ID: 933724842

View in Genome Browser
Species Human (GRCh38)
Location 2:85420865-85420887
Sequence TCCCCACAGTGGCCCGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724834_933724842 3 Left 933724834 2:85420839-85420861 CCTCTCCCGTGGAACGACTGCTT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724836_933724842 -2 Left 933724836 2:85420844-85420866 CCCGTGGAACGACTGCTTAGGTC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724833_933724842 4 Left 933724833 2:85420838-85420860 CCCTCTCCCGTGGAACGACTGCT 0: 1
1: 0
2: 0
3: 4
4: 45
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724829_933724842 22 Left 933724829 2:85420820-85420842 CCTCACCACCAGGGGTCGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724830_933724842 17 Left 933724830 2:85420825-85420847 CCACCAGGGGTCGCCCTCTCCCG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724827_933724842 26 Left 933724827 2:85420816-85420838 CCCTCCTCACCACCAGGGGTCGC 0: 1
1: 0
2: 1
3: 16
4: 176
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724826_933724842 27 Left 933724826 2:85420815-85420837 CCCCTCCTCACCACCAGGGGTCG 0: 1
1: 0
2: 1
3: 13
4: 186
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724828_933724842 25 Left 933724828 2:85420817-85420839 CCTCCTCACCACCAGGGGTCGCC 0: 1
1: 0
2: 4
3: 13
4: 175
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724837_933724842 -3 Left 933724837 2:85420845-85420867 CCGTGGAACGACTGCTTAGGTCC 0: 1
1: 0
2: 0
3: 6
4: 48
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196
933724831_933724842 14 Left 933724831 2:85420828-85420850 CCAGGGGTCGCCCTCTCCCGTGG 0: 1
1: 0
2: 1
3: 7
4: 117
Right 933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724842 Original CRISPR TCCCCACAGTGGCCCGGGAC GGG Intronic
900138265 1:1127957-1127979 GCCCCACTGTGGCCCAGGACTGG + Intergenic
900497697 1:2983541-2983563 TCCGCACAGTCGCCCAGGGCAGG + Intergenic
900767779 1:4516837-4516859 TCCCATCAGAAGCCCGGGACTGG + Intergenic
900787368 1:4657014-4657036 TCCCCACACTGGCCAGTGGCTGG + Intronic
900897709 1:5495420-5495442 TTCCCAAAGCGGCCCTGGACTGG - Intergenic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
902641132 1:17767082-17767104 TGGCCACAGTGGTCAGGGACGGG + Intronic
903161813 1:21494465-21494487 TCCCCACAGAGCCCCTGCACTGG + Intergenic
905791564 1:40792316-40792338 TCCCCACTGTGCCCAGGGGCTGG - Intronic
907351788 1:53838093-53838115 TCTCCACGCTGCCCCGGGACCGG + Intronic
910369782 1:86503511-86503533 TGCCCACAGAGGCCTGGGGCAGG + Intergenic
911063611 1:93768689-93768711 TCCCCACAGGGGCCCTGGGCTGG - Intronic
913530949 1:119733970-119733992 TCCACACAGTGGGCAGTGACTGG + Intronic
915546347 1:156600765-156600787 TCCCCATATTGGCCAGGGGCTGG + Intronic
919640102 1:200038799-200038821 ACCCCACCCTGGCCCGGGGCGGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063106961 10:3000533-3000555 TGCCCAAAGTGGCCAGGCACAGG + Intergenic
