ID: 933726314

View in Genome Browser
Species Human (GRCh38)
Location 2:85429609-85429631
Sequence GAGGAGTCCCAGTACTCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933726314_933726326 25 Left 933726314 2:85429609-85429631 CCCGGTGAGTACTGGGACTCCTC 0: 1
1: 0
2: 3
3: 11
4: 129
Right 933726326 2:85429657-85429679 CTCTCTACCCCTCCTCTCCTGGG 0: 1
1: 2
2: 2
3: 58
4: 506
933726314_933726325 24 Left 933726314 2:85429609-85429631 CCCGGTGAGTACTGGGACTCCTC 0: 1
1: 0
2: 3
3: 11
4: 129
Right 933726325 2:85429656-85429678 TCTCTCTACCCCTCCTCTCCTGG 0: 1
1: 1
2: 4
3: 68
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933726314 Original CRISPR GAGGAGTCCCAGTACTCACC GGG (reversed) Intronic
900001926 1:19254-19276 GAGCAGCCTCAGCACTCACCGGG + Intergenic
900411586 1:2514970-2514992 GAGGAGTCCCAGCCCTGCCCAGG - Intronic
905636709 1:39558819-39558841 GAGGGGTCCCAATACTCTTCTGG + Intergenic
912946903 1:114092957-114092979 GAAGAGACCCAGTACTGTCCTGG + Intronic
914446991 1:147758659-147758681 CAGGAGTCCCTGTCCCCACCCGG - Exonic
915471039 1:156126090-156126112 GCGGACTCCCTGTACCCACCCGG + Intronic
918216292 1:182394287-182394309 GATGAGTCCAAGAACTGACCAGG + Intergenic
1064733226 10:18354668-18354690 GAGGAGTCTCAGGACCCAGCAGG + Intronic
1065467658 10:26043225-26043247 GTGCAGTCCCAGTAGCCACCAGG - Intronic
1065778236 10:29142649-29142671 CAGGAGTGCCTGTCCTCACCTGG - Intergenic
1067143534 10:43676567-43676589 CAGGAGGCCCAGTGCTGACCTGG - Intergenic
1068635026 10:59339040-59339062 AAGGAGTGCCAGCAGTCACCTGG - Intronic
1070284231 10:75071743-75071765 CAGGAGTGCCTGTCCTCACCTGG - Intergenic
1071893847 10:90042280-90042302 CAGGAGTGCCTGTCCTCACCTGG + Intergenic
1072898018 10:99383745-99383767 CAGCACTCCCACTACTCACCAGG - Intronic
1075659716 10:124184892-124184914 GAGGAGGCCCAGTAATGAACAGG + Intergenic
1075847406 10:125555801-125555823 GAGGGGTCCCATAAATCACCAGG - Intergenic
1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG + Intronic
1076515956 10:131044497-131044519 GAGGGCTTCCAGTACTCCCCAGG - Intergenic
1077098106 11:808399-808421 GAGGAGTCCCACTGTTCCCCAGG - Intronic
1077112123 11:866480-866502 GAGCAGTCCCTGTCCTCAGCAGG - Intronic
1077155944 11:1090853-1090875 GAGGACACCCACTACCCACCTGG + Intergenic
1081447255 11:43142591-43142613 GAGGATTCCCAGTGCTCACAGGG + Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083107604 11:60373650-60373672 CAGGAGTGCCTGTCCTCACCTGG - Intronic
1083260179 11:61518478-61518500 GAGGGGTCCCAGGACTCAACTGG - Exonic
1083333248 11:61908904-61908926 GAGCAGTCCCAGCTCTCCCCTGG + Intronic
1084191662 11:67502198-67502220 GAGAAGTCCCAGCCCTCTCCAGG - Intronic
1086443027 11:86847547-86847569 GATGAGTCCCAGGACTAACCAGG + Intronic
