ID: 933726314

View in Genome Browser
Species Human (GRCh38)
Location 2:85429609-85429631
Sequence GAGGAGTCCCAGTACTCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933726314_933726325 24 Left 933726314 2:85429609-85429631 CCCGGTGAGTACTGGGACTCCTC 0: 1
1: 0
2: 3
3: 11
4: 129
Right 933726325 2:85429656-85429678 TCTCTCTACCCCTCCTCTCCTGG 0: 1
1: 1
2: 4
3: 68
4: 535
933726314_933726326 25 Left 933726314 2:85429609-85429631 CCCGGTGAGTACTGGGACTCCTC 0: 1
1: 0
2: 3
3: 11
4: 129
Right 933726326 2:85429657-85429679 CTCTCTACCCCTCCTCTCCTGGG 0: 1
1: 2
2: 2
3: 58
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933726314 Original CRISPR GAGGAGTCCCAGTACTCACC GGG (reversed) Intronic