1067068792 10:43118121-43118143 TCCCCAGAGTGTCCCAGGGCTGG - Intronic
1069639264 10:69944293-69944315 TCCTCACAGCAGCCTGGGACAGG + Intronic
1070187392 10:74078249-74078271 TCCCCACTGTGGTCCTGGGCTGG + Intronic
1070616758 10:77975323-77975345 TCCCCACTGTGTCCCATGACTGG - Exonic
1073248538 10:102107907-102107929 CCCCCCCAGTGGCCCTGGGCTGG - Exonic
1075085054 10:119409347-119409369 TCCTCACAGTGGGCCAGGGCAGG + Intronic
1075400141 10:122155161-122155183 TCCCCTCAGTGGCCCGGTGGTGG - Intronic
1076880452 10:133237062-133237084 TCCCCACTGTGGCCAGGGCGCGG - Intergenic
1077394027 11:2312418-2312440 TCCCCGCAGTGCCCAGGGGCGGG - Intronic
1077505893 11:2929801-2929823 TCCCCACGGTGGGCCGGCCCCGG - Intergenic
1077516036 11:3002723-3002745 TCCCCACAGTGGGGAGGGCCTGG - Intronic
1081655546 11:44854669-44854691 TCCCCACAGTGTCCAGGATCAGG - Intronic
1084093248 11:66893213-66893235 TGCCCACTGTGGCCCGTGTCAGG - Intronic
1084235676 11:67786550-67786572 CCCGCCCAGTGGCCCGGGACAGG - Intergenic
1084402933 11:68955751-68955773 GCCCCAGAGTGGCCTGAGACCGG - Intergenic
1084438312 11:69156872-69156894 TCCTCACAGTCACCCTGGACCGG - Intergenic
1086495360 11:87399053-87399075 TCCCCACACTGTCTTGGGACTGG + Intergenic
1089174036 11:116535666-116535688 TCTCCTCAGGTGCCCGGGACTGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090390813 11:126386166-126386188 TCCCCCCAGTGGCCAAGGGCTGG + Intronic
1090423810 11:126593416-126593438 TCCCCACAGTGGGTAGGGAGTGG - Intronic
1094663870 12:32498956-32498978 TCTGCACAGTGCCCCGGGGCAGG - Intronic
1096105515 12:48995090-48995112 TCCCCACAGTGGCCCTCCCCCGG - Intergenic
1097821537 12:64133285-64133307 CCCCCACATTGGCTCTGGACTGG - Intronic
1101764045 12:107682430-107682452 TGCCCTCAGGGGCCCGGGAAGGG - Intergenic
1102240759 12:111323108-111323130 TCCCCACAGTGGCAGGGAGCTGG - Intronic
1102462207 12:113106886-113106908 TCCCCACACTGGCTGGGGATGGG + Intronic
1103590702 12:121990238-121990260 TGCACACAGTGGCCAGGGATGGG - Intronic
1104683868 12:130771616-130771638 TCACCACAGTGGCCAGGGAGAGG - Intergenic
1104864268 12:131943458-131943480 TGCCCACAGGGGCCCATGACAGG - Intronic
1105049636 12:133037227-133037249 TTCCCACAGTGCCCCGCGTCCGG - Intergenic
1105506178 13:21012004-21012026 TCCACACAGTGGCCCTGGCCAGG + Intronic
1105544715 13:21342926-21342948 TCCCCACAGAGGCCCCTGTCAGG + Intergenic
1105600093 13:21878901-21878923 TCCGCACAGGGGCCAGGCACTGG + Intergenic
1108106353 13:47014701-47014723 TTGCCACAGTGCCCCAGGACTGG + Intergenic
1108321551 13:49295422-49295444 TACCCAGAGAGGCCCGGGCCGGG + Intergenic
1113531156 13:111028606-111028628 TCCCCACAGAGGCCCTGCAGAGG + Intergenic
1118752238 14:68815954-68815976 TCCCCATGGTGGTCAGGGACTGG + Intergenic
1118867007 14:69711914-69711936 TGCCCACAGGGGCCTGGGGCAGG + Exonic
