ID: 933724949

View in Genome Browser
Species Human (GRCh38)
Location 2:85421335-85421357
Sequence GTTTTCAGCAGATAAACAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933724943_933724949 8 Left 933724943 2:85421304-85421326 CCTTGGTGATCCATCTGCGCTGG 0: 1
1: 0
2: 0
3: 18
4: 194
Right 933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 158
933724948_933724949 -2 Left 933724948 2:85421314-85421336 CCATCTGCGCTGGGGAAAAAGGT 0: 1
1: 0
2: 2
3: 14
4: 117
Right 933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933724949 Original CRISPR GTTTTCAGCAGATAAACAGC CGG Intronic
903266212 1:22159595-22159617 AATGTCAGCAGATAAACAACTGG + Intergenic
903473143 1:23601271-23601293 GTTTTCAGCAGTGAAACTGGGGG - Intronic
905290045 1:36915151-36915173 GCATACAGCAGATAAACAGTAGG + Intronic
906941858 1:50262533-50262555 ATTGTCAGCAGATACAGAGCTGG + Intergenic
915717498 1:157958290-157958312 ATATTCAGCAGCTTAACAGCTGG + Intergenic
917737647 1:177935058-177935080 GTTTGAGGCAGAGAAACAGCAGG - Intronic
921349222 1:214218529-214218551 CTTTTCTGCAAATGAACAGCAGG - Intergenic
924137396 1:240983779-240983801 GCATTCATCAAATAAACAGCTGG - Intronic
1068834872 10:61542751-61542773 TTCTGCAGCAGACAAACAGCTGG + Intergenic
1069376956 10:67802693-67802715 GTTATCAGCTGTTAAAAAGCAGG + Intronic
1074716520 10:116224930-116224952 GTGTTCATAGGATAAACAGCTGG - Intronic
1078658030 11:13260649-13260671 GTTTTCAGGAAATAATGAGCAGG + Intergenic
1081108636 11:39104158-39104180 GTTTATAAAAGATAAACAGCTGG + Intergenic
1081589916 11:44415019-44415041 GTTTCCAGCAAATAAAAAGCAGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082899926 11:58236698-58236720 GGATTCAGCTGATAAACAGTTGG + Intergenic
1083661951 11:64255553-64255575 GTTCTCAGCAGACAAGAAGCGGG + Exonic
1085374813 11:76050136-76050158 GTTTGCCACAGATTAACAGCAGG - Intronic
1085751228 11:79162829-79162851 CTGTGCAGCAGATGAACAGCTGG - Intronic
1090084444 11:123639022-123639044 GTTTTCAGCAGGGAAATGGCAGG - Intronic
1090481282 11:127070913-127070935 TTTTTCAGTAGATAAACATGAGG + Intergenic
1092161982 12:6320255-6320277 GATGTGAGCAGATAAAAAGCAGG + Intronic
1093070381 12:14702023-14702045 GTTATCAGCTGAGAAACAGAAGG + Intergenic
1093343466 12:18008752-18008774 GTTTTCAGCAGCTATTTAGCTGG - Intergenic
1093785128 12:23184028-23184050 ATATTGAACAGATAAACAGCTGG - Intergenic
1095625647 12:44311301-44311323 GTCTAAAGCAGAGAAACAGCAGG + Intronic
1100142786 12:91639105-91639127 GTATTCAGCAGAAAAAGAGAGGG + Intergenic
1101603438 12:106230193-106230215 GTTTTCAGCATATTCACAGAAGG - Intergenic
1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG + Intronic
1103240439 12:119408935-119408957 GTTTTCCCCAGATCAAGAGCAGG + Intronic
1113642932 13:111971207-111971229 GTTTACAGTTTATAAACAGCAGG + Intergenic
1114960512 14:27882171-27882193 GTTTTCATAAGATTATCAGCTGG - Intergenic
1115633311 14:35266851-35266873 GTCATCAGCAAAAAAACAGCTGG - Exonic
1118838788 14:69495726-69495748 GTTTCCAGCAGAGAAGCTGCAGG - Intronic
1127112143 15:55686025-55686047 TTCTTTAGTAGATAAACAGCAGG - Intronic
1127650279 15:61000029-61000051 GTTTCCATCAGATCAACAGCTGG + Intronic
