGGGAGGCAGG + Intronic
1070833073 10:79432100-79432122 CAGGCTGAGGAGGCAGAGGTGGG + Intronic
1070981189 10:80649557-80649579 GAAGCTGAGGAGGAGGAGGCTGG + Intergenic
1071292530 10:84197880-84197902 GGGCCTGAGAAGGGTGAGGCTGG + Intronic
1071385550 10:85116622-85116644 TTGCCTGGGGATGGGGAGGCAGG - Intergenic
1071761839 10:88616702-88616724 CAGCCTGAGGCAGGGGTTGCGGG - Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072328271 10:94319979-94320001 CACCCTTAGGAGGCTGAGGCAGG - Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072620165 10:97074464-97074486 CAGGCTCAGAAGGGGAAGGCAGG + Intronic
1073100530 10:101004040-101004062 CATCCGAAGGAGGTGGAGGCGGG - Exonic
1073186021 10:101615478-101615500 CAGGCTGAGGAGGGGCAACCTGG + Intronic
1073486701 10:103823786-103823808 GAGCCTAGGGAGTGGGAGGCAGG + Intronic
1073489677 10:103844662-103844684 CAGGCTGGGGAAGGGGAGGGAGG + Intronic
1073730367 10:106280566-106280588 CAGACTTAGGCAGGGGAGGCAGG + Intergenic
1073991702 10:109268811-109268833 TAGCCTGAGGAGTGGGAGGATGG + Intergenic
1074255719 10:111800351-111800373 CAGCCTCAGGAAGGGGAACCTGG + Intergenic
1074406055 10:113181128-113181150 GGGGGTGAGGAGGGGGAGGCTGG - Intergenic
1074493064 10:113955966-113955988 CACTCTGGGGAGGGGTAGGCGGG + Intergenic
1074773021 10:116745474-116745496 CAGCCTGTGGAGGGTGTGGAGGG - Intergenic
1074856885 10:117480413-117480435 CAGCCTGGAGAGGTGGAAGCAGG - Intergenic
1075013654 10:118895035-118895057 CAGGCTGAGGCGGGAGAGTCAGG - Intergenic
1075077321 10:119359974-119359996 GAGGCTGAGGAGGCGGAGGGAGG + Intronic
1075228370 10:120649958-120649980 CAGCCTGCTGATAGGGAGGCAGG + Intergenic
1075658272 10:124175808-124175830 CAGGCTGGGGGAGGGGAGGCTGG - Intergenic
1075664681 10:124221960-124221982 CAGCCTGGGGAGTGAGGGGCTGG - Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076562452 10:131376048-131376070 CAGCCTGAGGAGAAGAAGGTGGG - Intergenic
1076624454 10:131812919-131812941 CATCCCGAGGAGGTGGGGGCTGG - Intergenic
1076711558 10:132338538-132338560 CAGGCTGAGGAGGGGAAAGGAGG - Intronic
1076778886 10:132713293-132713315 CATCCTGAGGAAGGGGTGGAAGG + Intronic
1076992256 11:281547-281569 GAGCCAGAGGAGGAGGAGGAGGG + Exonic
1077019144 11:409806-409828 CAGCCTGAGGGGCAGGAGGTGGG + Intronic
1077035618 11:493075-493097 CTTCCCGAGGAGGGCGAGGCAGG + Intergenic
1077057603 11:602566-602588 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1077116825 11:888979-889001 AAGCCTGAGCAGGGGCAGCCCGG - Intronic
1077141850 11:1028195-1028217 CAGCCAGGGGAGTGGGGGGCCGG + Intronic
1077488897 11:2851460-2851482 CAGGGTGAGGATGGGGAAGCTGG - Intergenic
1077503729 11:2920659-2920681 GAGGCTGAGGAGGGGAAGGAGGG + Intronic
1077544339 11:3162713-3162735 CAGCCTGAGGATGGGGCTCCTGG - Intronic
1077730249 11:4722693-4722715 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
1077811478 11:5642271-5642293 GAGCCTGAGGAGGGGGAGAAGGG - Intronic
1078057129 11:8018169-8018191 GAGCGCGAGGAGGGGGAGGTAGG - Intergenic
1078094164 11:8286255-8286277 CAGCCTGATGCAGGTGAGGCTGG - Intergenic
1078191609 11:9095965-9095987 CAGCCGCAGGAGGGGCAGGCTGG - Intronic
1078823889 11:14907798-14907820 TATCCTGGGGAGGGGCAGGCAGG + Intronic
1078830065 11:14970114-14970136 TATCCTGGGGAGGGGCAGGCAGG - Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079320582 11:19448237-19448259 CTGCCTGAGGAGGTGTGGGCAGG + Intronic
1079976467 11:27097911-27097933 TAGCTTGAGGATGGGGAGGAAGG - Intronic
1080653726 11:34242433-34242455 CAGCCACAGGAGGGGCAGGGAGG + Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081159565 11:39735672-39735694 CAACCTGAGGAGGAGCAGTCTGG - Intergenic
1081462728 11:43286706-43286728 GAGCCAGAAGATGGGGAGGCAGG - Intergenic
1081629266 11:44677582-44677604 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1081634068 11:44709109-44709131 CAGACTGTGGAGGGGGAGAAGGG + Intergenic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081906036 11:46670695-46670717 CTGCCTTGGGAGGTGGAGGCAGG + Intronic
1081981563 11:47270089-47270111 CGGGGTGCGGAGGGGGAGGCCGG - Intronic
1082053635 11:47794361-47794383 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1083176040 11:60951109-60951131 CAGCCGGCCGAGGGGCAGGCAGG + Exonic
1083188920 11:61035633-61035655 GACCCTGGGGAGGGGGTGGCTGG - Intergenic
1083227405 11:61293960-61293982 CAGCCTGAGAAGGAGGGGACCGG + Intronic
1083259334 11:61514714-61514736 CAGCCTGAGGTGTGGGAAGCTGG - Intergenic
1083609802 11:63999401-63999423 TAGCCTGAGGCGGGTGGGGCGGG + Exonic
1083668103 11:64286068-64286090 CAGCTTGGGGAGGGGGAGAGCGG + Intronic
1083729094 11:64643352-64643374 CGGCCGGGGGAGGGGGGGGCGGG + Intronic
1083822655 11:65181752-65181774 CGGCCTGCGGAGGGAGGGGCGGG + Exonic
1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG + Exonic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084161711 11:67353709-67353731 CCGCGGGAGGAGGGGCAGGCTGG + Intronic
1084266936 11:68010024-68010046 CAGCCTGAGGAGGAGGAGTGGGG - Intronic
1084372140 11:68751242-68751264 CAGCCAGGGGAGGGGGGGCCAGG + Intronic
1084374150 11:68764475-68764497 CAGCCTGGGGAAGGGGAAGCCGG + Intronic
1084389118 11:68863488-68863510 CTGCCTGGGGAGGGGGTGGCAGG - Intergenic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1084806452 11:71582548-71582570 CAGCCTGAGGAGGAGCAGCAGGG + Exonic
1084943256 11:72625564-72625586 CAGCCTGAGGAGGGGACACCAGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086781319 11:90909949-90909971 CAGAATGTGAAGGGGGAGGCAGG + Intergenic
1087002385 11:93434072-93434094 CAGCCTGGGGAAGGGGATCCGGG + Intronic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1087811745 11:102615900-102615922 CAGCCTGAGGTAGGGGTGGATGG - Intronic
1088807823 11:113368067-113368089 CAGCCATAGCAGGGGAAGGCGGG - Intronic
1088996155 11:114999070-114999092 GAGGCTGAGGAGGCAGAGGCAGG + Intergenic
1089015538 11:115162287-115162309 CTGCCTGGGGAGGGTGAGGAGGG + Intergenic
1089078920 11:115760366-115760388 CAGGCCGAGGGGGGGGCGGCGGG - Intergenic
1089214685 11:116828637-116828659 CAGCGTTAGGAGGGAGAGGGAGG + Intergenic
1089346572 11:117795399-117795421 CAGCCTGCGGGGGCGGAGGGAGG + Intronic
1089398813 11:118152820-118152842 GAGCGAGAGGAGGGGGAGGGAGG + Exonic
1089472173 11:118730202-118730224 CAGCCTGGGGAGGAGCAGCCTGG + Intergenic
1089541134 11:119189545-119189567 CAGCCTGAGGTGGTGAAGGCAGG + Exonic
1089599141 11:119602818-119602840 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1089645636 11:119876752-119876774 AACCTTGAGGAGGGGGAGGAGGG - Intergenic
1089854677 11:121532795-121532817 CAGACTCAGGAGGCTGAGGCAGG - Intronic
1090020959 11:123127923-123127945 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1090352318 11:126115306-126115328 CAGCCTGTGTCGGGGGAGCCAGG + Intergenic
1090359014 11:126159991-126160013 CAGCTTTAGAAGGAGGAGGCTGG - Intergenic
1090486059 11:127113051-127113073 CAGCCTTTGGAAGGGGAGGATGG - Intergenic
1091007815 11:131969520-131969542 GAGACTGAGCAAGGGGAGGCAGG + Intronic
1091128072 11:133119675-133119697 CAGCCTGAGGAGGGGAGGCGAGG + Intronic
1091556064 12:1574387-1574409 GAGGCTGGGGTGGGGGAGGCTGG + Intronic
1091556105 12:1574509-1574531 GAGGCTGGGGTGGGGGAGGCTGG + Intronic
1091648157 12:2289336-2289358 CTGCCTGGGGAGGGGGTGGATGG + Intronic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1091779718 12:3206057-3206079 TAGCCTGAGGAAGGGGCCGCTGG + Intronic
1092065622 12:5587817-5587839 CAGCCTGAGGAGGTGCATGGGGG - Intronic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092393247 12:8100522-8100544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1092525970 12:9310629-9310651 CAGCCTAAGGTGTGAGAGGCGGG - Intergenic
1093429603 12:19069770-19069792 TAGCCTCAGGAGGCTGAGGCAGG + Intergenic
1093958664 12:25250516-25250538 GGGGCTGAGGAGGGTGAGGCTGG - Intronic
1095969950 12:47894726-47894748 CAGGGTGGGGCGGGGGAGGCTGG + Intronic
1096110441 12:49026054-49026076 CTGCCTGAGGTGGGGGAAGGAGG + Intronic
1096113935 12:49044190-49044212 CAGCCCGACGAGGGTGAGACGGG - Exonic
1096229507 12:49889325-49889347 CCACCTGATGAGGGGGAGGAGGG - Intronic
1096377384 12:51124553-51124575 CAGCCTGCGGAGGTGCAGGCAGG + Intronic
1096482430 12:51951626-51951648 CGGGCGGAGGAGAGGGAGGCGGG + Intergenic
1096528715 12:52230166-52230188 CAGCCTCAGGGGAGAGAGGCAGG + Intergenic
1096538105 12:52288204-52288226 AAGCCTGAGGAGGTGGAGTCAGG - Intronic
1096540672 12:52305162-52305184 AAGCCTGAGGAGGTGGAGTCAGG + Intronic
1096631522 12:52929785-52929807 TGGCCTGAAGAGGTGGAGGCAGG - Intronic
1096705120 12:53415989-53416011 CAGACTTAGGAAGGGGAAGCAGG - Intronic
1096785155 12:54013107-54013129 AAGGCTGAGGAGGAGGAGGGTGG - Intronic
1097188469 12:57208366-57208388 CAGCATGGGGAGGGCCAGGCAGG - Intronic
1097225831 12:57476365-57476387 CAGCCTGAGGAGGGCGCTGTCGG + Exonic
1097592294 12:61588518-61588540 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1097871805 12:64608557-64608579 ACGCCTGAGGAGGCAGAGGCGGG - Intergenic
1097873949 12:64626009-64626031 CAACCAAAGGAGGGGGAGGTTGG - Intronic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098070730 12:66671492-66671514 CAGCCTGTGGGGGTGGAGGGCGG - Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098506173 12:71253248-71253270 AAGCCTGAGGAGGGGGGTCCTGG - Intronic
1099261038 12:80382880-80382902 GAGCCTGAGGTGGGGAAGACTGG - Intergenic
1099293586 12:80802744-80802766 CAGGAGGAGGAGGGTGAGGCAGG - Intronic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1101145133 12:101833452-101833474 CTGCCTGAGGAGGGGGAAAAGGG - Intergenic
1102523952 12:113497606-113497628 GTGCCAGAGAAGGGGGAGGCCGG + Intergenic
1102569354 12:113818112-113818134 CAGCCTTGGGAGGCTGAGGCGGG + Exonic