1119646331 14:76351105-76351127 GCCCCACAGTGGCCAGGGTTGGG - Intronic
1120521849 14:85533773-85533795 TCCCCGCAGCGGGCCGGGGCCGG - Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122114683 14:99521838-99521860 TCCCCACCGTGGCCAAGGAGTGG + Intronic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1202852433 14_GL000225v1_random:30099-30121 TCCCCACGGAAGCCCGGGAACGG + Intergenic
1131227546 15:90637806-90637828 TCCCCACAGGGCTCTGGGACTGG - Intronic
1132206486 15:99989343-99989365 TGCCCACAGGGGTCCGGGGCAGG - Intronic
1132350659 15:101137986-101138008 TCTGCACAGTGGCTTGGGACAGG - Intergenic
1132725336 16:1335951-1335973 TCCCCAGAGCGGCCCGAGAGGGG - Intronic
1133347248 16:5079186-5079208 CCCACCCAGTGGCCTGGGACAGG - Intronic
1133928801 16:10215553-10215575 CCCCCTCAGTCGCACGGGACTGG + Intergenic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1137498916 16:48995603-48995625 TGCCCACAGTGTCTGGGGACGGG + Intergenic
1138412818 16:56853244-56853266 ACCCCACAGTGGGCCGGGCACGG - Intergenic
1140660801 16:77190328-77190350 TTCCCACACTGGCCCGTGGCAGG + Intergenic
1141091086 16:81130729-81130751 TCACCACAGTGGCGAGGGGCTGG - Intergenic
1143090320 17:4446065-4446087 TGCCCACGATGCCCCGGGACAGG - Exonic
1143401880 17:6651617-6651639 ATCCCACAGTGCCCCGGGACCGG - Exonic
1145240616 17:21239183-21239205 TCTCCACACTGGCCCGGCACTGG + Exonic
1148875968 17:50687437-50687459 ACTCCTCAGTGGCCCAGGACTGG - Intronic
1149468659 17:56899016-56899038 GCCCCACAGTGACTCGGGATGGG + Intronic
1150608339 17:66713367-66713389 TCCCAACTGGGGCCCGGGAGTGG - Intronic
1151564280 17:74888924-74888946 TCCCCATGGTGACCCAGGACAGG + Intronic
1151714167 17:75823058-75823080 TCCCCTCTGTGGCCAGGGAAAGG - Intronic
1151750143 17:76032505-76032527 TCCCCACAGGAGCCCGGAGCTGG - Intergenic
1151863270 17:76782127-76782149 TCCCCACAGGGGCCGGGGGCGGG - Intergenic
1152629561 17:81404440-81404462 TCCCCACTCTGGCCCAGGCCAGG - Intronic
1152903977 17:82960591-82960613 TCCTCACAGTGACACGGGAGAGG + Intronic
1152938567 17:83154132-83154154 TCCCCACTGTGGGGAGGGACAGG - Intergenic
1156341658 18:36215002-36215024 CCTTCACAGTGGCCCGGGGCTGG + Intronic
1156479282 18:37426099-37426121 TCCCCCCAGTAGCACTGGACAGG + Intronic
1157327056 18:46677053-46677075 TACCCACAGTGGCACTGGAGGGG - Intronic
1160729133 19:632801-632823 CCCCCACGGCGGCCCGGGAGAGG - Intronic
1160733626 19:652092-652114 TCCCTCCAGGGGCCCGGGCCAGG - Intronic
1160808714 19:1003655-1003677 TCCCCGCAGTTGACCGGGGCGGG - Exonic
1160808929 19:1004641-1004663 TGCCCACCGTGGCCCAGGCCGGG - Exonic
1162151619 19:8649668-8649690 TCCCCACCCTGCCCAGGGACTGG - Intergenic
1162809693 19:13156200-13156222 GCCCCACGGTGGCCGGGCACCGG - Intergenic
1163002794 19:14379225-14379247 CCCCCACAGGAGCCCAGGACAGG + Intergenic
1163063955 19:14779514-14779536 CCCCCACAGGAGCCCGGGACAGG - Intergenic