1128055527 15:64696802-64696824 GTATGCAGCAGATGTACAGCTGG + Intronic
1131040105 15:89256821-89256843 ATTTTCAGCACGTAAACAGATGG + Intronic
1131288896 15:91087460-91087482 GTTTTCACCGGAGATACAGCAGG - Intergenic
1131565272 15:93479786-93479808 CTTTTCAGCAAATAAACTGGGGG - Intergenic
1131660836 15:94513918-94513940 CTTTTCAGCAAATATACAACAGG + Intergenic
1133100774 16:3478265-3478287 GTTTCCAGCAGTTAAATTGCTGG - Intronic
1134049766 16:11129157-11129179 TTTTTAAGCAGATAAACACGTGG - Intronic
1134555922 16:15164687-15164709 GCATTCAGCAGCAAAACAGCAGG + Intergenic
1134850767 16:17476875-17476897 GATTTCAGCAGAAGCACAGCTGG - Intergenic
1134916505 16:18076422-18076444 GCATTCAGCAGCAAAACAGCAGG + Intergenic
1135880304 16:26249141-26249163 GTTTAAAGCAGTTGAACAGCTGG + Intergenic
1136995510 16:35186083-35186105 TCTTTCAGCTGAGAAACAGCTGG + Intergenic
1137680703 16:50342265-50342287 ATTTTCACCAGATAAAAAGTTGG + Intronic
1138883076 16:61040348-61040370 GTTTTCAGCAGTAGAACACCAGG - Intergenic
1142357301 16:89607707-89607729 TTTTGCTGCAGATAATCAGCCGG + Intergenic
1143201996 17:5119789-5119811 CATCTCAGCTGATAAACAGCTGG + Intronic
1144182099 17:12762043-12762065 GTTTTCTGGAGAAACACAGCTGG + Intronic
1144717778 17:17446321-17446343 GTTTTCATCAGCCAAACAGGAGG + Intergenic
1147789897 17:43007214-43007236 GTTTCCATCAGATACTCAGCGGG + Intronic
1148405503 17:47410411-47410433 GTTTTCAGCACATAAACTTTGGG + Intronic
1154054179 18:10995259-10995281 GTTCTCAGAAGATATACAGATGG - Intronic
1154327185 18:13400028-13400050 GTTTGCATCAGACAAACAACAGG - Intronic
1154389587 18:13924867-13924889 GTGGTCAGCAGACAAGCAGCTGG + Intergenic
1155127365 18:22891522-22891544 CTTAACAGCAGATTAACAGCTGG - Intronic
1157360011 18:46967915-46967937 CCTTTCTTCAGATAAACAGCAGG + Intronic
1157360610 18:47021507-47021529 CCTTTCTTCAGATAAACAGCAGG + Intronic
1157361599 18:47027422-47027444 CCTTTCTTCAGATAAACAGCAGG + Intronic
1161898828 19:7102545-7102567 GTTTTCAGAAGATGGACATCAGG - Intergenic
1165176455 19:33934087-33934109 ATGTTCAACAGATAAAGAGCTGG + Intergenic
1166165320 19:40983915-40983937 GTCTTCAGCAGATGCTCAGCGGG - Intergenic
925015018 2:516682-516704 GTTTAGAGCAGACCAACAGCAGG + Intergenic
925397314 2:3544392-3544414 CTCTTCAACAGATAAACGGCAGG + Intronic
925548638 2:5044558-5044580 GTTTTGAGTAGTTAAACAGGGGG - Intergenic
925938926 2:8796460-8796482 GCTTGCTGCAGATAAACAGGAGG - Intronic
928022875 2:27717147-27717169 GTTTTCAGGAGAGCAACAGCTGG - Intergenic
928373606 2:30758430-30758452 TTTAATAGCAGATAAACAGCAGG + Intronic
929650471 2:43675662-43675684 GTTATCTGAAGATAAGCAGCTGG - Intronic
929974482 2:46618255-46618277 GTTTTCATCAGATTATCAGAGGG - Intronic
930313975 2:49774940-49774962 GTTTTTAGCAGCTAACTAGCAGG - Intergenic
933297736 2:80509569-80509591 GTTTTCAGGTGCCAAACAGCTGG - Intronic
933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG + Intronic
937130155 2:119504925-119504947 GTTTACAGAAGATATACAGATGG + Intronic
939160267 2:138579692-138579714 GTTTTCAGCAGTTTTACTGCAGG + Intergenic
942076623 2:172362116-172362138 GTTTTCAGCAGATTAATGACAGG - Intergenic
942538380 2:176989519-176989541 GTTGGCATCACATAAACAGCTGG - Intergenic