1102589252 12:113945311-113945333 AAGCCAGAGGAGGGGGTCGCTGG - Intronic
1102913056 12:116733112-116733134 CAGGATGTGGAGGGGGAGACAGG + Intronic
1103037036 12:117664970-117664992 CAGCCTGGTGTGGGGCAGGCAGG - Intronic
1103188530 12:118981405-118981427 GAGCCTGAGGAGGAGGGGGTTGG + Intergenic
1103199753 12:119078096-119078118 CAGCTTGAGGAGTGGCAGGTGGG + Intronic
1103346861 12:120256967-120256989 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1103604533 12:122077392-122077414 CAGTCTGGGGTGGGGGTGGCAGG - Intergenic
1103703857 12:122861146-122861168 CAGCTTGATGAGGGACAGGCCGG - Exonic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1103924944 12:124418459-124418481 CAGCCTGGGAAAGGGAAGGCGGG + Intronic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1104689878 12:130817944-130817966 CAGCCTGTGGTGGGGGCAGCTGG + Intronic
1104919863 12:132285153-132285175 CTGCCTGAGGGAGGGCAGGCAGG - Intronic
1104951401 12:132442193-132442215 AAGCCTGAGGAGTGGGTGGCCGG - Intergenic
1104959942 12:132483877-132483899 CAGACTGAGGAGGCAGAGGCGGG - Intergenic
1105430751 13:20335068-20335090 CAGCCTGAGGAGTCACAGGCTGG - Intergenic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1105546613 13:21355445-21355467 TAGCCTGGGGAGGGGGAGGAGGG + Intergenic
1105879321 13:24590103-24590125 CGGAGTGAGGAGGGGGTGGCAGG - Intergenic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106140489 13:27007058-27007080 AAGCCTAAGGAGGGCGGGGCTGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107644628 13:42481005-42481027 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1108210522 13:48135263-48135285 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1108533505 13:51348373-51348395 CAGCCTGAGGAGAGCCAGGATGG + Exonic
1109203121 13:59452963-59452985 CAGCCTGGCACGGGGGAGGCTGG - Intergenic
1111165058 13:84447680-84447702 AAGCCAGAGCAGGTGGAGGCTGG + Intergenic
1111406259 13:87810968-87810990 CAGCGGGAGGAGGCGGAGGTTGG - Intergenic
1111787399 13:92806667-92806689 AAGCCTGAGGAGAGGGAGATGGG + Intronic
1112018950 13:95354928-95354950 CAGGCTGAGGGTTGGGAGGCTGG - Intergenic
1113669440 13:112165738-112165760 GAGGCGGAGGAGGGGGAGGAGGG - Intergenic
1113679310 13:112231789-112231811 CAGCCAGAGGAGGCAGACGCCGG + Intergenic
1113900280 13:113793108-113793130 CTGCCTGGGGAGGTGGAGGGGGG + Intronic
1114082464 14:19213255-19213277 GACCCTGTGGAGGGGGAGGTGGG + Intergenic
1114567343 14:23642506-23642528 CAGCCTGATGGAGGGGAAGCAGG - Intronic
1114640398 14:24215824-24215846 CAGCCTGGGGCGGGAGATGCAGG + Intronic
1115307102 14:31944592-31944614 CAGGCAGAGGTGGGTGAGGCTGG - Intergenic
1115995154 14:39188403-39188425 AAGTCTGAGGAGGGTGAGGGTGG + Intergenic
1117253170 14:53954811-53954833 CAGCCTCAGGAAAGGGAGGTCGG - Intronic
1118028181 14:61791989-61792011 CAGGCTCAGGAGGCAGAGGCAGG + Intronic
1118199098 14:63655682-63655704 CAGGCTGAGAAGGCTGAGGCAGG + Intergenic
1118355933 14:65013792-65013814 GAGCCTCAGGAGGCTGAGGCAGG - Intronic
1118356148 14:65015516-65015538 CAGCCTGGCAAGGGGGAGGAGGG - Intronic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118739439 14:68728578-68728600 TAGCCTGTGGAGGCTGAGGCTGG + Intronic
1118761213 14:68881245-68881267 CAGCCTCAGAAAGGGGATGCAGG + Intronic
1118765370 14:68906059-68906081 CAGCCAGAGGCCGGGGGGGCAGG + Intronic
1119046442 14:71321544-71321566 CAGCCTGAGCTGGAGTAGGCAGG + Intronic
1119123030 14:72097671-72097693 CCGGCAGAGGAGGGGGAGGAAGG - Intronic
1119190713 14:72680017-72680039 CTGCGGGAGGAGGGAGAGGCGGG + Intronic
1119748281 14:77059801-77059823 CAGCTGGAGGAGCGGGAGCCAGG + Intergenic
1119755885 14:77119261-77119283 CTGGCTGAGGAGGCTGAGGCAGG - Intronic
1119756691 14:77124889-77124911 CGGCCTGATGAGTGGGCGGCAGG - Intronic
1120216386 14:81684955-81684977 CAGCCTAGAGAGGTGGAGGCAGG - Intergenic
1120660051 14:87239077-87239099 CAGCCTGAGGAGGAGGGGAGAGG + Intergenic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1120881606 14:89418229-89418251 CTGGCTCAGGAGGGGGTGGCAGG - Intronic
1120978951 14:90274209-90274231 CAGCATGGGCAGGGTGAGGCTGG + Exonic
1121272286 14:92645838-92645860 CAACCTCAGGAGGTTGAGGCAGG + Intronic
1121332080 14:93055971-93055993 CAGCCTGATGAGGCTGGGGCAGG + Intronic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1121408896 14:93735801-93735823 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1122126257 14:99580162-99580184 CACCCAGAGGAAGGAGAGGCTGG + Intronic
1122133066 14:99617331-99617353 GAGGCTGAGGGAGGGGAGGCGGG + Intergenic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122182834 14:99968291-99968313 CAGCCTGTGGTGGGGGAGGGTGG + Intergenic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1122704052 14:103608969-103608991 GAGGCTGAGGAGGGTGAGGGTGG + Intronic
1123008981 14:105338165-105338187 CAGCAGGCGGAAGGGGAGGCTGG - Intronic
1123572339 15:21626376-21626398 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1123608954 15:22068963-22068985 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124177320 15:27438634-27438656 CACCCGGAGGAGCAGGAGGCGGG - Intronic
1124239337 15:28017051-28017073 CAGCCTGGGGAGCGGGGGGCGGG + Intronic
1124560432 15:30768986-30769008 AGGCCTGAGGAGAGGGAGACCGG + Intronic
1124670779 15:31636455-31636477 AGGCCTGAGGAGAGGGAGACAGG - Intronic
1125834217 15:42736373-42736395 CAGCGTGAGGCTGGGGCGGCTGG + Exonic
1125840954 15:42800932-42800954 CAGCCGCAGGAGGGACAGGCTGG + Intronic
1125934817 15:43626031-43626053 CAGCCTCAGGAGGCTGAGACAGG - Intergenic
1126473581 15:49042914-49042936 CAGCTTCAGGAGGCTGAGGCAGG + Intronic
1126758340 15:51946299-51946321 CAGCCTCAGGAGACTGAGGCAGG - Intronic
1127200681 15:56646316-56646338 CAGTCTCAGGAGGCTGAGGCAGG + Intronic
1127225086 15:56919263-56919285 GAGCCTGGGGAGGAGGACGCCGG + Intronic
1127301912 15:57663205-57663227 CAGCCAGAGGTGGGGGTGGGGGG - Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1128094487 15:64943659-64943681 CACCCTGAGAAGGAGGAGGGAGG - Intronic
1128113798 15:65093228-65093250 CTGCCTGAGGAAGAGGAGACAGG + Exonic
1128237321 15:66077159-66077181 CACCCAGAGGAGTGGGAGCCAGG - Intronic
1128244540 15:66124173-66124195 CAACCTGGGGTCGGGGAGGCTGG - Intronic
1128309716 15:66622429-66622451 CAGCCCGGGGAGGGCCAGGCGGG - Intronic
1128313765 15:66647432-66647454 CAGCCTGGGGAGCTGGCGGCAGG - Intronic
1128338417 15:66803153-66803175 CAAACTCAGGATGGGGAGGCAGG - Intergenic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128371405 15:67042238-67042260 CTACCTGAGGAGGGGGAGGGGGG + Intergenic
1128389440 15:67173246-67173268 CAGCCTGGGGGCGGGGAGGGGGG + Intronic
1128680558 15:69648367-69648389 CAGGCGGAGAAGGGGGCGGCCGG - Intergenic
1128765444 15:70248368-70248390 CAGCATGAGGCGGGGGAGCTGGG + Intergenic
1128842323 15:70860182-70860204 CAGCCGCAGGAGGGGTAGGATGG - Intronic
1128998690 15:72315924-72315946 CAGCCTGAGGAGGAAGAGGCTGG + Exonic
1129105279 15:73302861-73302883 CAGGCTGACCAGGGGAAGGCAGG - Exonic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129189953 15:73931339-73931361 CAGACTGAAGAGGGAGAGACTGG - Intronic
1129191379 15:73939588-73939610 CTGCCTGGGGTGGCGGAGGCGGG + Intronic
1129258677 15:74349840-74349862 GAGGCTGAGGAGGGAGAGGGAGG + Intronic
1129333286 15:74838571-74838593 CAGCCTGAGGGGGAGGCGGGTGG - Intronic
1129389530 15:75213701-75213723 CAGTCTGAGGTGGTGGGGGCAGG + Intergenic
1129406306 15:75320854-75320876 CAGCCAGATGAGGTGGAGGTTGG + Intergenic
1129462783 15:75708223-75708245 CAGCCTGTGGAGGAGGCCGCTGG - Intronic
1129471666 15:75758846-75758868 CGGCTTGTGGAGGGCGAGGCAGG + Intergenic
1129597844 15:76978966-76978988 CAGCCGCAGGAGGGATAGGCTGG + Intergenic
1129722091 15:77883193-77883215 CAGCCTGTGGAGGAGGCCGCTGG + Intergenic
1129741607 15:77992269-77992291 CCACCTGAGAAGTGGGAGGCTGG + Intronic
1129844042 15:78760111-78760133 CCACCTGAGAAGTGGGAGGCTGG - Intronic
1130287051 15:82564777-82564799 CTGCTTGAGGAGGGGCAGGGTGG + Intronic
1130415895 15:83694340-83694362 GACCAGGAGGAGGGGGAGGCTGG + Intronic
1131271472 15:90950042-90950064 AAGCCTGGGGAGAGGGAGGAAGG + Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131443528 15:92476676-92476698 ATGCCAGAGGAGGGAGAGGCAGG + Intronic
1131838654 15:96414745-96414767 CACCCTGAGGAGTGTGAGGAGGG + Intergenic
1132018091 15:98336970-98336992 CAGGCTGTGGACTGGGAGGCAGG - Intergenic
1132026086 15:98405522-98405544 CAGCCTGGGGCAGGGGAGGAGGG - Intergenic
1132105401 15:99059325-99059347 CCGCGGGAGGAGGGGGAGGCCGG - Intergenic
1132309639 15:100848242-100848264 AGACCTAAGGAGGGGGAGGCTGG + Intergenic
1202981195 15_KI270727v1_random:360763-360785 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1132475979 16:138363-138385 GGGCCTGAGGAGGACGAGGCGGG + Exonic
1132532911 16:462479-462501 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1132611622 16:819617-819639 CAGCCTGAGCTGGGGGCTGCTGG + Intergenic
1132645973 16:999467-999489 CAGCCTGGGGATGGGGAAACTGG - Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132885617 16:2180834-2180856 CAGCCCGTGGAGGGCGAGGTGGG - Exonic
1132890054 16:2199381-2199403 CAGCCTGGGGATGGGGGGGCAGG + Intergenic
1133090467 16:3400561-3400583 TAGCATGAGGATGGGGAGCCAGG + Intronic
1133102220 16:3486397-3486419 CAGCCTGAGGAGGAGGGAGAGGG + Exonic
1133159540 16:3901285-3901307 CAGCTTCAGGAGGCTGAGGCTGG + Intergenic
1133233292 16:4376388-4376410 CAGCATGAGGAGCGGGGGCCCGG + Intronic
1133287062 16:4695403-4695425 CATCCTGAGGCTGGAGAGGCAGG - Exonic
1133732369 16:8588858-8588880 CAGCGTGAGGAAGGGAAGGTGGG - Intronic
1134118432 16:11566741-11566763 CAGCCTGGGCAGGGGTAGGGGGG + Intronic
