ID: 933724565

View in Genome Browser
Species Human (GRCh38)
Location 2:85419119-85419141
Sequence GGTGAAGCCCGGGGAAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 332}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724560_933724565 -9 Left 933724560 2:85419105-85419127 CCGGCAGGACTCGTGGTGAAGCC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 933724565 2:85419119-85419141 GGTGAAGCCCGGGGAAGGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 332
933724557_933724565 1 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724565 2:85419119-85419141 GGTGAAGCCCGGGGAAGGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 332
933724550_933724565 30 Left 933724550 2:85419066-85419088 CCCTGAGACTGGACTAGGTCTGT 0: 1
1: 0
2: 2
3: 11
4: 121
Right 933724565 2:85419119-85419141 GGTGAAGCCCGGGGAAGGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 332
933724551_933724565 29 Left 933724551 2:85419067-85419089 CCTGAGACTGGACTAGGTCTGTT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 933724565 2:85419119-85419141 GGTGAAGCCCGGGGAAGGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 332
933724558_933724565 0 Left 933724558 2:85419096-85419118 CCTGTGTGGCCGGCAGGACTCGT 0: 1
1: 0
2: 2
3: 3
4: 68
Right 933724565 2:85419119-85419141 GGTGAAGCCCGGGGAAGGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724565 Original CRISPR GGTGAAGCCCGGGGAAGGCC TGG Intronic