1088595459 11:111437379-111437401 CAGGAGTCCCTGGACTCATCTGG - Intronic
1091261392 11:134237610-134237632 GAGGAGAGCCAGGACCCACCAGG + Intronic
1091375006 12:19359-19381 GAGCAGCCTCAGCACTCACCGGG + Intergenic
1092671494 12:10867050-10867072 GATGAGGCCCAGCACTGACCTGG + Intronic
1095885394 12:47183751-47183773 GATGAGTCCCTGTCCTCACGTGG - Intronic
1097994072 12:65868458-65868480 GAGGAGTCAGATTACTCTCCGGG + Intronic
1104711203 12:130987981-130988003 GGGGAGTGACTGTACTCACCGGG - Intronic
1109272044 13:60266664-60266686 GACAAGTCCCAGGACTAACCAGG - Intergenic
1116326340 14:43536596-43536618 GACGAGTCCCAGAACTAACCAGG + Intergenic
1117461752 14:55952314-55952336 GAGGAGTCCAAGAAATTACCAGG + Intergenic
1118325736 14:64779138-64779160 GAGGTGACGCAGGACTCACCTGG + Exonic
1119831538 14:77707438-77707460 GAGGAATCCCAGAACTGACAGGG - Intronic
1120959867 14:90114844-90114866 GAGCATTGCCAGTGCTCACCAGG + Intronic
1122465068 14:101927391-101927413 CAGGAGTCCGAGTACTAACTAGG - Exonic
1132625885 16:891268-891290 CAGGATCCCCAGGACTCACCTGG - Intronic
1133053942 16:3135384-3135406 GAAGAGGGCCAGGACTCACCAGG - Exonic
1135475408 16:22770290-22770312 GAGGAGTCACAGTATTCAATAGG + Intergenic
1136020997 16:27439934-27439956 GATGAGTCCCAGAAGACACCAGG - Intronic
1139643451 16:68310429-68310451 CAGGAGTCCGAGTACACGCCGGG - Exonic
1150575847 17:66430328-66430350 GAGGTGTCCCTGTAGTCAGCTGG - Intronic
1150755029 17:67904236-67904258 CAGGAGTTCCAAGACTCACCTGG - Intronic
1157472401 18:47999768-47999790 GAGGAGACCCAGGACTCTTCCGG - Intergenic
1158066222 18:53412635-53412657 GAAAACTCCCAGTACTCACTGGG + Intronic
1159841492 18:73404090-73404112 GAGGTGTCCCAGTCCCCACTGGG - Intergenic
1160475899 18:79187396-79187418 TTTGAGTCCAAGTACTCACCAGG - Intronic
1160633678 19:60862-60884 GAGCAGCCTCAGCACTCACCGGG + Intergenic
1162070607 19:8149873-8149895 GAGAAGTCCCGGGACTCACCTGG + Intronic
1164464933 19:28479643-28479665 GAGGAATCCAAGTAATCCCCAGG + Intergenic
1166039720 19:40194482-40194504 GAGGAGTCCCAGCCTTCAACAGG - Intronic
925038016 2:706638-706660 GAGAAGTTCCAGTTCTGACCAGG - Intergenic
927618105 2:24621156-24621178 GAGGAGTTCCCTTATTCACCTGG + Intronic
927948562 2:27152276-27152298 GAGCAGTCCCAGAATACACCAGG - Intronic
931021732 2:58052479-58052501 GTGTAGTCCCAGTACTCAGGAGG + Intronic
933008035 2:77021341-77021363 GTGGAGTCACAGAACACACCAGG + Intronic
933726314 2:85429609-85429631 GAGGAGTCCCAGTACTCACCGGG - Intronic
933829478 2:86195319-86195341 CGGGAGCCCCAGTGCTCACCTGG + Exonic
934503770 2:94876994-94877016 GTGGAGCCCCAGTCCCCACCTGG - Intergenic
936567796 2:113594151-113594173 GAGCAGCCTCAGCACTCACCGGG - Intergenic