944358397 2:198821350-198821372 GTATTCAACAGAGAAAAAGCAGG - Intergenic
945623845 2:212175225-212175247 GTATCTAGCAGATAAAAAGCAGG + Intronic
945845763 2:214942924-214942946 CTTTGCAGCACATAAAGAGCAGG - Exonic
948064836 2:235069881-235069903 GTTCTCAGCAAATACACATCAGG + Intergenic
948485638 2:238279158-238279180 GTTTTCAGCAGAGTCCCAGCAGG + Intronic
1169593126 20:7166673-7166695 GTTTTCAACAGAAAAGCAGGTGG - Intergenic
1170410982 20:16091569-16091591 TTTATCAGCTGATAGACAGCTGG - Intergenic
1171754392 20:29088604-29088626 GTCTGCAGCATATACACAGCTGG + Intergenic
1177907062 21:26984549-26984571 GTTGTCAGCAGAAAAACAGTGGG - Intergenic
1178662121 21:34515988-34516010 GATTTCAGCAAATAAACACTGGG + Intronic
1180934980 22:19619530-19619552 GTTTTCTGCAGAGACAGAGCAGG - Intergenic
1182721364 22:32403524-32403546 GTTCTCACCAGAAAAACAGAAGG - Intronic
1182990034 22:34758873-34758895 GTTTTCAGCCAAGAAAAAGCTGG - Intergenic
951150237 3:19279777-19279799 TTTTTCTGCAGTTAAACACCAGG - Intronic
953601283 3:44367525-44367547 ATGTTCAACAGATAAACTGCAGG - Exonic
956352248 3:68350651-68350673 CTTTTTAACAGAAAAACAGCAGG + Intronic
956564382 3:70619111-70619133 GTTTTCAGCAGAGAAGCTGGAGG - Intergenic
957114458 3:76007494-76007516 ATTTTGAGTAGATAAAAAGCAGG + Intronic
958411563 3:93823058-93823080 CTTCTCAGCAAATAAACAGCAGG + Intergenic
958814760 3:98902447-98902469 GATTTCTGTAGATAGACAGCAGG - Intergenic
960766221 3:121133432-121133454 GTTTTTAGCAGAAAAATTGCAGG + Intronic
961031878 3:123613159-123613181 GATTTCAACTGATAAAGAGCTGG - Exonic
961097234 3:124168058-124168080 CTTTTCAGCAAAGAAAGAGCAGG - Intronic
965099242 3:164275348-164275370 TTTTCCAGCAGAAACACAGCAGG + Intergenic
965932428 3:174061275-174061297 GTTTTCAGCAGAGTAATAACTGG + Intronic
968219348 3:196923919-196923941 GTGTTCAGCTAATAAACAGATGG + Intronic
968609027 4:1548698-1548720 GTTTACAGGAGACACACAGCTGG + Intergenic
969397436 4:6931520-6931542 GTGTCCAGCACATACACAGCTGG - Intronic
969992735 4:11280804-11280826 GTTTTAAGCAGGGAAACTGCAGG - Intergenic
972095802 4:35345326-35345348 GCTTCCAGCAGATACAAAGCAGG + Intergenic
973161722 4:47026336-47026358 GTGTTCACCAGATAATCACCGGG + Intronic
974349632 4:60728040-60728062 ATTTTCAAAAGATAACCAGCAGG - Intergenic
977697557 4:99983102-99983124 TTTTTTAGGAGATAAAAAGCCGG - Intergenic
978385187 4:108170971-108170993 AGTTTCAGCACTTAAACAGCGGG - Intergenic
980965636 4:139518031-139518053 GTTTTCTGCAGGTTGACAGCAGG - Exonic
981120802 4:141048973-141048995 GTGTTGAGCAGATGAACATCAGG - Intronic
981183431 4:141772630-141772652 GTATTCAGCTGATAAGCATCCGG - Intergenic
982379150 4:154730067-154730089 TGTTTCAGCAGATAACCTGCAGG + Intronic
984774481 4:183468616-183468638 GTTTACAGCAGCAAAACAACAGG - Intergenic
985314827 4:188646094-188646116 GTTTTCAGGAGAGAAGAAGCAGG + Intergenic
985325710 4:188767368-188767390 CATTTCAGAAGAAAAACAGCAGG + Intergenic
987387252 5:17341873-17341895 GTTTTAAGCAGAGAAATGGCAGG + Intergenic
989227332 5:39044779-39044801 GTTTTCTGAAGGTAGACAGCAGG - Intronic
990107620 5:52284133-52284155 GCTTTCAGCAAATATAAAGCAGG - Intergenic
990499852 5:56385162-56385184 GTTTCCAGCAGATAAATAAAAGG - Intergenic