1134562016 16:15219043-15219065 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1134905018 16:17972550-17972572 CAGGCTGACGTGGGGGCGGCCGG - Intergenic
1134922554 16:18130669-18130691 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1135020856 16:18961854-18961876 GAGCATGAGAAGGAGGAGGCAGG - Intergenic
1135186588 16:20321160-20321182 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1135258097 16:20957693-20957715 TAGCCTCAGGAGGCCGAGGCAGG + Intronic
1135275717 16:21110757-21110779 CAGACTTAGGAGGTTGAGGCAGG + Intronic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135729811 16:24884595-24884617 CAGCTTGGGGAGGCTGAGGCAGG - Intronic
1136172380 16:28496767-28496789 CAACCCGAGGAAAGGGAGGCAGG + Exonic
1136250974 16:29004861-29004883 CAGGCTGGGGAAGGGAAGGCAGG - Intergenic
1136415108 16:30098185-30098207 TAGCCTGAGGTGGGGTAGGCGGG - Intergenic
1136428886 16:30185876-30185898 CAGCCAGCGGAGGGGGCAGCAGG - Intronic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136540759 16:30926577-30926599 CAGAGTGGGGAGGGGGACGCAGG - Intronic
1136542715 16:30937304-30937326 CAGCAAGGGGAGGGGGAGGAGGG - Intronic
1137289323 16:47041211-47041233 CAGCCTGAGGCTGGAGGGGCTGG - Intergenic
1137603104 16:49769798-49769820 CAGGCAGAGGAGGGAGAGGTGGG - Intronic
1137652664 16:50133885-50133907 CTGGCTGATGAGGGGGTGGCTGG + Intergenic
1137666745 16:50254251-50254273 GAGCCTGCGGAAGCGGAGGCAGG - Intronic
1137684250 16:50374780-50374802 GAGACTGAGGAGGGGGAGGGAGG + Intergenic
1138016652 16:53434589-53434611 CCGCCGCCGGAGGGGGAGGCGGG - Exonic
1138585436 16:57967095-57967117 GAGCGGGAGGAGGGGCAGGCCGG - Intronic
1138657855 16:58501094-58501116 CTTCCTCAGGAGGGAGAGGCAGG + Intronic
1139422005 16:66854789-66854811 CAGCCTGGGGAGGGGGTCCCAGG - Intronic
1139468484 16:67166301-67166323 CTGCCTGAGGAAGGGGTGGGAGG - Exonic
1139492064 16:67291521-67291543 CAGTGTGAGGAGGGGGAGAGGGG + Intronic
1139580262 16:67869010-67869032 CAGCCTGAGGAGTGGTAGCAAGG - Intronic
1139608801 16:68039922-68039944 TAGCCTGAGGTGGAGGAAGCAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139957699 16:70700954-70700976 CAGGCTGAGGAGGGTGCGGAGGG + Intronic
1139959329 16:70708765-70708787 CAGTGTGAGGAGGGCAAGGCCGG + Intronic
1140194901 16:72847881-72847903 AAGCCCGAGGGGGAGGAGGCTGG + Intronic
1140267436 16:73433009-73433031 AAGCCACAGGAGGGAGAGGCTGG + Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1140753645 16:78048441-78048463 CAGCCTCAGGACGGGCAGGCTGG + Intronic
1141195887 16:81860863-81860885 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1141433073 16:83980924-83980946 GGGCCTGAGGCAGGGGAGGCTGG + Intronic
1141470760 16:84236887-84236909 CAGCGCGAGGAGTGCGAGGCGGG + Exonic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141693003 16:85607055-85607077 GAGCCTGGGGTGGGGGGGGCGGG + Intergenic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1141842652 16:86584053-86584075 CAGGCTGAGGGGGCAGAGGCAGG - Intergenic
1141964004 16:87429184-87429206 CAGCCTGAGGTGGGTGGGGCCGG + Intronic
1142106756 16:88308511-88308533 CAGAGTGTGGAGGGGCAGGCTGG - Intergenic
1142212077 16:88813110-88813132 GAGCCTTCGGAGGGGGAGGCCGG + Intergenic
1142213696 16:88820836-88820858 CAGCCTGTGGGGGGTGTGGCGGG + Intronic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142288570 16:89182089-89182111 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1142288592 16:89182134-89182156 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1142288607 16:89182164-89182186 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1142288629 16:89182209-89182231 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1142400434 16:89855695-89855717 GCCCCTGAGGAGGAGGAGGCTGG - Intronic
1142442274 16:90106546-90106568 GGTCCTGAGGAGGAGGAGGCTGG - Intergenic
1142586576 17:978627-978649 CAGCCTGGGGCGGGGGAGGCGGG + Intronic
1142740826 17:1931004-1931026 CAGCCTGGGAAGGAGGAGACCGG + Intergenic
1142808887 17:2386136-2386158 CAGGCTGAGGTGGGGAAGGAGGG - Exonic
1142966570 17:3585580-3585602 CAGCCTGAGGCAGGGGAGATGGG + Intronic
1143096484 17:4481039-4481061 CAGGGTGAGGAGGGTGAGGGAGG + Intronic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1143229303 17:5338454-5338476 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143384803 17:6522631-6522653 CAGCATGAGGCAGGGGAGGGGGG + Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143528239 17:7484619-7484641 AAGCCGGAGGAGGGGAAGGTGGG - Exonic
1143948590 17:10615701-10615723 CAGCCTAGGAAGGAGGAGGCAGG + Intergenic
1144517447 17:15928457-15928479 GAGGCTGAGCATGGGGAGGCTGG + Intergenic
1144692961 17:17280903-17280925 CGGCCCGAGGGAGGGGAGGCCGG + Intronic
1144736381 17:17557853-17557875 AACCCTGGGGAGGGTGAGGCCGG - Intronic
1144948481 17:18981766-18981788 CAGCCTGCGGGGTGGGGGGCCGG - Intronic
1145210249 17:21007567-21007589 AAACCTGAGGAGGGGGTAGCTGG + Intronic
1145787814 17:27605431-27605453 CAGGCTGAGGAGCCAGAGGCTGG + Exonic
1145901763 17:28494521-28494543 CAGGCTGAGGAGGGGGCTGGGGG - Intronic
1145963853 17:28903051-28903073 CAGCCTCCGAAGGCGGAGGCGGG + Exonic
1146187018 17:30730826-30730848 CAGCCTGAGATGGGACAGGCTGG + Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146405521 17:32533489-32533511 CAGCTTGAAGAGTGGGTGGCAGG - Intronic
1146496657 17:33328686-33328708 CAGCATGAGAAAGGGGAGACAGG - Intronic
1146546299 17:33741760-33741782 CTGCCTGAGCATGGGTAGGCTGG - Intronic
1146795111 17:35775040-35775062 CAGGCAGAAGAGGGGGTGGCGGG + Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147193117 17:38748497-38748519 CGGGAAGAGGAGGGGGAGGCTGG + Intronic
1147321261 17:39647461-39647483 CCTCCTGATGAGGGGGAGGCAGG - Intronic
1147860229 17:43516526-43516548 GAGCCTGGGGAGGTCGAGGCTGG - Intronic
1147917546 17:43897766-43897788 CAGCCTGGGGTGGGTGAGGAGGG - Intronic
1147971042 17:44219272-44219294 GAGCCGGGGGAGGGGAAGGCAGG - Intronic
1147982436 17:44282770-44282792 GAGCCAGAGGAGGGGGAGCTTGG - Intergenic
1148102219 17:45099241-45099263 CACTGTGGGGAGGGGGAGGCTGG + Intronic
1148209787 17:45801172-45801194 GAGCCTGTGGAGGGGGTGGAGGG - Intronic
1148389164 17:47257909-47257931 CACAGTGAGGAGGGGGAGTCTGG + Intronic
1148591595 17:48820400-48820422 GAGGCTGAGGAGGCTGAGGCAGG - Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148670268 17:49404961-49404983 CAGCCCGCGGAGGTGCAGGCAGG + Exonic
1148863206 17:50615217-50615239 CAGCGTGGGGAGGGCGAGGATGG + Intronic
1148889186 17:50795538-50795560 CAACCAGAGCAGGGAGAGGCAGG + Intergenic
1149486338 17:57045895-57045917 CCGCGTGGGGAGGCGGAGGCGGG - Intergenic
1149520589 17:57315436-57315458 GAGCCTGTGTTGGGGGAGGCAGG + Intronic
1149554730 17:57565309-57565331 CAGCGTGAGGCTGGGAAGGCCGG - Intronic
1149567140 17:57648525-57648547 CTGCCTCAGGAGGAGGAGTCTGG + Intronic
1150096216 17:62378449-62378471 GAGCCTTGGGAGGCGGAGGCAGG + Intronic
1150217533 17:63478792-63478814 CAGCCTGTGGAGTGGGGGACAGG - Intergenic
1150265270 17:63828141-63828163 GAGCTGGAGGAGGGGAAGGCAGG + Exonic
1150300468 17:64043509-64043531 GATGCTGAGGAGGGGGAGGACGG - Exonic
1150377411 17:64693335-64693357 CAGCTAGAGGAGGCTGAGGCAGG - Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151100816 17:71553456-71553478 CAGGTTGAGGAGGGGCAGACAGG + Intergenic
1151309727 17:73285788-73285810 GACCCCGAGGAGGGGGAGGGTGG - Exonic
1151413595 17:73947390-73947412 AAGCCTGAGAAGGTGGCGGCTGG + Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151451693 17:74201967-74201989 CTGCCTGAAAAAGGGGAGGCGGG + Intergenic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151824759 17:76518072-76518094 CTGCCTGGGAAGGGGGAGGTGGG - Intergenic
1151825530 17:76521947-76521969 CAGAGTGAGGGTGGGGAGGCTGG - Intergenic
1151853015 17:76702258-76702280 CAGCCTCAGGAGGCAGAGGCAGG + Intronic
1152088144 17:78232444-78232466 CAGCCGGAGGAGGGGGCTGTGGG + Intronic
1152123250 17:78431697-78431719 GAGTCTGTGGAGGGGGAGGGAGG + Intronic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1152404784 17:80091015-80091037 CTGGCTGAGGAGGGGGAGCCGGG - Intronic
1152617081 17:81342949-81342971 CCGCCTGAGAAGGGGGCGGAAGG - Intergenic
1152630399 17:81408386-81408408 GAGCCTGGGGGGTGGGAGGCAGG - Intronic
1152637953 17:81437876-81437898 CAGCCAGGGTCGGGGGAGGCTGG + Intronic
1152755383 17:82084976-82084998 CAGGCTGGGGATGGGGAGGCTGG + Intronic
1152761372 17:82108858-82108880 CAGCGTGGGGCGGGGCAGGCCGG + Intronic
1152803173 17:82341347-82341369 CAGGCTGAGGAAGCTGAGGCTGG - Intergenic
1152925397 17:83085333-83085355 CTGCCTGGGGCGGGGGCGGCGGG + Intronic
1152929110 17:83100936-83100958 CAGCTTGAGCAGGGGCAGGCTGG + Intergenic
1152988758 18:343309-343331 AAGGCTCAGGTGGGGGAGGCCGG + Intronic
1153004129 18:482225-482247 CAGCCTCAGAAGGCTGAGGCAGG - Intronic
1153805458 18:8705841-8705863 CGGCCCGAGGAGGGGACGGCCGG - Intronic
1153977048 18:10278555-10278577 CAGCTTGGGGAGAGGCAGGCAGG - Intergenic
1154123417 18:11669871-11669893 CAGCCTGATGTGGGAGAGGAGGG + Intergenic
1155892789 18:31288315-31288337 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
1156645926 18:39162298-39162320 CAGCCTGAGGAAGGTGATGCAGG + Intergenic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157285408 18:46374038-46374060 CAGCATGAGCAGGGCCAGGCTGG + Intronic
1157307176 18:46525699-46525721 GAGCCTGAGGAGGGTGAGAGGGG + Intronic
1157393937 18:47326256-47326278 CAGTCTTAGGAGGGTGAGTCTGG + Intergenic
1157562676 18:48659784-48659806 CAGCCTGGGGAGGGAGACACAGG + Intronic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157761771 18:50270562-50270584 CTGGCTGAAGAGGGGGAGTCAGG + Intronic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1158512513 18:58103809-58103831 CAGCCCGAGGAGGAGAATGCAGG + Intronic