943562874 2:189484137-189484159 AAGGAGTCCATGGACTCACCTGG + Intergenic
946227114 2:218269947-218269969 GAGGAGCGGCAGTTCTCACCTGG + Exonic
1170447213 20:16440609-16440631 GAAGAGCCACAGGACTCACCAGG + Intronic
1171363730 20:24609525-24609547 GATGAGTCCCTGGACTCAGCTGG + Intronic
1179183484 21:39064493-39064515 GAGGAGTCCAAGCACTCTGCAGG + Intergenic
1180829009 22:18888269-18888291 GAAGAGCCTCAGTGCTCACCAGG - Intergenic
1181525691 22:23484422-23484444 GAAGAGCCTCAGTGCTCACCAGG - Intergenic
1182779518 22:32856490-32856512 GAGGAGTCTCAGTACCCAGAAGG - Intronic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183671834 22:39277762-39277784 GAGGAGACCCACTACTTCCCTGG + Intergenic
1184283345 22:43451751-43451773 GAGCAGTGCCTGGACTCACCCGG - Intronic
1185129262 22:49028386-49028408 GAGCAGACCCAGCACTGACCGGG - Intergenic
1203279100 22_KI270734v1_random:114257-114279 GAAGAGCCTCAGTGCTCACCAGG - Intergenic
950487379 3:13281638-13281660 CAGGAGTCCCAGTACTGTCATGG - Intergenic
952877517 3:37959023-37959045 CAGGGCTCCCAGCACTCACCAGG - Intronic
953232261 3:41075542-41075564 GAGGTGTCCCAGAGCTCACTGGG - Intergenic
954320576 3:49829747-49829769 CAGGAGTCCCAGCTCTCACTGGG - Exonic
963909917 3:150808012-150808034 GAGAAGTCCCAGCACTAAGCAGG - Intergenic
969868496 4:10090776-10090798 GGGGAGTCCCAGTGCTCCTCGGG + Intronic
972461331 4:39306166-39306188 GTGGAGGCCCAGTTTTCACCCGG - Intronic
973824710 4:54693542-54693564 GAGAAGTCCCATTACTGGCCAGG + Intronic
974459025 4:62164035-62164057 GATGAGTCCCAGAACCCACTGGG - Intergenic
974968921 4:68801935-68801957 GATGAGTCCCAGGACTAACCAGG + Intergenic
975012878 4:69377913-69377935 GACGAGTCCCAGGAATAACCAGG + Intronic
975384229 4:73736993-73737015 GAGCAGTCTCAGCTCTCACCTGG - Intergenic
975683210 4:76896732-76896754 CAGGATTCCCAGGACTCATCCGG + Exonic
976504124 4:85826587-85826609 TACTAGTCCCAGTACTCACTGGG + Intronic
976795607 4:88929394-88929416 TAGGAGTCCCAGCAATCTCCAGG - Intronic
980801927 4:137762843-137762865 GATGAGTCCTGGTACTCAGCAGG - Intergenic
980922454 4:139100583-139100605 GTGCAGTCCCACTACTCATCAGG - Intronic
981776179 4:148370215-148370237 TAGGAGCCCCATTACTGACCTGG + Intronic
985652426 5:1113019-1113041 GTGGAGTTCCAGAACCCACCAGG + Intergenic
985678622 5:1244788-1244810 GAGGGGTCCCAGGACTTCCCAGG - Intronic
988521022 5:31945742-31945764 GAGGAGACCCAGGAAGCACCTGG - Intronic
988678645 5:33460991-33461013 GAGCACTCACAGGACTCACCCGG + Exonic
991343820 5:65641496-65641518 GAGGATCCCCAGGACTCACCTGG + Intronic
1000541778 5:162549904-162549926 CAGGAGTGCCTGTCCTCACCTGG - Intergenic
1002474526 5:179456421-179456443 TAGCAGTCCCAGCACTGACCAGG + Intergenic
1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG + Intronic
