ID: 933724557

View in Genome Browser
Species Human (GRCh38)
Location 2:85419095-85419117
Sequence CGAGTCCTGCCGGCCACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724557_933724566 2 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724566 2:85419120-85419142 GTGAAGCCCGGGGAAGGCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 224
933724557_933724564 -4 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724564 2:85419114-85419136 CTCGTGGTGAAGCCCGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 120
933724557_933724569 11 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724569 2:85419129-85419151 GGGGAAGGCCTGGGTCCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 436
933724557_933724562 -9 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
933724557_933724571 17 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724571 2:85419135-85419157 GGCCTGGGTCCTCCAGGTCAGGG 0: 1
1: 0
2: 0
3: 28
4: 319
933724557_933724573 24 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724573 2:85419142-85419164 GTCCTCCAGGTCAGGGATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 286
933724557_933724565 1 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724565 2:85419119-85419141 GGTGAAGCCCGGGGAAGGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 332
933724557_933724570 16 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724570 2:85419134-85419156 AGGCCTGGGTCCTCCAGGTCAGG 0: 1
1: 0
2: 1
3: 28
4: 317
933724557_933724561 -10 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724561 2:85419108-85419130 GCAGGACTCGTGGTGAAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 135
933724557_933724563 -8 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724563 2:85419110-85419132 AGGACTCGTGGTGAAGCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724557 Original CRISPR CGAGTCCTGCCGGCCACACA GGG (reversed) Intronic
902423176 1:16298023-16298045 CGAGTCCAGCCTGGCAAACATGG + Intronic
905542150 1:38768299-38768321 TGCGTCCTGCAGGCCACCCAAGG + Intergenic
907272146 1:53297443-53297465 CGAGTCCCGCCCACCACACGCGG - Intronic
911599691 1:99834593-99834615 GGAGTCCTGCGGGACCCACATGG - Intergenic
912605781 1:110987158-110987180 AGAGTCCTGCCAGCAGCACAGGG + Intergenic
913014101 1:114715476-114715498 CTTGTCCTGCCTACCACACAGGG - Intronic
918924438 1:190763624-190763646 CGAGACCAGCCTGGCACACATGG - Intergenic
919741747 1:200985056-200985078 CCTGTCCTGCGGGCCTCACAAGG - Intronic
919950675 1:202360506-202360528 CGAGACCAGCCTGCCAAACATGG + Intronic
920297770 1:204969497-204969519 CCAGTGCAGCCTGCCACACACGG - Intronic
921065352 1:211618804-211618826 AGAGTCCTGCCGTCCAGACTTGG - Intergenic
1062815818 10:499304-499326 GGAGCCCAGCCGTCCACACAGGG - Intronic
1063535703 10:6881139-6881161 AGATGCCTGCCTGCCACACACGG + Intergenic
1064315003 10:14247146-14247168 CGATCCCCGCTGGCCACACAGGG + Intronic
1065527053 10:26633390-26633412 CAAGTCCCTCCGTCCACACATGG + Intergenic
1066429419 10:35337122-35337144 GGAGTCCTACCGGCCAGACACGG + Exonic
