ID: 933724569

View in Genome Browser
Species Human (GRCh38)
Location 2:85419129-85419151
Sequence GGGGAAGGCCTGGGTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 436}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724560_933724569 1 Left 933724560 2:85419105-85419127 CCGGCAGGACTCGTGGTGAAGCC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 933724569 2:85419129-85419151 GGGGAAGGCCTGGGTCCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 436
933724557_933724569 11 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724569 2:85419129-85419151 GGGGAAGGCCTGGGTCCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 436
933724558_933724569 10 Left 933724558 2:85419096-85419118 CCTGTGTGGCCGGCAGGACTCGT 0: 1
1: 0
2: 2
3: 3
4: 68
Right 933724569 2:85419129-85419151 GGGGAAGGCCTGGGTCCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724569 Original CRISPR GGGGAAGGCCTGGGTCCTCC AGG Intronic