1158571990 18:58604019-58604041 CAGCATGAGGAGGAGAATGCAGG + Intronic
1159063659 18:63543706-63543728 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1159078212 18:63705321-63705343 CAGCTTTGGGAGGCGGAGGCAGG - Intronic
1159946341 18:74447092-74447114 CAGGCTGAGGGGCGGGAAGCTGG + Exonic
1159971978 18:74666286-74666308 CAGCCAGTGGAGGGGAGGGCAGG + Intronic
1160394242 18:78559927-78559949 CAGCCTGACGAGGGGAAGTCGGG + Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160589977 18:79938406-79938428 CAGCCTGAGGAAGGCAGGGCTGG - Intronic
1160698008 19:494032-494054 CGGCCAGAGGTGGGGAAGGCGGG - Intronic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160732542 19:647896-647918 TAGACAGAGGACGGGGAGGCTGG + Exonic
1160810642 19:1011544-1011566 CAGCGCGGGGCGGGGGAGGCCGG + Intronic
1160898936 19:1417029-1417051 CAGCCTGGGGCGGGGGTGGGGGG - Intronic
1160906461 19:1453793-1453815 CGGGCTGGGGAGGGGGAGGGAGG - Intronic
1160960530 19:1718783-1718805 CGGCCGGGGGAGGGGGAGGCTGG - Intergenic
1160988426 19:1850872-1850894 CAGGGTGAGGAGGGGGAGAGAGG + Intergenic
1160991785 19:1863178-1863200 GCGGCTGAGGAGGAGGAGGCGGG + Exonic
1161226155 19:3146909-3146931 CAGAGTGAGGAGGGGGAGAGAGG - Intronic
1161238213 19:3208312-3208334 CAGTCGGAGAAGGGGAAGGCTGG - Exonic
1161243056 19:3233664-3233686 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161253093 19:3291736-3291758 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161274907 19:3410518-3410540 CAGAGTGAGGAAGGGGAGACAGG + Intronic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161341527 19:3745787-3745809 CCTCCTGAGGAGTGGGTGGCTGG - Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161351990 19:3798622-3798644 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1161381658 19:3968664-3968686 AAGCATGAGAAGGGGGAGGAGGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161642947 19:5435706-5435728 CAGAGTGAGGAGGGGGAGAGAGG - Intergenic
1161674692 19:5638831-5638853 CAGCTTGGGGAGGATGAGGCAGG - Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161937159 19:7379103-7379125 CAGCCTGTGGGGGTGGAGGTGGG - Exonic
1162043423 19:7983975-7983997 GAGCCTGAGGAGGGACAGCCAGG - Intronic
1162299393 19:9835589-9835611 AAGCCTGAGGAAGCTGAGGCAGG + Intronic
1162349235 19:10138686-10138708 CAGCCTGAGTCGGGAGTGGCTGG + Intronic
1162402423 19:10454186-10454208 CACCCAGGGGAGGGGGAGGGGGG - Intronic
1162708080 19:12570879-12570901 TAGCCTCAGGATGGGGGGGCAGG - Intronic
1162791833 19:13066979-13067001 CACCCTGAGGAGGGGAACGGTGG - Intronic
1162971879 19:14185663-14185685 CAGCCTGAGATGGGACAGGCTGG - Intronic
1163321516 19:16577474-16577496 CGGCCGGAGGTGGGGGCGGCTGG - Exonic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163577980 19:18121834-18121856 CTGCCTGCTGAGGAGGAGGCGGG - Exonic
1163583997 19:18154248-18154270 CAGCCTGGGGAGGCGGAGATAGG - Intronic
1163717017 19:18878701-18878723 GAGGCTGGGGAGGGGCAGGCAGG - Exonic
1163721595 19:18900507-18900529 CTGCCTGAGGTGGGGGTGACGGG - Intronic
1163769261 19:19180729-19180751 CAGGCTGAGGAGGGCGGGGGTGG + Exonic
1163813339 19:19448235-19448257 CCGCCTGTGAAGGGGGAGTCCGG - Intronic
1163831165 19:19547811-19547833 CAGCCTATCGAGGGTGAGGCTGG - Intergenic
1164104763 19:22099833-22099855 CAGCATTAGGAGGCCGAGGCGGG + Intergenic
1164430681 19:28185853-28185875 CAGCCTCATGAGGAGGAGGCTGG + Intergenic
1164479803 19:28602616-28602638 AAACCTGAGGAGTGGGAGGGAGG - Intergenic
1164676362 19:30104251-30104273 AGGACTGAGGAAGGGGAGGCAGG - Intergenic
1164909314 19:31992800-31992822 CAGACTGAGGGAGGGGAGCCAGG - Intergenic
1165143189 19:33714979-33715001 GAGCCTGTGGAGGGAGGGGCTGG - Intronic
1165235839 19:34420902-34420924 CAGACTGAGGTGGGGGATGTGGG + Intronic
1165362373 19:35344874-35344896 CAGGATGAGGATGGCGAGGCAGG - Exonic
1165427298 19:35753236-35753258 CTGCCTGAGGATGAGGAGGTGGG + Exonic
1165827603 19:38714165-38714187 CACACAGAGGAGGGTGAGGCTGG - Intronic
1165905680 19:39193176-39193198 CAGCCAGGGTAGGGGTAGGCAGG + Intergenic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1165961676 19:39539946-39539968 CAGCCTGAGGAGGCCGGGGAAGG - Exonic
1166167686 19:41003877-41003899 CAGCCTGGGGAGGCGGATGTTGG + Intronic
1166199734 19:41229195-41229217 CAGCCTTAGGAGGCCGAGGTGGG - Intronic
1166329360 19:42069587-42069609 AAGCCGGGGGAGGGGGAAGCTGG + Intronic
1166767862 19:45263154-45263176 CAGCCTGCAGAAGGTGAGGCTGG + Exonic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1166868153 19:45853701-45853723 CAGCCTAGGGATGGGGAGTCAGG - Intronic
1167015543 19:46838688-46838710 GAGCCAGAGGAGGGGGACGGGGG - Intronic
1167071837 19:47226503-47226525 CCGCCGGAGGAGGGGGCGGCAGG - Intronic
1167074217 19:47239404-47239426 CAGCCTGGGGAGAGGGAGTTGGG + Intergenic
1167145570 19:47679573-47679595 CAGCCTGCGGATGGCGGGGCAGG + Exonic
1167238057 19:48326811-48326833 AAGCCTGGGGAGGGGGAGCAGGG - Exonic
1167258438 19:48444134-48444156 CAGCCTGAGAACGAGGGGGCGGG + Exonic
1167261175 19:48459126-48459148 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1167291339 19:48626700-48626722 CAGCTACAGGAGGGTGAGGCAGG + Intronic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1167668860 19:50838573-50838595 GGGTCTGAGGAGGGAGAGGCTGG + Intergenic
1167679813 19:50912366-50912388 CAGCCAGAGGAGGGCAGGGCGGG + Intergenic
1167745536 19:51349557-51349579 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
1167756890 19:51418314-51418336 CAGACTCAGGAGGCTGAGGCAGG - Intergenic
1167915185 19:52734647-52734669 GGGGCTGAGGAGGGGGAGGCTGG + Intronic
1168526177 19:57090441-57090463 CAGCCCGGGGATGGGGAGGACGG + Intergenic
924963607 2:56893-56915 CAGCCTGGGGAGGTGGAGCTGGG + Intergenic
925401571 2:3576796-3576818 CAGCACGGGGAGGTGGAGGCGGG + Intronic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926559756 2:14403049-14403071 CAGCCTGAGGATGAGGAAGAAGG + Intergenic
926717405 2:15935840-15935862 CAGCCTGGGGAGTGGGAGCAGGG - Intergenic
927199787 2:20571203-20571225 CAGCCTAAGGAAGGGGGTGCTGG - Intronic
927338296 2:21950997-21951019 CATCCAGAGGAAGGGGAGGGGGG - Intergenic
927534679 2:23846038-23846060 CAGACACAGGAGGGTGAGGCGGG + Intronic
927534746 2:23846580-23846602 CAGACACAGGAGGGTGAGGCGGG + Intronic
927534813 2:23847122-23847144 CAGACACAGGAGGGTGAGGCGGG + Intronic
928697058 2:33859985-33860007 CAGCCGCAGGAGGGGAAGGAAGG - Intergenic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
928974292 2:37067658-37067680 CTGACTCAGGAGGGTGAGGCAGG + Intronic
928991984 2:37242299-37242321 CAGCCTGAGAAGGCTGAGGCAGG - Intronic
929762601 2:44818471-44818493 CATCAAGAGGAGGGTGAGGCAGG - Intergenic
929924604 2:46197868-46197890 CAGCCTCGGGTGGGGGTGGCAGG + Intergenic
930099210 2:47590094-47590116 CAACCTGAGGAGGAGCAGTCTGG + Intergenic
930213362 2:48667074-48667096 CATGCTGAAGAGGTGGAGGCAGG - Intronic
930762256 2:55049856-55049878 CCGGGGGAGGAGGGGGAGGCCGG + Exonic
932203722 2:69858174-69858196 CAGGCTGGGGAGGGGCAGGTGGG + Intronic
932334551 2:70922627-70922649 GAGGCAGAGGAGGGGCAGGCCGG + Intronic
932490058 2:72114713-72114735 AGGACTGAGGAGGGTGAGGCTGG - Intergenic
932771372 2:74502551-74502573 CAGGCGGAGGAGCGTGAGGCGGG + Intronic
933163642 2:79053047-79053069 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
933310591 2:80656993-80657015 CAGCCTTAGGAGGCTGAAGCAGG + Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934080557 2:88464115-88464137 AAGCCTGGGCAGGGGGTGGCCGG - Intergenic
934562085 2:95318594-95318616 CAGGCAGAGGAGGGAGAGCCTGG - Intronic
934573947 2:95389006-95389028 CAGGCTGAGGAGGGGTAGTCTGG + Intergenic
934759845 2:96848441-96848463 CAGCCTGTGGAGAGAAAGGCTGG + Exonic
935292241 2:101620509-101620531 CAGGCTGAGGATGGTGAGGAAGG - Intergenic
935970566 2:108527279-108527301 CAGTCTGAGGAGAGTCAGGCGGG - Intergenic
936406587 2:112210019-112210041 GAGCCTGGGGAGGGTGAGGAGGG + Intergenic
936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG + Intergenic
936462299 2:112722479-112722501 TGCCCTGAGGAGGGGTAGGCTGG - Exonic
936518705 2:113198662-113198684 CAGCCACAGGAGGGGGCGGGAGG + Intronic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
937209757 2:120260690-120260712 TGGCCTCAGGAGGGGGACGCTGG + Intronic
937365339 2:121257234-121257256 CAGCCTGAGGTGGGGGTGGGTGG - Intronic
937865511 2:126748507-126748529 CAGCCACAAGAGGGGAAGGCGGG - Intergenic
937898055 2:126993586-126993608 CAGCCTCAGGAGGCTGAGGCAGG + Intergenic
938287245 2:130128555-130128577 CTGCCTGTGGAGGGGGTGGTTGG - Intronic
938469255 2:131544318-131544340 CTGCCTGTGGAGGGGGTGGTTGG + Intergenic
938494120 2:131783348-131783370 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
939734981 2:145833084-145833106 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
940323106 2:152398009-152398031 CAGCCTTGGGAGGCTGAGGCGGG + Intronic
942418881 2:175787169-175787191 GGGCCAGAGGAGGGGGTGGCAGG + Intergenic
942490442 2:176484500-176484522 AAGCCTCAGGAGAGGGAGGGAGG - Intergenic
942522334 2:176817489-176817511 CAGTCTGAGGAGCAAGAGGCTGG + Intergenic
942558725 2:177198573-177198595 CAGCCGCAGGAGGGGCACGCTGG - Intergenic
943064359 2:183070998-183071020 CAGCCACAGGAGGGGCAGGCTGG + Intergenic
943669927 2:190649265-190649287 CCGCCAGAGGAGGGAGAGCCGGG + Exonic
944250939 2:197579762-197579784 CAACCTGAGGAGGAGCAGTCTGG - Intronic
944645827 2:201780608-201780630 CAGTCTGGGGAGGGAGAGACCGG + Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
944988959 2:205212490-205212512 CAGCCAGAGTAGGGTGAGGAAGG + Intronic
946074928 2:217065840-217065862 CAGCCTGGAGAAGAGGAGGCTGG - Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946320796 2:218953359-218953381 CAGCCACAGAAGGGGCAGGCTGG + Intergenic