1163184014 19:15623775-15623797 TCCCCACTGTAGCCCCAGACTGG - Intronic
1163360462 19:16842811-16842833 TCCCCTCCCTGGCCCCGGACGGG - Intronic
1163727651 19:18931921-18931943 TCTCCACAGTTGCCCGGGCCAGG + Intronic
1163796822 19:19342687-19342709 TCCCCACCAGGGCCCGGGCCAGG + Intronic
1165159201 19:33805888-33805910 TCCCCGGAGTGGACAGGGACAGG + Intronic
1166130016 19:40740465-40740487 TCCCTGCAGGGGCCCGGGATTGG - Exonic
1166921655 19:46232665-46232687 TCGCCTCAGTGGCCCCAGACGGG + Intergenic
1166998311 19:46730329-46730351 ACCCCAGAGTGGCCAGGGCCAGG + Intronic
1167011749 19:46813329-46813351 TCCCCACGGTAGCCCGAGGCTGG - Intergenic
1167246630 19:48376940-48376962 TCCCCACACTGGCCAGGGGAGGG + Intergenic
1167638276 19:50667444-50667466 TCGTCACAGGGGCCCGGGGCTGG + Exonic
926725335 2:15993276-15993298 TCCCCACACTAGCCCTGGATAGG + Intergenic
927495194 2:23547186-23547208 TCCCCAGAGTGGCCAGGGAGCGG - Intronic
927672766 2:25082713-25082735 TCCCCACTGTGTCCCAGGGCTGG - Intronic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
936519737 2:113204229-113204251 AACCCACAGTGGCCTGGGCCAGG + Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
940361865 2:152804792-152804814 GGCACACAGTGGCACGGGACTGG - Intergenic
943037616 2:182766562-182766584 TACCCACAGAGGCCTGGGGCAGG + Intronic
944499878 2:200348528-200348550 TTCCTGCAGTGGCCAGGGACTGG + Intronic
944534630 2:200696815-200696837 TTACCACAGTGGCCCAGGAAAGG + Intergenic
946249004 2:218401853-218401875 TCCCCACAGTGGGCAGGGCCTGG - Intronic
1168794808 20:604460-604482 TGCCCAGAGTGTCCCGGAACAGG + Exonic
1169537062 20:6556613-6556635 TCCCCACAGTGATCAGTGACTGG - Intergenic
1169666436 20:8041824-8041846 TCCCCCCAGTCGCCAGGGAATGG + Intergenic
1170456505 20:16538433-16538455 TCACCAAAGTGGCCAGGGAGAGG - Intronic
1172596924 20:36156016-36156038 TCCACACCCTTGCCCGGGACAGG - Intronic
1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG + Intronic
1174298214 20:49563676-49563698 ACCCAACAGTGGTCCGTGACTGG - Intronic
1175872985 20:62217091-62217113 TCCCCACTGGGGTCCCGGACTGG + Intronic
1176010207 20:62889304-62889326 TCCCCACACTGGGCAGTGACGGG - Intronic
1176032214 20:63018042-63018064 TCCACACAGCGGCCCCGGACTGG + Intergenic
1176128327 20:63485780-63485802 GCCCCACAGAGGCCCAGGATGGG + Intergenic
1179584241 21:42364912-42364934 CCCCCACAGTGTCCCGGGGGTGG - Intronic
1179788701 21:43743466-43743488 TCCCCACAGTGCTCGGGGGCTGG - Intronic
1179788719 21:43743517-43743539 TCCCCACAGTGCTCAGGGGCTGG - Intronic
1179788737 21:43743568-43743590 TCCCCACAGTGCTCAGGGGCAGG - Intronic
1180166421 21:46033121-46033143 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166436 21:46033156-46033178 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166451 21:46033191-46033213 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166466 21:46033226-46033248 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1181510580 22:23387045-23387067 TCGCCACCCTGGCCCTGGACAGG + Intergenic