991100851 5:62791029-62791051 GTTTTCATCAGATAAACTTTGGG - Intergenic
993648319 5:90486576-90486598 GGTTCCAGCAGAGAACCAGCAGG - Intronic
993698955 5:91095515-91095537 GTTCTCAGCAAATAAACTGAGGG - Intronic
993773151 5:91956865-91956887 GTTTGCAGCTGACAAACAGCAGG - Intergenic
993776427 5:92004066-92004088 GTCATAAGCAGATAAACAGAGGG + Intergenic
996772668 5:127101486-127101508 TTTTTGAGCAGAGAAAAAGCAGG - Intergenic
997287122 5:132688067-132688089 GTCTTCAGCAGTTCAACAGCTGG - Intergenic
999084989 5:148880052-148880074 GTTTTAAGCAGGAAAACATCAGG + Intergenic
999891965 5:155987707-155987729 GTTTTCAGCAGAGACTTAGCAGG - Intronic
1005784297 6:29227298-29227320 GTTTTCAACAGAGAAATAGGAGG + Intergenic
1006049827 6:31333463-31333485 GTTTTTACCAGAAATACAGCAGG - Intronic
1007839811 6:44706572-44706594 GTTTTCTGCACATCAACTGCAGG + Intergenic
1014016773 6:116540086-116540108 ATTTTCAGAAGGTAAACAGAAGG - Intronic
1016718827 6:147268806-147268828 GTTTTCAGCAGTTAGACAGCAGG + Intronic
1017053600 6:150417959-150417981 CTCCTCAGCAGATAAACATCTGG + Intergenic
1020372779 7:7452436-7452458 GGTTTTAGGAGATCAACAGCAGG - Intronic
1021792333 7:24218018-24218040 GTTTGCAGCAAAAAAACACCTGG + Intergenic
1021831848 7:24620147-24620169 ATTTTAAGCAGCTAAACAGCAGG + Intronic
1023286778 7:38629559-38629581 ATTTTGAGCATATTAACAGCTGG + Intronic
1028212054 7:88085722-88085744 GGATGCAGCAAATAAACAGCTGG - Intronic
1031234157 7:119150972-119150994 GTTTTCAGTAGATACTCAGTTGG - Intergenic
1031745121 7:125486642-125486664 GTTTCCAGTAGCTAAAAAGCTGG + Intergenic
1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG + Intronic
1034951540 7:155299936-155299958 GTTTGTAGCAGATTAACAGAGGG + Intronic
1035961634 8:4144640-4144662 TTTATCAGGAGATAATCAGCAGG + Intronic
1036128192 8:6082976-6082998 ATTTTCTGCAGATAAACTGTGGG - Intergenic
1037238318 8:16747991-16748013 GGATTCAGCAGAGAAACATCTGG - Intergenic
1037540179 8:19863178-19863200 GTTTTCAACACATAAACTTCGGG - Intergenic
1043066939 8:75584970-75584992 GCTTTCAGCAAATATAAAGCAGG - Intergenic
1045957801 8:107929409-107929431 GCTTTCAGCTGCTAAACAGGGGG - Intronic
1047966792 8:130050941-130050963 TTTGTCATCAGATAAAAAGCTGG + Intergenic
1048817844 8:138350702-138350724 GCCTTCAATAGATAAACAGCTGG - Intronic
1050904583 9:10987652-10987674 TTTTTCAGAAGATAAAATGCGGG - Intergenic
1052041217 9:23741319-23741341 GTTTACAGCAGACAAACTGCAGG + Intronic
1052500560 9:29284185-29284207 GTTTTCAGCTAGTAAACATCAGG - Intergenic
1052958210 9:34271535-34271557 AGTTTCAGCAGAGAAACAGTAGG - Intronic
1053148887 9:35730516-35730538 GTATTCAGCAGATGACCAGGTGG + Intronic
1055795684 9:79972559-79972581 GTTTTCAGCAGGAGAGCAGCTGG + Intergenic
1057202350 9:93148579-93148601 GTTTTCAGAAGAAAAAAAGAAGG - Intergenic
1058059271 9:100477561-100477583 TTTTTCAGCAGTTACATAGCAGG + Intronic
1186700880 X:12088399-12088421 GATTTCAACATATGAACAGCAGG + Intergenic
1192986142 X:76400439-76400461 GTTTTCAGCAGAAAACCTGCAGG + Intergenic
1195272611 X:103247190-103247212 GTTGTCAGGAGATAAAATGCTGG - Intergenic
1199116253 X:143996728-143996750 GCTGTCAGCAGATATAAAGCAGG - Intergenic