946337698 2:219049533-219049555 CAGGCTGAGGTGTGGGAGGTGGG + Intergenic
946757174 2:222959513-222959535 CAGCCTGAGGCGAGGGAGCGTGG - Intergenic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947869771 2:233428127-233428149 GAGCCAGAGGAGGAGGAGGTGGG + Intronic
948312069 2:236994823-236994845 TGGCTTGAGGTGGGGGAGGCTGG + Intergenic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948375644 2:237518660-237518682 GTGGCTGAGGAGGGGGTGGCTGG - Intronic
948465468 2:238149800-238149822 GTGCCTGAGGAAGGGGAGGGAGG + Intronic
948668072 2:239548653-239548675 CAGTCTGAGGGTGGAGAGGCAGG + Intergenic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
948819908 2:240537108-240537130 CAGCCTGAGGAATGTGAGGTTGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
949043321 2:241859199-241859221 CAGCCTCAGGAGGGGCAGCTCGG - Intergenic
1168968210 20:1912963-1912985 CGGCCTGAGAGGGGTGAGGCTGG - Intronic
1169001921 20:2174165-2174187 CAGCTAGAGGAAGGGGAAGCAGG + Intronic
1169030278 20:2401328-2401350 CAGGAGGAGGATGGGGAGGCTGG - Intronic
1169044510 20:2524989-2525011 AAGCCTCAGGAGCGGGAAGCCGG - Intergenic
1169045712 20:2533108-2533130 GAGCCTGAGACGGGGCAGGCGGG + Intergenic
1169136795 20:3202696-3202718 GAGCCTGAGGAGGGGGCGTCTGG - Intronic
1169195061 20:3678444-3678466 CATCCCCAGGAGGGGAAGGCTGG - Intronic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170073052 20:12389848-12389870 AAGCCTGAGGAGGGGGTTGTGGG - Intergenic
1170222050 20:13951485-13951507 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171388870 20:24788185-24788207 GAGACTCAGAAGGGGGAGGCTGG - Intergenic
1171848214 20:30290600-30290622 CGGCCTGGGGGAGGGGAGGCGGG + Intergenic
1171997686 20:31744838-31744860 CACTCTGAGGAGGCTGAGGCGGG + Intronic
1172654646 20:36529440-36529462 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1172964580 20:38825306-38825328 CAGCCTTGGGAGGGGGAAGTAGG + Intronic
1172972502 20:38883588-38883610 CTGCCTGTGTAGGGGGTGGCGGG + Intronic
1173069212 20:39745271-39745293 AAGCCTGAGGAGGGGGCAGAAGG - Intergenic
1173552732 20:43944550-43944572 CTGCAGGAGGAGGGAGAGGCTGG - Intronic
1173781586 20:45761076-45761098 CAGCCTGGGGAGGAGGAGAAAGG - Intronic
1173783388 20:45774828-45774850 CAGCCTTGGGAGGCTGAGGCAGG + Intronic
1173848174 20:46201113-46201135 CAGCATGGGGAAGCGGAGGCCGG - Intronic
1173865878 20:46312464-46312486 AAGCGGGAGGAGGGGGAGGAAGG - Intergenic
1173871423 20:46344420-46344442 TAGCATGAGGAGGGGGAAGAGGG - Intergenic
1173972347 20:47162595-47162617 AAGCCTGGGGAGGTCGAGGCTGG - Intronic
1174334696 20:49851258-49851280 AAGCCTGTGGTGGGGGAAGCAGG + Intronic
1174346389 20:49933205-49933227 CAGCAGGAGGAGGCTGAGGCGGG - Intergenic
1174618236 20:51853102-51853124 TAGCCTGAGGAGGTGGAGGTGGG + Intergenic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1175124403 20:56740681-56740703 CAGCCAGAGAGGGGCGAGGCAGG + Intergenic
1175229451 20:57464429-57464451 CAGGCTGAAGCGGGGGAGGCTGG + Intergenic
1175345067 20:58267032-58267054 CAGGCTCAGGAAGGGGAGGGAGG + Intergenic
1175371500 20:58495912-58495934 CAGCCTGGAGAGGGGGACCCGGG - Intronic
1175417364 20:58810786-58810808 CAGCCTGAGGTGGTTGAGTCAGG + Intergenic
1175545210 20:59773496-59773518 CAGCCTGAGGCTGGCCAGGCAGG - Intronic
1175670331 20:60897095-60897117 GAACCTGAGGAGGGGGACGTGGG + Intergenic
1175743238 20:61435497-61435519 CGGCCGGAGGAGGTGGAGGATGG + Intronic
1175893373 20:62325091-62325113 CAGGCGGATGAGGGGCAGGCAGG + Intronic
1175895295 20:62333296-62333318 CAGCCTGAGTGGGGGAAGCCAGG + Intronic
1175980888 20:62738065-62738087 TAGGCAGAGGAGGGGGAGGGGGG - Intronic
1175989943 20:62783616-62783638 CAGCCTGCCCAGGGGGAGCCGGG - Intergenic
1175996069 20:62812881-62812903 CAGCCTCAGGACGGGGACCCAGG + Exonic
1176177822 20:63737034-63737056 CACCCGGAGGAGCTGGAGGCTGG - Intronic
1176179894 20:63744849-63744871 CTGAGTGTGGAGGGGGAGGCGGG + Exonic
1176209839 20:63913970-63913992 CTGCCTGAGGGGTGGGAGGATGG - Intronic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1176711397 21:10152859-10152881 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1177315376 21:19454019-19454041 CAGTCTGAGGTGGCAGAGGCAGG - Intergenic
1178001102 21:28162825-28162847 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1178626825 21:34225316-34225338 CAGCAGGAGGAGGGAGAGGTGGG + Intergenic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178837097 21:36108011-36108033 CAGCCATAGGAGGTGGAGGAGGG - Intergenic
1178890228 21:36514750-36514772 GGTCCTGAGGAGGGGGTGGCTGG + Intronic
1178955923 21:37021740-37021762 GAGCCTGAGGTGGGAGATGCTGG + Intergenic
1179455428 21:41496589-41496611 TAGGCTGAGGAAGGGGAGGTGGG - Intronic
1179590412 21:42404299-42404321 CAGCCTTAGGAGGCTGAGGTGGG - Intronic
1179594268 21:42431399-42431421 CTGCCTGAGGCTGGGGAGGAAGG + Intronic
1179654869 21:42838646-42838668 GAGGCTGAGGCGGGTGAGGCGGG - Intergenic
1179681158 21:43022212-43022234 AAGGCCGAGGAGGAGGAGGCTGG - Intronic
1179791363 21:43757675-43757697 CTGGCTGAGGTGGGGGAGCCAGG - Exonic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1179912169 21:44456139-44456161 CACCCTGAGGAGGGAGGGGCTGG + Intronic
1180008670 21:45035198-45035220 CTGCCTGTGGAGGGTGGGGCAGG - Intergenic
1180498313 22:15909415-15909437 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1180716401 22:17875457-17875479 GAGTCGGAGGAGGGAGAGGCGGG + Intronic
1180818430 22:18807964-18807986 GAGCCTGAAGTGGGGGAGGGGGG + Intergenic
1181006482 22:20016171-20016193 CAGCCCGAGGGGCGGCAGGCCGG - Intronic
1181204652 22:21242419-21242441 GAGCCTGAAGTGGGGGAGGGGGG + Intergenic
1181509453 22:23382520-23382542 GGGCCAGGGGAGGGGGAGGCGGG - Intergenic
1181632751 22:24159843-24159865 CTGCCTGTGGACGGGGTGGCTGG - Intronic
1182113862 22:27743661-27743683 CAGCCTGGCGAGGAGCAGGCTGG - Intergenic
1182122900 22:27798536-27798558 CAGGCGGAGGAGGGGGCGCCAGG + Exonic
1182676351 22:32042637-32042659 CAGGCTGTGGAGGGGGAGTCAGG + Intergenic
1182748090 22:32621226-32621248 CAGCTTTAGGAGGGTCAGGCAGG + Intronic
1183072691 22:35407371-35407393 CAGACTGAGGGGGTGGAGGGTGG - Intronic
1183276049 22:36898845-36898867 CAACCTGAGGAAGTGGAGGGAGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183352812 22:37343440-37343462 CAGCCTGGAGTGGGAGAGGCGGG - Intergenic
1183397452 22:37580153-37580175 AGCGCTGAGGAGGGGGAGGCTGG - Intronic
1183466164 22:37981422-37981444 CAGCCTGAGGTGTGGCAGTCAGG - Intronic
1183543520 22:38443470-38443492 CAGACTGAGATGGGGAAGGCAGG - Intronic
1183748836 22:39707635-39707657 AAGCCTGAGCAGGGGGTGCCTGG - Intergenic
1183832776 22:40427511-40427533 CTGCCTCAGGAGGGGCAGGCAGG + Intronic
1183922054 22:41177429-41177451 CAGTCTGAGGAGGGGTTGGAGGG - Exonic
1183932783 22:41245808-41245830 CAGTCTGGGGAGGGAGAGGCAGG - Exonic
1184514741 22:44955076-44955098 CAGCCTGAGGGGGCAGAGGGTGG + Intronic
1184536992 22:45094195-45094217 TAGCCTGAGCAGCGGGAGGGTGG - Intergenic
1184610051 22:45597597-45597619 CAGCCCAGGGAGGGGCAGGCAGG + Intronic
1184620356 22:45672020-45672042 GAGCCTGACGAGGAGGAGGAAGG - Exonic
1184793681 22:46718392-46718414 CAAACAGAGGAGGGGAAGGCGGG + Intronic
1185051676 22:48557354-48557376 CAGGCTGAGGAGGGCGGCGCCGG + Intronic
1185088979 22:48755460-48755482 CAGGCTGATCAGGGGGAGCCAGG + Intronic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
1185270918 22:49929075-49929097 CAGCCTGGGAAGGGGGGGCCAGG - Intergenic
1185281687 22:49972434-49972456 CAGCCCGAGGTAGGGGCGGCGGG - Intergenic
1185322331 22:50207533-50207555 CAGCCTCAGGGGTGGGCGGCTGG - Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1203222272 22_KI270731v1_random:52996-53018 GAGCCTGAAGTGGGGGAGGGGGG - Intergenic
949188105 3:1218212-1218234 GAGCCTGAGGAAGGGGAAGAGGG + Intronic
950044525 3:9941072-9941094 CAGCATGAGGATGGGCAGGCAGG - Intronic
950114884 3:10444362-10444384 CAGCAGGAGGATGTGGAGGCAGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950575945 3:13832126-13832148 GAGCCTGAGGAGGAGGAAGAGGG - Intronic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
950791199 3:15473824-15473846 CACCCTGGGGAGAGGGTGGCAGG - Intronic
952075647 3:29694123-29694145 CAGCCTCTGGAGAGTGAGGCAGG + Intronic
952113250 3:30148937-30148959 TAGCCTGAGCAGGGTGAGGAGGG + Intergenic
952257358 3:31706915-31706937 CTGTCTGAGGAGGGGAAAGCAGG - Intronic
952269351 3:31817038-31817060 CAGCCAGAGCAGGGAGAGGATGG - Intronic
952282176 3:31934518-31934540 CAGCTTCAGGAGGCTGAGGCAGG - Intronic
952509773 3:34041365-34041387 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
952821812 3:37492353-37492375 CAGCTTGGGAAGGCGGAGGCTGG + Intronic
952858878 3:37795691-37795713 CAGGCTGAGCTGGGGAAGGCAGG - Intronic
952895348 3:38075093-38075115 CAGCCTGAGGAGGAGGGGAAAGG + Intronic
952912039 3:38199373-38199395 TAGCCTGAGGAGGCTGAGGTGGG - Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953390785 3:42532503-42532525 CAGCCTGGTGAGGGTGGGGCTGG - Intronic
953405846 3:42659400-42659422 GAGGGGGAGGAGGGGGAGGCTGG + Exonic
953419271 3:42742031-42742053 CAGCATGAAGAGGTGCAGGCAGG - Intronic
953492017 3:43360633-43360655 CAGCCTGAGGAGTGGGCTCCAGG - Intronic
953834560 3:46331489-46331511 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
953976353 3:47384507-47384529 CAGCCTGAGGAGGGGCCATCAGG + Intronic
953978033 3:47397049-47397071 GAGCCTGAGGAGAGGGAGAGAGG + Intronic
954274745 3:49534941-49534963 CTGCCTCAGGAGGGGAGGGCTGG + Exonic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954392809 3:50276265-50276287 CAGCGTGAGGCGGGGGTGTCGGG - Intronic