1182774927 22:32823858-32823880 TCCCCACAGTGCCCTGCCACAGG + Intronic
1183068613 22:35380956-35380978 ACCCCACACTGGCCCGGGGCGGG + Exonic
1183975136 22:41507682-41507704 CCTCAACAGTGGCCAGGGACAGG - Intronic
1184178930 22:42806266-42806288 TCCCCACTGTGGCCTGGCAGAGG + Intronic
1184474354 22:44712477-44712499 TCCCCACACGGAGCCGGGACTGG - Intronic
1184837035 22:47029868-47029890 CCCCCAGAGTGGCCTGGGCCGGG + Intronic
1184889622 22:47371835-47371857 TCCCCACAGTCGGGGGGGACAGG + Intergenic
1185070544 22:48653456-48653478 TCACCACAGTGGCCCTGGCCAGG - Intronic
1185105494 22:48867257-48867279 GCCCCACAGTGGGCAGGGAATGG - Intergenic
949559273 3:5187598-5187620 CCCGCCCAGTGGCCCGGGATTGG - Intergenic
952196042 3:31076195-31076217 TCCCCACTGAGCCCCTGGACTGG + Intergenic
953058476 3:39406940-39406962 TTCCCAGAGTGCCCCGGGAGCGG + Intronic
953982632 3:47420292-47420314 TCCCCAGAGTGGCCCAGGACAGG - Intronic
954409520 3:50364389-50364411 TCCCCCCAGTGGGATGGGACAGG - Intronic
955344385 3:58150175-58150197 TCCCGACAGTGGCCACGGACGGG - Exonic
957051645 3:75416349-75416371 CCCACCCAGTAGCCCGGGACAGG - Intergenic
958745205 3:98125985-98126007 ACCTCACAGTGGCCCTAGACAGG + Intergenic
964892377 3:161552474-161552496 TCCCAACAGAAGCCCGGGAGAGG + Intergenic
968555135 4:1243092-1243114 TACCCACGGTGGCCCAGTACCGG + Intronic
968994427 4:3936729-3936751 CCCACCCAGTGGCCAGGGACAGG - Intergenic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
986847202 5:11769152-11769174 TCCCGAAAGTGACCCAGGACTGG - Intronic
993980325 5:94537164-94537186 CCCCCACAATGGCCAGGGATAGG + Intronic
994790833 5:104224037-104224059 TCCCCACTCTGGTCCGGGACTGG + Intergenic
995600583 5:113791111-113791133 TCTCCACAGTGGCATGTGACTGG + Intergenic
1001577290 5:172772341-172772363 CGCCCACAATGGCCCGGGATTGG - Intergenic
1003781252 6:9429483-9429505 TCTCCACAGTGGCCAGGCAGAGG - Intergenic
1004553011 6:16667934-16667956 TCCCCAAAGTGCCTCGGGCCAGG + Intronic
1006149840 6:31981074-31981096 TCCTCAGAGTGGGCCGGGAGGGG + Exonic
1006156141 6:32013812-32013834 TCCTCAGAGTGGGCCGGGAGGGG + Intergenic
1006948019 6:37798433-37798455 TCCCTACCGTGTCCCAGGACGGG - Intergenic
1007160980 6:39791932-39791954 TCCCCAAAGTGTCCCTGCACTGG - Intergenic
1008639367 6:53445806-53445828 TTCCCACAGTCTCCCAGGACTGG - Intergenic
1009371187 6:62905468-62905490 TCTCCCCTGTGGCCCGGGGCAGG - Intergenic
1010792076 6:80075986-80076008 TGGCCACAGTGGGCAGGGACAGG + Intergenic
1013431822 6:110062781-110062803 TCTCCACAGTGGCCAGTGGCTGG + Intergenic
1019161195 6:170067929-170067951 TTGCCACAGTGGCCAGGGAGAGG - Intergenic
1019366669 7:636648-636670 TCCTCACAGTGGCCACGGGCTGG - Intronic
1019434701 7:1015941-1015963 GCCCCTCAGTGACCCTGGACCGG + Intronic
