ID: 933724562

View in Genome Browser
Species Human (GRCh38)
Location 2:85419109-85419131
Sequence CAGGACTCGTGGTGAAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724547_933724562 26 Left 933724547 2:85419060-85419082 CCCAGACCCTGAGACTGGACTAG 0: 1
1: 0
2: 1
3: 17
4: 162
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
933724548_933724562 25 Left 933724548 2:85419061-85419083 CCAGACCCTGAGACTGGACTAGG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
933724558_933724562 -10 Left 933724558 2:85419096-85419118 CCTGTGTGGCCGGCAGGACTCGT 0: 1
1: 0
2: 2
3: 3
4: 68
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
933724550_933724562 20 Left 933724550 2:85419066-85419088 CCCTGAGACTGGACTAGGTCTGT 0: 1
1: 0
2: 2
3: 11
4: 121
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
933724551_933724562 19 Left 933724551 2:85419067-85419089 CCTGAGACTGGACTAGGTCTGTT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
933724557_933724562 -9 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724562 2:85419109-85419131 CAGGACTCGTGGTGAAGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724562 Original CRISPR CAGGACTCGTGGTGAAGCCC GGG Intronic