1067787928 10:49264476-49264498 CTGGTCCTGCTTGCCACACATGG - Intergenic
1069832823 10:71291501-71291523 GGAGTCCTGCAGGGCATACACGG - Exonic
1070539686 10:77407169-77407191 CCAGTCCTGCTTCCCACACATGG - Intronic
1071356424 10:84800907-84800929 CGAGACCTGCCTGGCAAACATGG - Intergenic
1073017741 10:100415280-100415302 CGAGACCAGCCGGACAAACATGG + Intergenic
1076406667 10:130216814-130216836 CGAGACCAGCCTGCCCCACATGG - Intergenic
1077138033 11:1011313-1011335 AGCGTCCTGCCGGCCCCGCAGGG + Exonic
1077229780 11:1453600-1453622 GGAGTCCTGCCGGACAAGCACGG - Intronic
1077753553 11:5001111-5001133 CGAGTCCAGCCTGCCCAACATGG - Intergenic
1082238839 11:49851859-49851881 CCGGTCCTCCGGGCCACACAGGG - Intergenic
1082243302 11:49892470-49892492 CCGGTCCTCCAGGCCACACACGG + Intergenic
1085187838 11:74591392-74591414 CGAGGCCTGCCAGGCCCACATGG - Intronic
1085984165 11:81765110-81765132 CGAGACCAGCCTGCCAAACATGG - Intergenic
1089402373 11:118171694-118171716 CCCGTCCTGCCGGCCAGAAAAGG - Intronic
1089579380 11:119471802-119471824 TGAGTCCTGCCGGGTACACCCGG - Intergenic
1090848234 11:130547614-130547636 CGGGTCCCTCGGGCCACACAGGG - Intergenic
1091753913 12:3039622-3039644 CGGTTCCTGCTGGCCACCCATGG + Intronic
1093021396 12:14207338-14207360 CGAGTCCCTCCTGCAACACATGG + Intergenic
1094126012 12:27022868-27022890 CAAGTCCTGGCGGCCTCACCCGG - Intronic
1099321304 12:81153205-81153227 CGAGACCAGCCTGCCAAACATGG + Intronic
1104193633 12:126508828-126508850 CGAGACCTGCCTGCCCAACATGG + Intergenic
1104614457 12:130256666-130256688 CCAGTCCCGCCGACCACCCAAGG - Intergenic
1105484915 13:20819021-20819043 CGAGACCAGCCTGCCAAACATGG - Intronic
1112343132 13:98568664-98568686 CGAGACCTGCCTGCTCCACATGG + Intronic
1112772301 13:102804512-102804534 CGAGACCAGCCTGGCACACAGGG - Intronic
1119401611 14:74366370-74366392 CGAGACCAGCCTGGCACACATGG + Intergenic
1121094243 14:91204846-91204868 CCAGTCCGGCCGGCTACCCAGGG + Intronic
1122415517 14:101547850-101547872 CAAGTCCTGCCGGCCACCGATGG - Intergenic
1122671590 14:103376924-103376946 CGAGACCAGCCTGCCCCACATGG - Intergenic
1125172586 15:36782892-36782914 AGAGTTCTGCCAGCCAGACATGG + Intronic
1126575610 15:50193392-50193414 AGAGACCTGCCTGGCACACAGGG + Intronic
1130975279 15:88769156-88769178 CGAGACCTGCCGGACACATCTGG + Intergenic
1131223873 15:90607983-90608005 CCAGTGCTGCCAGCCACTCAGGG - Intronic
1131416205 15:92260739-92260761 CGAGACCAGCCTGCCAAACATGG - Intergenic
1132753604 16:1470989-1471011 TGCTTCCTGCCGCCCACACACGG + Intronic
1136748608 16:32613926-32613948 GGATTCCTGCCAGCCACAGAGGG - Intergenic
1137602987 16:49769153-49769175 CGAGACCTGCCTGGCCCACATGG + Intronic
1141428223 16:83957216-83957238 CGAGTCCACCAGGCCACACTGGG + Intronic
1141464117 16:84195543-84195565 CAGCTCCTGCTGGCCACACAGGG + Exonic
1142240404 16:88941975-88941997 CGACCCCTGCCGGCCACGCACGG - Intronic
1203050741 16_KI270728v1_random:873140-873162 GGATTCCTGCCAGCCACAGAGGG - Intergenic
1151417304 17:73974623-73974645 TGAGACCTGCCTGCCACAGAAGG - Intergenic
