ID: 933724561

View in Genome Browser
Species Human (GRCh38)
Location 2:85419108-85419130
Sequence GCAGGACTCGTGGTGAAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724557_933724561 -10 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724561 2:85419108-85419130 GCAGGACTCGTGGTGAAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 135
933724551_933724561 18 Left 933724551 2:85419067-85419089 CCTGAGACTGGACTAGGTCTGTT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 933724561 2:85419108-85419130 GCAGGACTCGTGGTGAAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 135
933724550_933724561 19 Left 933724550 2:85419066-85419088 CCCTGAGACTGGACTAGGTCTGT 0: 1
1: 0
2: 2
3: 11
4: 121
Right 933724561 2:85419108-85419130 GCAGGACTCGTGGTGAAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 135
933724548_933724561 24 Left 933724548 2:85419061-85419083 CCAGACCCTGAGACTGGACTAGG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 933724561 2:85419108-85419130 GCAGGACTCGTGGTGAAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 135
933724547_933724561 25 Left 933724547 2:85419060-85419082 CCCAGACCCTGAGACTGGACTAG 0: 1
1: 0
2: 1
3: 17
4: 162
Right 933724561 2:85419108-85419130 GCAGGACTCGTGGTGAAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724561 Original CRISPR GCAGGACTCGTGGTGAAGCC CGG Intronic