954420906 3:50418589-50418611 AAGCCTCAGGAGGGGAATGCAGG + Intronic
954434752 3:50490073-50490095 CAGGCTGTGGAGTGGGCGGCAGG + Intronic
954436984 3:50501499-50501521 CAGCCAGAAGATGGCGAGGCGGG - Intronic
954584300 3:51720466-51720488 CAGCCTTGGGATGGGGAAGCTGG - Intergenic
954781654 3:53066372-53066394 CAGCCTTGGCAGGTGGAGGCAGG + Intronic
955044710 3:55348877-55348899 CACCATGGGGAGGGGGAGGCAGG - Intergenic
955357859 3:58246440-58246462 CAGGCAGAGGAGGGACAGGCAGG - Intronic
955554232 3:60118755-60118777 GAGGCTGAGGTGGGGGCGGCGGG + Intronic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956464605 3:69506645-69506667 CAGACTCAGGAGGCTGAGGCAGG - Intronic
957287168 3:78231656-78231678 GAGCCTGAGGCTGTGGAGGCTGG - Intergenic
957444280 3:80294883-80294905 GAGGCTGAGGTGGGGGAGGCGGG - Intergenic
959614490 3:108331843-108331865 TAGAATGGGGAGGGGGAGGCAGG - Intronic
959972347 3:112421597-112421619 CAGCCTGGCGAGGAGCAGGCTGG + Intergenic
960054544 3:113267837-113267859 CAGCCTTCGGAGGCTGAGGCAGG - Intronic
961112192 3:124294257-124294279 CAGCCATATGAGTGGGAGGCAGG + Intronic
961205208 3:125076245-125076267 CAGCCTGAGGCAGGAGAGGTAGG - Intergenic
961430709 3:126880894-126880916 CAGGCTGTTGAGGTGGAGGCTGG + Intronic
961491933 3:127262436-127262458 CAGACTGAGGAGGGGAGAGCAGG - Intergenic
961625142 3:128256596-128256618 CAGCCTGAAGAAGTGGAGTCAGG - Intronic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
961726604 3:128934909-128934931 TTGCCTGAGGAGGGAGTGGCTGG - Intronic
962055853 3:131870873-131870895 CAGCCTGAAGAAGAGAAGGCTGG + Intronic
962403871 3:135083651-135083673 CAGGCTGAGGAGGTGCAGGTAGG + Intronic
962712738 3:138101436-138101458 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
962775910 3:138659403-138659425 CTGCCTGGGGAGGCTGAGGCAGG + Intronic
962899801 3:139751289-139751311 CAACCTCAGGAGGTTGAGGCAGG + Intergenic
962995236 3:140620831-140620853 CAGCCTGAGAACTGAGAGGCTGG + Intergenic
963063875 3:141247031-141247053 CTGCCTGAGGCAGGGGAGGGAGG - Intronic
963468520 3:145712024-145712046 CAGCCTGGGGAGGAGGGGGGAGG - Intergenic
963791120 3:149583448-149583470 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
963926608 3:150957768-150957790 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
964067735 3:152598651-152598673 CAGCCTGAGGAGGAGGGGAGAGG - Intergenic
964203717 3:154147297-154147319 CATCCTCAGGAGGCTGAGGCAGG + Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
965096344 3:164232143-164232165 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
965590314 3:170356662-170356684 CAGCCTGGTGGGGTGGAGGCAGG + Intergenic
966006523 3:175020515-175020537 CAGCCTGATGAAGGGGAGAATGG - Intronic
966789703 3:183655817-183655839 GAGGCTGAGGAGGCTGAGGCAGG + Intronic
966879393 3:184341452-184341474 CACCCAGAGGAGATGGAGGCAGG - Intronic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967036024 3:185648878-185648900 GAGCCTGTGGAGGGGGAGTTAGG + Intronic
967055232 3:185824734-185824756 CGGCCTGAGCGGGGCGAGGCGGG + Intronic
967149736 3:186637584-186637606 CTGAGTGAGGAGGGAGAGGCAGG - Intronic
967993638 3:195150599-195150621 CACCCTGAGGAGGAAGCGGCAGG - Intronic
968074713 3:195810055-195810077 CACCGTGAGGACGTGGAGGCCGG - Intronic
968362545 3:198157510-198157532 GGTCCTGAGGAGGAGGAGGCTGG - Intergenic
968405532 4:336846-336868 CGGCCTGGGGTGGGGGCGGCGGG + Intergenic
968446666 4:655568-655590 CAGCCTGGGGAGGAGGAAGAAGG + Intronic
968506822 4:974561-974583 CAGTCTGAGGAGGGAGGAGCAGG + Intronic
968547506 4:1206401-1206423 CTGCCAGGGCAGGGGGAGGCCGG + Intronic
968577839 4:1376217-1376239 CAGCCTGAGGAGGGGGCTGCCGG + Intronic
968578150 4:1377439-1377461 CAGTGTGAGGAGGGAGGGGCTGG + Intronic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
968900785 4:3430799-3430821 CAGTCTCAGGAAGTGGAGGCCGG + Exonic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969054563 4:4393538-4393560 CAGCCACAGGAGGTAGAGGCAGG - Intronic
969432501 4:7163938-7163960 CAGACTCAGGAGGCTGAGGCAGG + Intergenic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
969469618 4:7379953-7379975 CAGACTGGGGATGGGGAGCCAGG - Intronic
969629807 4:8329558-8329580 CAGCTGGAGGAGGGGGAGCTAGG - Intergenic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
969720264 4:8889656-8889678 CAACCAGAGGAGGCAGAGGCTGG + Intergenic
969823165 4:9735798-9735820 CACCCTGAGAAGGGGGCAGCGGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970437424 4:16049006-16049028 CACCCTGATGATGGGGCGGCTGG + Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
970601137 4:17641978-17642000 CAGCCGCAGTAGGGGGAGGGGGG + Intronic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
973118474 4:46489318-46489340 CAGGCTGAGGAAGAGTAGGCAGG - Intergenic
973798110 4:54449408-54449430 CAGCCAGAGGAAGGAGAGGTGGG + Intergenic
973824480 4:54691548-54691570 CAGCCTAAGGAGAGGCAGGTTGG + Intronic
973921389 4:55689050-55689072 CAGCCTGTAGAGGCTGAGGCAGG + Intergenic
973973610 4:56240312-56240334 CAGACTGGGGAGGGGGAGTAGGG + Intronic
976597591 4:86908621-86908643 AAGGTTGAGGAGGGGGAGGGAGG - Intronic
976610363 4:87024700-87024722 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
978233010 4:106423703-106423725 CAGCCTCAGGAGGCTGAGGTGGG + Intergenic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
978279029 4:106987542-106987564 CTGCCTGAGGAAAGGGACGCAGG + Intronic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
978521362 4:109619176-109619198 GAGGCTGAGGAGGCTGAGGCAGG - Intronic
979259892 4:118636095-118636117 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
979328492 4:119404530-119404552 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
979721168 4:123902118-123902140 CAGCCTGGGGAGGATGAAGCTGG - Intergenic
979721181 4:123902170-123902192 CATCCTGAGGATGAGGAGGGAGG + Intergenic
980755332 4:137151114-137151136 CTGACTCAGGAGGGTGAGGCAGG - Intergenic
981431336 4:144664311-144664333 CAGCATGTGGAGGAGGATGCAGG + Intronic
981531732 4:145760856-145760878 CAGTCTGAGGTCGGGGAGGGTGG + Exonic
981692642 4:147526696-147526718 CAGCCTTAGGAGGCCGAAGCAGG + Intronic
981786303 4:148483101-148483123 CAGACTGGGGTGGGGGAGGATGG - Intergenic
982318709 4:154057912-154057934 CAGCCTGAGGAGGAGGGGAGAGG - Intergenic
982334073 4:154214457-154214479 CAGCATGAGGGTGGGGAGGTGGG + Intergenic
982473943 4:155827295-155827317 TAGGCTGAGGAGGAGGAGACAGG - Intergenic
983295267 4:165859018-165859040 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983772094 4:171563635-171563657 TAGCCTGAGGTGGGGGCGGGGGG - Intergenic
983904311 4:173168754-173168776 GAGCCGGAGGAGGGGGAAGGAGG + Exonic
983933775 4:173481569-173481591 GAGGATGTGGAGGGGGAGGCAGG - Intergenic
984298223 4:177881289-177881311 CAGTTTGTGGAGGGGGAAGCAGG + Intronic
984867618 4:184295427-184295449 GATCCTTAGAAGGGGGAGGCAGG + Intergenic
984973305 4:185209565-185209587 CAGCCTGACGCGGGCGGGGCGGG - Intronic
985159295 4:187027492-187027514 CAGCCTGAGGGTTGGAAGGCTGG + Intergenic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
985312566 4:188617953-188617975 AAGCCTGAGGAGGAGCAGGGAGG - Intergenic
985549311 5:524993-525015 GAGCCTGGGGTGGGGGATGCTGG - Intergenic
985665681 5:1180601-1180623 AAGCCTGAGGCGGGGGATGGGGG + Intergenic
985697276 5:1347750-1347772 CAGCCTTGGGAGGGGGATGGAGG + Intergenic
985708049 5:1412905-1412927 CCGCGTGGGGTGGGGGAGGCAGG + Intronic
985720419 5:1485916-1485938 CAGCCCGAGGATGCAGAGGCGGG - Intronic
985942502 5:3150006-3150028 CACCCATAGGAGCGGGAGGCCGG + Intergenic
986378496 5:7159413-7159435 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
986476454 5:8139037-8139059 AAGCATGAGGAAGGGGAAGCAGG + Intergenic
986707796 5:10465909-10465931 GAGTCTTAGGAGGGGTAGGCAGG - Intronic
986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG + Intergenic
987065355 5:14284912-14284934 CAGCCTAAGCAGGAAGAGGCAGG - Intronic
987358908 5:17088988-17089010 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
987489547 5:18560256-18560278 GTGCCTGAGGAGGCTGAGGCAGG - Intergenic
988228796 5:28448392-28448414 CAGGCTGAGGAAGAGAAGGCAGG - Intergenic
988547521 5:32172747-32172769 CTGCCTCAGGAGGCTGAGGCAGG + Intronic
990450753 5:55929799-55929821 CATCCTGCGGAGGGTGAGGGAGG - Intergenic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
992102274 5:73419308-73419330 CACCCTTAGGAGGGGGTGGCAGG - Intergenic
993055099 5:82971797-82971819 CAGCCATAGGAGGTGGAGGAGGG + Intergenic
993902397 5:93593530-93593552 CAGCCACAGGAGGGAGAGACAGG - Intronic
995069322 5:107899804-107899826 AATCCTGAGGAGGGGGAGTGAGG + Intronic
995870014 5:116734663-116734685 CAGCCCAAGGAGGCAGAGGCAGG + Intergenic
996212552 5:120829771-120829793 CTGCCTCAGGAAGGTGAGGCAGG - Intergenic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
996410256 5:123151310-123151332 CAGCATGGGGAGGGGGAAGTGGG - Intronic
997211499 5:132079669-132079691 CTGACTGAGGCTGGGGAGGCGGG - Intergenic
997531976 5:134587055-134587077 GGGACAGAGGAGGGGGAGGCTGG - Intergenic
997635379 5:135400187-135400209 CAGCCTGAGGACTGGGGGGTGGG - Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998481923 5:142470008-142470030 CAGCCAGAGGAGGGTAAGGGTGG - Intergenic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
998673096 5:144375920-144375942 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
998887109 5:146706165-146706187 CAGCCGTAGGAGGGGCAGGCTGG + Intronic
999257049 5:150215594-150215616 CAGCCTGGGGAGAAAGAGGCTGG + Intronic
999473254 5:151874925-151874947 GAGCATGAGGAGGGGAAGGAAGG + Intronic
999974141 5:156894117-156894139 AAGCCTGAGGTGGGGTAGGTGGG - Intergenic
1000285084 5:159819903-159819925 AACTCTGAGGATGGGGAGGCTGG - Intergenic