1151481869 17:74374392-74374414 TGAGTCCTGCCAGCCCCACCAGG + Intergenic
1152925545 17:83085986-83086008 CACTCCCTGCCGGCCACACAGGG - Intronic
1156448341 18:37253146-37253168 CGGGCCCTGCCTGCCCCACACGG - Intronic
1161364958 19:3873316-3873338 CCATTCCTGGTGGCCACACATGG - Intergenic
1161655029 19:5509051-5509073 GGAGTCCTGCCCGTCACAGAAGG - Intergenic
1163308492 19:16497549-16497571 CGAGACCAGCCTGACACACATGG - Intronic
1163569819 19:18074545-18074567 CGAGACCAGCCGGGCAAACATGG + Intronic
1164820588 19:31248162-31248184 TGGGTCCTGCCTGCAACACATGG + Intergenic
1168235380 19:55059625-55059647 CGAGTCCAGCCTGGCAAACATGG + Intronic
1168324476 19:55530989-55531011 CGAGTCCTGTGGGCCCCACGAGG + Intronic
927380539 2:22475144-22475166 CGGGTCCTTCCCACCACACATGG - Intergenic
927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG + Intergenic
928290123 2:30029522-30029544 CGAGACCAGCCTGCCAAACATGG + Intergenic
929976351 2:46639205-46639227 CGAGACCTGCCAGGCCCACATGG + Intergenic
930806872 2:55499367-55499389 CGAGTCCAGCCTGCCCAACATGG - Intergenic
933724557 2:85419095-85419117 CGAGTCCTGCCGGCCACACAGGG - Intronic
937291796 2:120786240-120786262 AGAGTCCTGCCAACCAGACAGGG + Intronic
937472530 2:122186440-122186462 CGAGACCAGCCGGACAAACATGG + Intergenic
938386349 2:130869944-130869966 CGGGTCCCGCTGGCCACACCGGG - Intronic
940883118 2:158967582-158967604 CAATTCCCGCTGGCCACACAAGG + Intergenic
946055197 2:216895088-216895110 GGAGTCCTGCCAGGCAGACATGG - Intergenic
948855690 2:240729530-240729552 GGAGTCCTGCCTGCCTCACTGGG - Intronic
1170644805 20:18188228-18188250 CCAGTCCTGCAGACCACACAGGG - Exonic
1170811203 20:19676224-19676246 CGTGTCCTGCCAGCGACTCATGG - Intronic
1173613270 20:44386365-44386387 CGAGACCAGCCTGCCAAACATGG - Intronic
1175840905 20:62026657-62026679 CGAATCCAGCAGGCCACACTCGG + Intronic
1178297078 21:31419018-31419040 CGAGATCTGCCGGGCACACCAGG + Intronic
1180755141 22:18155836-18155858 CGAGTCCCACCGACCACCCAAGG + Intronic
1184685391 22:46094508-46094530 CCTGTCCTGGGGGCCACACAGGG + Intronic
1185269317 22:49921658-49921680 CGGGTCCTGCCGGTGCCACATGG + Exonic
1185362747 22:50418790-50418812 CCAGCCCTGCTGGGCACACAGGG - Intronic
961565102 3:127758006-127758028 CGTGTGCAGCTGGCCACACAGGG - Intronic
963969320 3:151412171-151412193 CTAGTCCTGCTGGCCACATTTGG - Intronic
964278248 3:155031857-155031879 CGAGACCGGCCTGCCAAACATGG - Intronic
967491741 3:190100031-190100053 CGAGACCAGCCGGCCCAACATGG + Intronic
970570923 4:17382080-17382102 CGAGACCAGCCGGGCCCACATGG - Intergenic
973809202 4:54553648-54553670 CAGGTCCTGCCTGCCACACAAGG + Intergenic
978785079 4:112600489-112600511 CGAGTCCTGCCTGGCCAACATGG + Intronic
980087274 4:128404029-128404051 CCATTCCTGCTGGCAACACAGGG - Intergenic
981617295 4:146655184-146655206 CGAGTCCAGGCGGCCCCAGAGGG - Intergenic
981712661 4:147724427-147724449 CGAGACCAGCCTGACACACATGG - Intergenic
985869937 5:2546192-2546214 CAAGTCCTGCCCTCGACACATGG + Intergenic
987002589 5:13675139-13675161 CGAGTCCCTCCCACCACACATGG - Intergenic
