ID: 933724557

View in Genome Browser
Species Human (GRCh38)
Location 2:85419095-85419117
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724557_933724562 -9 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
933724557_933724563 -8 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724563 2:85419110-85419132 AGGACTCGTGGTGAAGCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 59
933724557_933724573 24 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724573 2:85419142-85419164 GTCCTCCAGGTCAGGGATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 286
933724557_933724571 17 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724571 2:85419135-85419157 GGCCTGGGTCCTCCAGGTCAGGG 0: 1
1: 0
2: 0
3: 28
4: 319
933724557_933724569 11 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724569 2:85419129-85419151 GGGGAAGGCCTGGGTCCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 436
933724557_933724561 -10 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724561 2:85419108-85419130 GCAGGACTCGTGGTGAAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 135
933724557_933724566 2 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724566 2:85419120-85419142 GTGAAGCCCGGGGAAGGCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 224
933724557_933724565 1 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724565 2:85419119-85419141 GGTGAAGCCCGGGGAAGGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 332
933724557_933724570 16 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724570 2:85419134-85419156 AGGCCTGGGTCCTCCAGGTCAGG 0: 1
1: 0
2: 1
3: 28
4: 317
933724557_933724564 -4 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724564 2:85419114-85419136 CTCGTGGTGAAGCCCGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724557 Original CRISPR CGAGTCCTGCCGGCCACACA GGG (reversed) Intronic