1000772683 5:165376339-165376361 CAAGCTGCTGAGGGGGAGGCTGG + Intergenic
1001081832 5:168672920-168672942 AAGGGTGAGAAGGGGGAGGCAGG - Intronic
1001199753 5:169705385-169705407 CAACTTGAGGCGGTGGAGGCAGG + Intronic
1001652640 5:173327030-173327052 GCGCCAGAGGAGGGGGAGGGTGG + Intronic
1002168650 5:177363092-177363114 CAGCCGGGGGAGGAGGAGCCCGG + Intronic
1002427589 5:179185363-179185385 CCGCCTGAGCAGGGAGAGGCTGG + Intronic
1002436408 5:179234527-179234549 GAGCCTGGGGAGGTGCAGGCTGG - Intronic
1002455855 5:179345106-179345128 ACGCCTGGGGAGGGGGCGGCGGG + Intronic
1002968684 6:1992370-1992392 TAGCCTGAAGAAGGGGAGGGAGG - Intronic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003175473 6:3750515-3750537 CAGGCTGAGGGGGTGGAAGCCGG - Intronic
1003318207 6:5030343-5030365 CAGCCTGGGGTGGGGAAGGTGGG - Intergenic
1003322457 6:5063778-5063800 CAGCCTGAAGAGGGGCTGGGTGG - Intergenic
1003364122 6:5456617-5456639 CAGCCTCATGAGGCTGAGGCAGG + Intronic
1003405079 6:5821316-5821338 CAGCCTGGGGATGGGGAGGAGGG - Intergenic
1004318408 6:14612437-14612459 CAGCCTGAGGAGGGTGGGAGGGG + Intergenic
1004446688 6:15706592-15706614 TAGGCTGAGGAGGAGGAGGGAGG - Intergenic
1004516065 6:16323270-16323292 CAGCTTTAGGAGGCTGAGGCGGG + Intronic
1004591891 6:17059829-17059851 CAGCTTGAAGAGGGAGAGGAAGG - Intergenic
1004680853 6:17892925-17892947 GAACCTGAGGAGGGGGACACGGG + Intronic
1005380789 6:25232170-25232192 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005629320 6:27692951-27692973 GAGGCTGAGGAGGCTGAGGCAGG + Intergenic
1005661953 6:28007397-28007419 CAGTCTCAGGAGGCTGAGGCAGG - Intergenic
1005959359 6:30684868-30684890 GAGGCTGAGAAGGAGGAGGCGGG - Exonic
1005990115 6:30897289-30897311 CTGCCTGAGGTGGGGCAGGGGGG + Intronic
1006205643 6:32339714-32339736 ACACCTGAGGAGGGGGAGGAGGG - Intronic
1006376931 6:33676888-33676910 AAGGGTGAGGAGGTGGAGGCAGG + Exonic
1006555008 6:34858539-34858561 CTGCCAGCGGAGGGGTAGGCAGG - Exonic
1006558578 6:34889572-34889594 CAGACTGGAGAGGGGGTGGCTGG - Exonic
1006563138 6:34931123-34931145 CAGCCTTGGGAGGCTGAGGCGGG - Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006639741 6:35483777-35483799 CAGCCTGATGTGGTGGAGGGAGG - Intronic
1006716305 6:36122950-36122972 AAGCCTGTGGAGGGGGAAGCGGG + Intergenic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1006981949 6:38154268-38154290 CAGGCAGAGGAGGGGGCGGGGGG - Exonic
1007125563 6:39422970-39422992 CACCTTGAGGAGGGGCAGGAAGG + Intronic
1007181394 6:39931803-39931825 CTGCCTGTGGCGGGGGAAGCAGG - Intronic
1007345805 6:41228640-41228662 CAGCCTGTGATGGGGGAGGTTGG + Intronic
1007352195 6:41282082-41282104 CATCCTTGGGAGGGGGAGTCAGG + Intronic
1007387358 6:41528830-41528852 CAGCCTGGTGAGAGGGATGCGGG + Intergenic
1007414657 6:41684515-41684537 CAGCCTGAAGGGTGGGAGGGAGG + Exonic
1007433033 6:41787370-41787392 CAGCCTGTGGAGGTGGGGGTAGG - Exonic
1007576031 6:42925649-42925671 CAGCCTGCAGAGGAGGAGGCAGG - Exonic
1007967163 6:46014029-46014051 CAGCCTGGGGTGGGGGTGGGGGG + Intronic
1008526101 6:52408686-52408708 CAGCCTGAGGGCCAGGAGGCTGG + Intergenic
1010035696 6:71323730-71323752 CAGCCTGGTGAGGGGGAGTAAGG - Intergenic
1011099708 6:83708431-83708453 CAGCGCGAGGAGGAGGAGGGAGG - Intronic
1011114657 6:83876943-83876965 CAGACTGGGGAGGCTGAGGCAGG - Intronic
1011746776 6:90413937-90413959 CAGCTTGAGAGGGGAGAGGCTGG + Intergenic
1012011228 6:93788603-93788625 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1012602958 6:101120290-101120312 CAACCTCAGGAGGGAGAGGGTGG + Intergenic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1013013721 6:106142841-106142863 CATCCTGAGCTGGGGGTGGCAGG + Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1015123027 6:129721958-129721980 CAGGATGGGGAAGGGGAGGCAGG + Intergenic
1015397084 6:132746929-132746951 CATCATGATGAGGGTGAGGCAGG - Intronic
1015539121 6:134296954-134296976 CAGCCGCAAGAGGGGCAGGCTGG + Intronic
1016614759 6:146033166-146033188 GAGCCTGTCAAGGGGGAGGCAGG + Intronic
1016733547 6:147451805-147451827 TAGCATGAGGAGGGGGAGTAAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016908446 6:149173869-149173891 CTGCCTGGGGCAGGGGAGGCAGG + Intergenic
1017256881 6:152343638-152343660 GAGGCTGAGGAGGCTGAGGCAGG - Intronic
1017428030 6:154342624-154342646 GGGGCTGAGGAGGGGGAGGCAGG + Intronic
1017536006 6:155348868-155348890 TAGCCTTAGAAGGGGGTGGCTGG + Intergenic
1018025229 6:159800436-159800458 GAGCTTGAGGAGGGGGTGGCGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018181629 6:161228251-161228273 CAGCCTGTAGCAGGGGAGGCAGG + Intronic
1018713827 6:166516418-166516440 AAGCCAGGGGTGGGGGAGGCAGG + Intronic
1018770269 6:166964522-166964544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1018813475 6:167314449-167314471 CAGCCTGAGGCGAAGTAGGCAGG - Intronic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019041443 6:169109261-169109283 CATCCTGAAGTAGGGGAGGCAGG - Intergenic
1019190661 6:170248997-170249019 CAGCCGCTGGAGGGGAAGGCAGG - Intergenic
1019253137 7:31197-31219 GGTCCTGAGGAGGAGGAGGCTGG + Intergenic
1019274709 7:169939-169961 CGGGCTGAGGAGGGGCTGGCAGG - Intergenic
1019350788 7:553011-553033 CAGCCTGCGGACGGCGGGGCTGG + Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019494755 7:1332514-1332536 CAGCCCTAGGAGAGGGAGCCAGG - Intergenic
1019496352 7:1342229-1342251 CAGCCTGAGCTGGGGTGGGCTGG + Intergenic
1019631697 7:2052984-2053006 CAGCCTGAGGAGGGAACGGGTGG + Intronic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019779127 7:2929440-2929462 CAGCCTGGGGAACGGGCGGCAGG - Intronic
1019807882 7:3141933-3141955 CAGCCTCAGGAGGCTGAGGTGGG + Intronic
1019908389 7:4082136-4082158 CCACCTGAGGAGGGGGCGTCTGG + Intronic
1019969308 7:4527400-4527422 CAGCCTTGGGAGGCCGAGGCTGG + Intergenic
1020137287 7:5594314-5594336 CAGCGGGAGGAGGTGGAGGAAGG - Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020448436 7:8295028-8295050 CCTACTGAGGAGGCGGAGGCAGG - Intergenic
1021346973 7:19540612-19540634 CAGCCTGAGGCTGGAGAGGATGG + Intergenic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021674201 7:23064134-23064156 CAGCCTGAGGGGGCAGAGACAGG - Intergenic
1021906392 7:25338478-25338500 CAGCCTGAGCAGGGGAATGGGGG + Intergenic
1022222193 7:28324359-28324381 CAGCTTCAGGAGGGGGAGTGGGG - Intronic
1022362362 7:29674455-29674477 CATTCTGAGGAGGGTGAGACTGG + Intergenic
1022438623 7:30413702-30413724 CAGCCTGAGGGGTGAAAGGCCGG + Intergenic
1022467257 7:30660387-30660409 GAGCATGAGGAAGGGAAGGCCGG + Intronic
1022699033 7:32739293-32739315 CATTCTGAGGAGGGTGAGACTGG - Intergenic
1022859959 7:34357634-34357656 CAGCCTGATGAGGAGTGGGCTGG - Intergenic
1023289730 7:38656633-38656655 CAGCCACAGGAGGGGCAGGCTGG - Intergenic
1023401611 7:39795719-39795741 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1023862692 7:44225620-44225642 CGGCTCGAGGAGGGGGATGCAGG - Intronic
1023980585 7:45067774-45067796 CAGCCTCAGGAGGGAGAAGAAGG - Intronic
1024044805 7:45579352-45579374 CAGCCAGAGGAGGGGCCAGCAGG - Intronic
1024075592 7:45816341-45816363 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1024648007 7:51384956-51384978 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1024676860 7:51645207-51645229 GAGCCTGAGCAGGGTGGGGCTGG - Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1025051861 7:55739452-55739474 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025128819 7:56365120-56365142 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025177200 7:56808001-56808023 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025195342 7:56928099-56928121 CAGCCTGTGGAGGGAGGTGCAGG - Intergenic
1025676610 7:63648844-63648866 CAGCCTGTGGAGGGAGGTGCAGG + Intergenic
1025694592 7:63768385-63768407 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1025933372 7:66014147-66014169 CAGCCAGTAGAGGGAGAGGCAGG - Intergenic
1025950429 7:66141130-66141152 CAGCCAGAAGAGGGAGCGGCAGG + Intronic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1026596317 7:71736798-71736820 GGGCCTGAGTGGGGGGAGGCGGG - Intergenic
1026690638 7:72547497-72547519 CAGCCTGAAGCAGGGGAAGCCGG + Intergenic
1026869725 7:73842766-73842788 CTGACGGTGGAGGGGGAGGCCGG - Intergenic
1026896175 7:74011192-74011214 GAGCCTGCAGAGGGGGTGGCAGG + Intergenic
1026944341 7:74306467-74306489 CATCCTGGGGCGAGGGAGGCAGG - Intronic
1027459721 7:78437048-78437070 CAGACTGAGGTGTGGGAGCCTGG + Intronic
1028134266 7:87209952-87209974 GAGACAGAGGAGGGGGAGGGGGG + Intronic
1028897481 7:96058744-96058766 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1029155635 7:98515689-98515711 CTCCCTGTGTAGGGGGAGGCAGG - Intergenic
1029205935 7:98869524-98869546 CAGCCTGGGGGGGTGGAAGCAGG + Intronic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1029549744 7:101231461-101231483 GAGGCTGAGGCGGGGGAGGGGGG - Intergenic
1030425995 7:109379139-109379161 AGGCCTGAGGAGAGGGAGACAGG - Intergenic
1031586298 7:123534964-123534986 GAGCCAGAGGAGGGGGATGGGGG + Intronic
1031685755 7:124730685-124730707 CAGCCTGAGGAGGAGGGGAAAGG - Intergenic
1031919042 7:127588297-127588319 GAGCCAGAGCCGGGGGAGGCGGG + Intronic
1031998078 7:128245957-128245979 GAGGCTGAGGAGGCTGAGGCAGG + Intronic
1032094482 7:128931160-128931182 CAGCCGGGGTAGGGGGTGGCAGG + Intergenic
1032157486 7:129480828-129480850 CAGCCTCAGGAGGTTGATGCAGG - Exonic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032545490 7:132738236-132738258 GGGCCTGGGGAGGGCGAGGCAGG + Intergenic
1032579588 7:133091909-133091931 CAGCCTTGGGAGGTTGAGGCAGG + Intergenic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1032865182 7:135917698-135917720 CATCCTCAGGAGAGGGAAGCAGG + Intergenic
