ID: 933724564

View in Genome Browser
Species Human (GRCh38)
Location 2:85419114-85419136
Sequence CTCGTGGTGAAGCCCGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724550_933724564 25 Left 933724550 2:85419066-85419088 CCCTGAGACTGGACTAGGTCTGT 0: 1
1: 0
2: 2
3: 11
4: 121
Right 933724564 2:85419114-85419136 CTCGTGGTGAAGCCCGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 120
933724548_933724564 30 Left 933724548 2:85419061-85419083 CCAGACCCTGAGACTGGACTAGG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 933724564 2:85419114-85419136 CTCGTGGTGAAGCCCGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 120
933724557_933724564 -4 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724564 2:85419114-85419136 CTCGTGGTGAAGCCCGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 120
933724551_933724564 24 Left 933724551 2:85419067-85419089 CCTGAGACTGGACTAGGTCTGTT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 933724564 2:85419114-85419136 CTCGTGGTGAAGCCCGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 120
933724558_933724564 -5 Left 933724558 2:85419096-85419118 CCTGTGTGGCCGGCAGGACTCGT 0: 1
1: 0
2: 2
3: 3
4: 68
Right 933724564 2:85419114-85419136 CTCGTGGTGAAGCCCGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724564 Original CRISPR CTCGTGGTGAAGCCCGGGGA AGG Intronic