988260505 5:28881461-28881483 CGAGTCCAGCCTGGCAAACATGG - Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
996405323 5:123098272-123098294 CGAGTCCCGCCTGGCAGACACGG - Intronic
997431396 5:133843554-133843576 AGAATCCTGCCCACCACACACGG + Intergenic
997627590 5:135341525-135341547 TGGGTCCTGCCAGTCACACATGG + Intronic
998525842 5:142842549-142842571 CTAGTCCTTCCCGACACACAGGG - Intronic
1001990482 5:176112301-176112323 GGATTCCTGCCAGCCACAGAGGG - Intronic
1002226390 5:177725839-177725861 GGATTCCTGCCAGCCACAGAGGG + Intronic
1002267457 5:178045374-178045396 GGATTCCTGCCAGCCACAGAGGG - Intronic
1003546082 6:7059837-7059859 CGAGACCTGCCTGCCCAACATGG + Intergenic
1009242311 6:61197686-61197708 CTAGTCCTTCCCACCACACATGG - Intergenic
1010203061 6:73299590-73299612 GGCGCCCCGCCGGCCACACAGGG - Intronic
1013611529 6:111800406-111800428 CGAGTCCTCACAGCCACTCACGG + Intronic
1014668822 6:124273227-124273249 CAAGTCCTTCCCTCCACACATGG - Intronic
1017306246 6:152921929-152921951 CAAGTCCTTCCTGCAACACATGG - Intergenic
1019129997 6:169866369-169866391 CCAGGCCTCACGGCCACACAGGG + Intergenic
1019311008 7:360683-360705 AGAGTCGTGCCGGCCCCACGCGG + Intergenic
1019719657 7:2560320-2560342 GGAGTCCTGCTGGCCATGCAGGG + Intronic
1020339552 7:7095080-7095102 CGAGTCCTGCCTAGCATACACGG + Intergenic
1024216715 7:47254594-47254616 CGCCCCCTGCCGGCCACACCGGG + Intergenic
1024303030 7:47902408-47902430 CGAGCCCTGCCAGCCACCCCTGG - Exonic
1024639535 7:51317525-51317547 CAGGTCCTGCCGGCCACGCCGGG + Intergenic
1024996298 7:55275352-55275374 CATGTCCTGGCAGCCACACACGG + Intergenic
1029218706 7:98970768-98970790 GGAATGCTGCCTGCCACACAGGG + Intronic
1031070284 7:117154432-117154454 CTAGCCCTGTCAGCCACACAGGG - Intronic
1033951037 7:146785172-146785194 CGAGACCAGCCTGACACACATGG - Intronic
1035455622 7:159006803-159006825 CGACTCCTTCCCGCCACAGAGGG + Intergenic
1039973367 8:42338843-42338865 TCAGTCCTGCCGGCTACACCTGG + Intronic
1042302463 8:67299768-67299790 CGAGGCCAGCTGGCAACACAGGG + Intronic
1043059393 8:75480915-75480937 CGAGTCCAGCCTGCCCAACATGG - Intronic
1043145667 8:76650628-76650650 CGAGTCCTGCCTGACCAACATGG - Intergenic
1044282120 8:90368185-90368207 AGAGTGCTGCCGGCCAGGCAAGG - Intergenic
1048367850 8:133753996-133754018 CCAGTCCTCCAGCCCACACATGG - Intergenic
1049234873 8:141507485-141507507 CGGGACCTGCCACCCACACAGGG - Intergenic
1053359110 9:37470705-37470727 CGAGACCAGCCTGACACACATGG + Intergenic
1055361511 9:75495995-75496017 TGAGTCTTTCCGGCCAGACATGG - Intergenic
1057081227 9:92176098-92176120 GGAGTCCTGCTGGCTGCACAGGG + Intergenic
1060873285 9:127060117-127060139 AGAGTCCGGCTGCCCACACATGG + Intronic
1061273040 9:129554631-129554653 CGAGGCCTGAGGGCCACACAGGG + Intergenic
1061388605 9:130304849-130304871 CGAGTCCTGCCGGCCTCGACGGG + Intronic
1185844410 X:3424156-3424178 CGAGACCAGCCTGACACACATGG + Intergenic
1192342212 X:70273420-70273442 CGAGTCCAGCCTGGCCCACATGG - Intronic
1192560308 X:72123877-72123899 CCCTTCCTGCCTGCCACACATGG - Intergenic
1198105173 X:133455096-133455118 CAAGACCTCCAGGCCACACAAGG + Intergenic