1033246139 7:139717855-139717877 CAGCCTTTGGAGGCTGAGGCAGG - Intronic
1033494145 7:141876953-141876975 CAGTGTGGGGAGGGGCAGGCAGG + Intergenic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1033945336 7:146709728-146709750 CAGGCTGAGGAGGGCCAGACTGG + Intronic
1034436323 7:151064377-151064399 CAGGCAGGGGAGGGGGAGGTGGG + Intronic
1034994498 7:155569679-155569701 CAGGGTGTGGAGGGGAAGGCAGG - Intergenic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035259348 7:157651896-157651918 CACTCAGAGGAGGGAGAGGCAGG - Intronic
1035280779 7:157776696-157776718 GAGGCGGAGGAGAGGGAGGCAGG - Intronic
1035519644 8:266337-266359 TCACCTGAGGAGGGGGCGGCCGG + Intergenic
1035519680 8:266437-266459 CCACCTGGGGAGGGGGCGGCCGG + Intergenic
1035519732 8:266605-266627 CCACCTGCGGAGGGGGTGGCAGG + Intergenic
1035583786 8:756740-756762 CAGGGTGAGGAGGGTGTGGCTGG - Intergenic
1035587164 8:785559-785581 GGGCCTGAGGGGAGGGAGGCCGG - Intergenic
1036690114 8:10939920-10939942 CACCTGGGGGAGGGGGAGGCTGG - Intronic
1036709469 8:11068931-11068953 CAGCCTGGGGAGGGGCAGATGGG - Intronic
1038039865 8:23715438-23715460 CAGCCAGTGGAGGGGGTGGGTGG - Intergenic
1038444603 8:27594735-27594757 CATCATGAGGAGGGGGTGACAGG - Intergenic
1038624929 8:29182501-29182523 CAGCCTAAGGGGGCGGAGGAGGG + Intronic
1038828628 8:31033384-31033406 CAGGCTGTGCCGGGGGAGGCGGG - Exonic
1038913096 8:31989133-31989155 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1039577777 8:38638328-38638350 CAGCCTTGGGAGGCTGAGGCAGG - Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1039869475 8:41533408-41533430 CAGCTAGAGGATGGGGCGGCGGG + Intronic
1040391578 8:46954948-46954970 CTGCAGGAGGAGGGTGAGGCCGG + Intergenic
1040427836 8:47307330-47307352 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1040647930 8:49421119-49421141 CAACCTGAGGAGGAGCAGTCTGG - Intergenic
1041260629 8:56018239-56018261 CTGCCTTAGGAGGCCGAGGCAGG - Intergenic
1041277570 8:56178705-56178727 CAGCCCTAGGACGGGGAGACTGG - Intronic
1041670325 8:60485299-60485321 CAGCCTGTATAGGGGAAGGCAGG + Intergenic
1041926142 8:63238636-63238658 CAGCCTCAGGAGGCTAAGGCAGG - Intergenic
1042807664 8:72789509-72789531 CAGGTAGAGAAGGGGGAGGCAGG + Intronic
1047021212 8:120776698-120776720 CAGGCTTATGAGGGGGAAGCAGG - Intronic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1047757801 8:127932009-127932031 AAGCCTGAGGATGGGGTGGGAGG - Intergenic
1047762295 8:127963181-127963203 CAGCCTGGGCAGGGGCAGGAAGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048498227 8:134953377-134953399 CAGCCTGTGGAGATTGAGGCTGG - Intergenic
1048545735 8:135385587-135385609 CCACATGAGGAGGGGGATGCAGG + Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1048573187 8:135671644-135671666 CAGCCTGAGGAGGCAGGGGCTGG + Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049250791 8:141588011-141588033 AAGCCAGAGGAGGGGAAGGCAGG + Intergenic
1049288303 8:141788444-141788466 CATGCTGGGGAGGGGGTGGCTGG - Intergenic
1049352887 8:142173499-142173521 CAGACTCAGGTGGGTGAGGCTGG - Intergenic
1049389470 8:142360580-142360602 CAGCCTGAGGGGCTGGTGGCTGG - Intronic
1049408875 8:142463704-142463726 AAGCCTGAGCAGGGAGGGGCTGG - Intronic
1049519573 8:143081017-143081039 CAGCCTGAGTGGGGTGAGGTGGG - Exonic
1049567332 8:143347940-143347962 CACGCTGAGGAGGGTGAGGAGGG + Intronic
1049804992 8:144534645-144534667 CAGCCAGTGCTGGGGGAGGCAGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049976933 9:868929-868951 GAGCCTGGGGAGGTTGAGGCTGG + Intronic
1050140373 9:2511044-2511066 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1050474066 9:6021605-6021627 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1051668136 9:19484462-19484484 CAGCCGGAGAAGCTGGAGGCTGG + Intergenic
1053170065 9:35872057-35872079 GAGTCAGGGGAGGGGGAGGCTGG - Intergenic
1053412655 9:37925628-37925650 GAGCCTGAGTAGGGAGGGGCAGG - Intronic
1054175063 9:61869196-61869218 CGGCCTGGGGGAGGGGAGGCGGG + Intergenic
1054329363 9:63736493-63736515 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1054662474 9:67711597-67711619 CGGCCTGGGGGAGGGGAGGCGGG - Intergenic
1054731877 9:68709309-68709331 GAGCCTGGGGAGGTTGAGGCTGG - Intronic
1055075739 9:72213314-72213336 CAGCCTGAGAATGGGGATGGGGG + Intronic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1055599560 9:77901519-77901541 CGGCCTAAGGAGGAAGAGGCAGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056764468 9:89436408-89436430 CTGCGTGAGGATGGGGCGGCGGG - Intronic
1056934949 9:90909283-90909305 AAGGCTGAGAATGGGGAGGCAGG - Intergenic
1056999705 9:91496503-91496525 CAGCCTTGGTAGGGAGAGGCTGG + Intergenic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1057803739 9:98206098-98206120 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1058396182 9:104556980-104557002 CAGCCTTGGGGAGGGGAGGCGGG - Intergenic
1058419414 9:104820066-104820088 CAGCCTGGGGACAGGGAGGCAGG + Exonic
1059386920 9:113971789-113971811 CAGTCAGAGGAGGGGTAGGGTGG + Intronic
1059409731 9:114124374-114124396 GAGGCAGAGGAGGGGGAGGAGGG + Intergenic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059679467 9:116572195-116572217 CAGCCTGGGGAGGAGAAGGCAGG - Intronic
1059757237 9:117304872-117304894 CAGGCTGAGGGTGGGGAGGAGGG + Intronic
1059935365 9:119304875-119304897 CAGCCTGAGGAGTGGGAGAAAGG - Intronic
1060209287 9:121700056-121700078 CAGCCTGAGGCTGGGGAGCCAGG + Intronic
1060215624 9:121736710-121736732 CAGCCAGAGCAGTGGAAGGCAGG - Intronic
1060402632 9:123357312-123357334 CAGCCTGTGGTGGTGGGGGCAGG - Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1060734567 9:126058879-126058901 GAGCCTGCGGAGGGACAGGCCGG - Intergenic
1060798133 9:126526469-126526491 AAGCCTCAGGAGCTGGAGGCTGG + Intergenic
1060962580 9:127691515-127691537 CAGGCTGTGGAGGAGGACGCTGG - Exonic
1061431210 9:130532582-130532604 CAGCCTGAGGCTGGGCATGCTGG - Intergenic
1061605622 9:131708474-131708496 CAGCTTGAGGAGGAGGAAGTTGG - Intronic
1061916905 9:133760093-133760115 CTGCGTGAGGAGGGTGGGGCCGG + Intergenic
1061935635 9:133856124-133856146 CTGCCTGAGGCTGGGGAGGGCGG + Intronic
1061955619 9:133959837-133959859 CCGCAGGAGGTGGGGGAGGCAGG + Intronic
1062048584 9:134435676-134435698 CAGGCGGGGGAGGGGGAGTCAGG - Intronic
1062049682 9:134440843-134440865 CAGCCTGGGGAGGGACAGGTGGG - Intergenic
1062173341 9:135147586-135147608 GAGCCAGAGGAGGAGGAGGTCGG - Intergenic
1062192166 9:135253624-135253646 GAGCATGAGGGCGGGGAGGCTGG - Intergenic
1062309103 9:135926438-135926460 CAGCCTAAGGAGGGGCCTGCAGG - Intergenic
1062452419 9:136621210-136621232 GAGCCTGCGGAGAGGGCGGCCGG - Intergenic
1062491019 9:136804950-136804972 CAGCCTCTGGAGGGAGAGGCAGG - Intronic
1062544608 9:137055827-137055849 TCGCCTGCGGAGGGAGAGGCAGG + Intergenic
1062613010 9:137383395-137383417 CAGCCGTGGGAGGGAGAGGCAGG + Intronic
1062747233 9:138221169-138221191 GGTCCTGAGGAGGAGGAGGCTGG - Intergenic
1202796150 9_KI270719v1_random:121848-121870 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1185728042 X:2438554-2438576 CTGCCTCAGGAGGGTGAGGCAGG + Intronic
1185756275 X:2655490-2655512 CTCCCAGAGGAGGGGGAGACTGG + Intergenic
1186350845 X:8737715-8737737 CAGCCTCGGGAGGCTGAGGCAGG + Intergenic
1186680124 X:11864123-11864145 CAGGCAGAGGAGGGGAAGACTGG + Intergenic
1187009759 X:15267299-15267321 CTGCCTCAGGAGGGAGAGGCAGG - Intronic
1187415842 X:19092651-19092673 CTGGGTGAGGAGGGTGAGGCTGG - Intronic
1187447630 X:19373014-19373036 GAGCAGAAGGAGGGGGAGGCGGG + Intronic
1188890956 X:35610734-35610756 CAACCTGAGGAGGAGCAGTCTGG - Intergenic
1189095509 X:38134540-38134562 CAGGCTGAGGAGTGGGCTGCTGG + Intronic
1189289652 X:39876098-39876120 CAGCCCTGGGAGTGGGAGGCTGG - Intergenic
1189893697 X:45632245-45632267 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1190055386 X:47178457-47178479 CAGCATGAAGAGGGGCAGGTCGG - Intronic
1190941080 X:55041720-55041742 CAGCCACAGTAGGGGTAGGCTGG + Intergenic
1191220843 X:57986153-57986175 CAGCCGCAGGAGGGGCAGGCTGG - Intergenic
1191758788 X:64624595-64624617 CAGCCACAGGAAGGGGAGGTTGG - Intergenic
1192212699 X:69137702-69137724 CAGCCTGGGGTGGGGGTGGAAGG - Intergenic
1192225166 X:69222649-69222671 CACCAGGAGGAGGGGGTGGCTGG - Intergenic
1192369670 X:70503041-70503063 CAGCCTGAGGCCGGAGAGGAAGG + Exonic
1193516987 X:82478265-82478287 CAGCCTGAGGATCTGGAGGGAGG - Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194959969 X:100223903-100223925 CTGTCTGAGGAGGGGAAGACTGG - Intergenic
1195418534 X:104647169-104647191 CAGCCTGCAGAGGTGCAGGCAGG + Intronic
1195633570 X:107087715-107087737 CAGCTTGTGGAGGCTGAGGCAGG - Intronic
1196016456 X:110944898-110944920 CAGCCTGGGGAAGTGGATGCAGG - Intronic
1196300625 X:114046803-114046825 GAACCTGAGGAGGGGGTGGTGGG + Intergenic
1196799276 X:119528077-119528099 TAGCCTGGGGAGGGGGAAGGAGG - Intergenic
1197708120 X:129648347-129648369 CTGCCTGGGGTTGGGGAGGCTGG - Intronic
1198052283 X:132960765-132960787 CAGCATGAGGGGGTGGAGGAAGG - Intronic
1198180111 X:134199227-134199249 CAGCCTTCGGAGGCTGAGGCAGG - Intergenic
1199764274 X:150929654-150929676 CTGCCTGGGGAGGCTGAGGCAGG - Intergenic
1199798638 X:151227807-151227829 CTGCCAGAGGAGGGAGAGCCGGG - Intergenic
1200292469 X:154886283-154886305 CAGCCCGCCGAGGGGGACGCAGG + Intronic
1200339313 X:155382023-155382045 CAGCCCGCCGAGGGGGACGCAGG + Intergenic
1200347157 X:155458670-155458692 CAGCCCGCCGAGGGGGACGCAGG - Exonic
1200749447 Y:6931285-6931307 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1201486141 Y:14496479-14496501 CAGCCTCAAGAAGAGGAGGCAGG - Intergenic