ID: 933724573

View in Genome Browser
Species Human (GRCh38)
Location 2:85419142-85419164
Sequence GTCCTCCAGGTCAGGGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724568_933724573 -8 Left 933724568 2:85419127-85419149 CCGGGGAAGGCCTGGGTCCTCCA 0: 1
1: 1
2: 3
3: 40
4: 375
Right 933724573 2:85419142-85419164 GTCCTCCAGGTCAGGGATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 286
933724558_933724573 23 Left 933724558 2:85419096-85419118 CCTGTGTGGCCGGCAGGACTCGT 0: 1
1: 0
2: 2
3: 3
4: 68
Right 933724573 2:85419142-85419164 GTCCTCCAGGTCAGGGATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 286
933724560_933724573 14 Left 933724560 2:85419105-85419127 CCGGCAGGACTCGTGGTGAAGCC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 933724573 2:85419142-85419164 GTCCTCCAGGTCAGGGATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 286
933724567_933724573 -7 Left 933724567 2:85419126-85419148 CCCGGGGAAGGCCTGGGTCCTCC 0: 1
1: 0
2: 4
3: 48
4: 361
Right 933724573 2:85419142-85419164 GTCCTCCAGGTCAGGGATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 286
933724557_933724573 24 Left 933724557 2:85419095-85419117 CCCTGTGTGGCCGGCAGGACTCG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933724573 2:85419142-85419164 GTCCTCCAGGTCAGGGATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724573 Original CRISPR GTCCTCCAGGTCAGGGATGT AGG Intronic