1019593218 7:1846142-1846164 TCCCCACTGTGGTCTGGGGCCGG - Intronic
1020012806 7:4815776-4815798 GCCCCACAGTGGCCCTGGCTGGG + Intronic
1020079813 7:5281440-5281462 CCCCCACAGAGACCCAGGACAGG + Intronic
1020318715 7:6925093-6925115 CCCACCCAGTGGCCCGGGACAGG - Intergenic
1021232635 7:18104135-18104157 TGCACACAGTGGCCCGGGCTAGG + Intronic
1024283736 7:47739470-47739492 TCCCCACTGTGGCCCAGGTCAGG - Intronic
1025199097 7:56950774-56950796 CCCCCACAGGGACCCAGGACAGG - Intergenic
1025672850 7:63626159-63626181 CCCCCACAGGGACCCAGGACAGG + Intergenic
1026362679 7:69617200-69617222 TCCACACAGTTGCCCTGGCCAGG - Intronic
1027540621 7:79459556-79459578 CACCCACAGTGTCCCTGGACTGG - Intergenic
1034274889 7:149819708-149819730 TTCCCACAGTGCCCGGGGGCTGG + Intergenic
1034564775 7:151904390-151904412 TTCCCACAGGGCCCCGGGTCAGG - Intergenic
1035595322 8:853293-853315 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1035604390 8:920122-920144 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1040988957 8:53328374-53328396 TCCCCACAGTGGGCCTGGGGAGG + Intergenic
1044823006 8:96170395-96170417 TTCCCACAGTGGCCCTGAAAGGG + Intergenic
1047668997 8:127124379-127124401 TCCCCACAGTGGCCTTGCATGGG + Intergenic
1048311342 8:133324650-133324672 TCCCCACAGTAGCCTGGCTCTGG - Intergenic
1048842266 8:138576562-138576584 TCCACACAGAGGGGCGGGACTGG + Intergenic
1049145963 8:141001220-141001242 GGCTCACAGTGGTCCGGGACCGG + Intronic
1049224506 8:141443417-141443439 TCCCCACTCTGGCCCCGGAGAGG + Intergenic
1049510411 8:143024336-143024358 TCTCCACACCGGCCCGGAACTGG + Intergenic
1049511327 8:143028243-143028265 TCTCCACACTGGCCTGGAACTGG + Intergenic
1049569581 8:143362865-143362887 TGCCCAGAGTGGCCAGGGAGGGG - Intergenic
1049848733 8:144819477-144819499 CCCCAACAGTGGCCTGGGGCAGG - Intergenic
1053817539 9:41928425-41928447 TCCCCAGAGAGGGCGGGGACCGG - Intronic
1054107795 9:61072097-61072119 TCCCCAGAGAGGGCGGGGACCGG - Intergenic
1054613062 9:67259028-67259050 TCCCCAGAGAGGGCGGGGACCGG + Intergenic
1060608644 9:124940885-124940907 TCCCCACAGCGGCCCGGTCAGGG - Intronic
1060721701 9:125983884-125983906 TCCCCACAGTGGCAGGGGCCAGG - Intergenic
1061191833 9:129086621-129086643 TCCCCACCATTGCCCGGGGCTGG - Intronic
1062183689 9:135204979-135205001 TCCTCACAGCGGCTGGGGACTGG + Intergenic
1062289400 9:135787747-135787769 TCCCCACAGTGTCCCTGTCCCGG + Intronic
1062623538 9:137433225-137433247 TCCTCACAGGGGCCGGGGCCAGG - Exonic
1186107821 X:6226411-6226433 TTCCCAGGGTGGCCCGGGCCAGG + Intronic
1186384861 X:9099707-9099729 TCCCCAGAGTGGCTCAGGATGGG + Intronic
1190061164 X:47212590-47212612 TCCCCACAAAGGCCCGGGGCTGG - Intronic
1192507574 X:71698312-71698334 TGCCCACAGAGGCCTGGGGCAGG + Intergenic
1192519122 X:71783240-71783262 TGCCCACAGAGGCCTGGGGCAGG - Intergenic
1197356748 X:125444963-125444985 TCCCCACAGTGGCTCAGTCCAGG - Intergenic