ID: 933724566

View in Genome Browser
Species Human (GRCh38)
Location 2:85419120-85419142
Sequence GTGAAGCCCGGGGAAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724557_933724566 2 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724566 2:85419120-85419142 GTGAAGCCCGGGGAAGGCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 224
933724558_933724566 1 Left 933724558 2:85419096-85419118 CCTGTGTGGCCGGCAGGACTCGT 0: 1
1: 0
2: 2
3: 3
4: 68
Right 933724566 2:85419120-85419142 GTGAAGCCCGGGGAAGGCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 224
933724560_933724566 -8 Left 933724560 2:85419105-85419127 CCGGCAGGACTCGTGGTGAAGCC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 933724566 2:85419120-85419142 GTGAAGCCCGGGGAAGGCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 224
933724551_933724566 30 Left 933724551 2:85419067-85419089 CCTGAGACTGGACTAGGTCTGTT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 933724566 2:85419120-85419142 GTGAAGCCCGGGGAAGGCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724566 Original CRISPR GTGAAGCCCGGGGAAGGCCT GGG Intronic