1004018537 6:11754854-11754876 GAGGAGTGTCAGTACTAACCTGG + Intronic
1009192643 6:60648070-60648092 GAGGAGTCTCAGAAATCAACAGG - Intergenic
1010784047 6:79979109-79979131 GGGCAGTCCCAGAACTAACCTGG - Intergenic
1012452762 6:99370777-99370799 TAGGAGTCTAAGTACTCAACAGG + Intronic
1016715118 6:147216885-147216907 GACGAGTCCTAGAACTCACATGG + Intronic
1017986051 6:159444078-159444100 GAAGAGACCCAGTACCCACAGGG - Intergenic
1020151009 7:5681639-5681661 GACGAGTCCCATTCCTCAACTGG + Intronic
1021340320 7:19456325-19456347 GAGAAGGCCCAGTAATCCCCAGG - Intergenic
1023058909 7:36311165-36311187 GAGGAGTCTGAGCACCCACCAGG + Intergenic
1026369547 7:69684969-69684991 TATGAGTCCCTGTACACACCAGG - Intronic
1029404629 7:100367123-100367145 GGGGAGGCCCAGCACTCAGCTGG - Intronic
1029409177 7:100397909-100397931 GGGGAGGCCCAGCACTCACCTGG - Exonic
1031531813 7:122885923-122885945 GAGGCGTCCCAGAGCTCTCCCGG + Intronic
1032089179 7:128902758-128902780 GAGCAGCCTCAGGACTCACCAGG + Exonic
1033775706 7:144608408-144608430 GGGAAGTTCCAGAACTCACCTGG + Intronic
1035598177 8:878090-878112 GAGGACTCCCAGTACTCTCAAGG - Intergenic
1039828272 8:41193201-41193223 CAGGAGCCCCAGTGCTCAGCAGG - Intergenic
1048780172 8:137991067-137991089 GATGAGTCACAGGACTAACCAGG + Intergenic
1048970665 8:139643436-139643458 CAGGGGTCCCAGGACTCACTGGG + Intronic
1049884734 9:19367-19389 GAGCAGCCTCAGCACTCACCGGG + Intergenic
1056815288 9:89796679-89796701 GAGGAGGCCAAGTGCTCACAGGG + Intergenic
1057860355 9:98636040-98636062 CAGGAGTCGCAGATCTCACCTGG + Intronic
1059962067 9:119575276-119575298 TTGAAGTCCCAGGACTCACCTGG + Intergenic
1061415232 9:130443999-130444021 GAGGACTCCCGGTCCTCAGCCGG - Intergenic
1061723206 9:132566552-132566574 GGGGAGTTCCAGTCCTCAACGGG - Intronic
1061755385 9:132808867-132808889 AAGGAGGTCCAGTACCCACCAGG + Intronic
1061914595 9:133742864-133742886 CAGGACTCCCAGCACTGACCAGG + Intergenic
1062385990 9:136311770-136311792 GCGCAGCCCCAGCACTCACCAGG + Intergenic
1203745452 Un_GL000218v1:38596-38618 GTGGAGCCCCAGTCCCCACCTGG + Intergenic
1203564658 Un_KI270744v1:80888-80910 GTGGAGCCCCAGTCCCCACCTGG - Intergenic
1185699688 X:2221282-2221304 CAGGAGTCTCAGGACTCACATGG + Intronic
1187618780 X:21027563-21027585 TGAGAGTCCTAGTACTCACCTGG - Intergenic
1189868878 X:45361067-45361089 GATGAGTCCTAGTACTGACCTGG - Intergenic
1193836395 X:86349476-86349498 CAGGAGTGCCTGTCCTCACCTGG + Intronic
1201158774 Y:11153607-11153629 GTGGAGGCCCAGTCCCCACCTGG + Intergenic
1201270543 Y:12249683-12249705 GAGGAGTCACAGCACACATCAGG - Intergenic
1201640381 Y:16171105-16171127 GAAGAGTCCCAGTACTAACCAGG - Intergenic
1201662433 Y:16414220-16414242 GAAGAGTCCCAGTACTAACCAGG + Intergenic