ID: 933726520

View in Genome Browser
Species Human (GRCh38)
Location 2:85430493-85430515
Sequence CAGCAGGAATGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1396
Summary {0: 1, 1: 0, 2: 12, 3: 132, 4: 1251}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933726520_933726527 0 Left 933726520 2:85430493-85430515 CCCTCTCCCCTCCATTCCTGCTG 0: 1
1: 0
2: 12
3: 132
4: 1251
Right 933726527 2:85430516-85430538 TGCTGAGCATCCCTTCCTCCAGG 0: 1
1: 0
2: 3
3: 49
4: 356
933726520_933726535 18 Left 933726520 2:85430493-85430515 CCCTCTCCCCTCCATTCCTGCTG 0: 1
1: 0
2: 12
3: 132
4: 1251
Right 933726535 2:85430534-85430556 CCAGGCCCAGGAGGAGGACGAGG 0: 1
1: 0
2: 8
3: 130
4: 832
933726520_933726528 6 Left 933726520 2:85430493-85430515 CCCTCTCCCCTCCATTCCTGCTG 0: 1
1: 0
2: 12
3: 132
4: 1251
Right 933726528 2:85430522-85430544 GCATCCCTTCCTCCAGGCCCAGG 0: 1
1: 0
2: 4
3: 82
4: 632
933726520_933726536 21 Left 933726520 2:85430493-85430515 CCCTCTCCCCTCCATTCCTGCTG 0: 1
1: 0
2: 12
3: 132
4: 1251
Right 933726536 2:85430537-85430559 GGCCCAGGAGGAGGACGAGGAGG 0: 1
1: 2
2: 51
3: 457
4: 4895
933726520_933726532 12 Left 933726520 2:85430493-85430515 CCCTCTCCCCTCCATTCCTGCTG 0: 1
1: 0
2: 12
3: 132
4: 1251
Right 933726532 2:85430528-85430550 CTTCCTCCAGGCCCAGGAGGAGG 0: 1
1: 0
2: 7
3: 72
4: 539
933726520_933726529 9 Left 933726520 2:85430493-85430515 CCCTCTCCCCTCCATTCCTGCTG 0: 1
1: 0
2: 12
3: 132
4: 1251
Right 933726529 2:85430525-85430547 TCCCTTCCTCCAGGCCCAGGAGG 0: 1
1: 0
2: 7
3: 56
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933726520 Original CRISPR CAGCAGGAATGGAGGGGAGA GGG (reversed) Intronic
900141709 1:1141538-1141560 AAGCAGGGATGGGGGGGACAGGG - Intergenic
900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG + Intronic
900544609 1:3221635-3221657 GGGCAGGCATTGAGGGGAGAAGG - Intronic
900764855 1:4497981-4498003 CAGCCTGGAGGGAGGGGAGAAGG - Intergenic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
900932793 1:5747511-5747533 CAGCAGGAAGGGAGGAAGGAGGG + Intergenic
901063995 1:6486117-6486139 CAGGAGGAAGGGAGGAGGGAAGG - Intronic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
902044351 1:13513781-13513803 CAGCAGGGATGGAGAGGGGAGGG + Exonic
902225931 1:14996472-14996494 CCCCAGGAATGTAGGGGGGATGG + Intronic
902265729 1:15262187-15262209 CAGCAGGAATGCAGCAGAGGTGG + Intronic
902864452 1:19269146-19269168 CTGAAGGAATGCAGGGGAGTAGG + Intergenic
903034250 1:20484594-20484616 ACGCAGGGATGGAGGGGAGGGGG - Intronic
903043901 1:20552232-20552254 CAGCAGGAATCGTGGGGCGCGGG + Intergenic
903268700 1:22174359-22174381 CAGAAGGAAGGCAGGAGAGAGGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
903623606 1:24715460-24715482 TAGCAGGCATGGAGAGGAGGGGG - Intergenic
903625241 1:24725569-24725591 CAGCAGGCAGGGCAGGGAGATGG + Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
904286669 1:29457234-29457256 CAGCAGTAAGGGTGGGGAGGAGG - Intergenic
904542131 1:31240012-31240034 CCGCCGGAGGGGAGGGGAGAGGG + Intergenic
904711489 1:32433571-32433593 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
904912469 1:33945582-33945604 CAGCAAGATTGCAGGGGAGCAGG + Intronic
905052090 1:35060616-35060638 CAGCAGGAGAGGAGGGGCGAAGG - Intronic
905108548 1:35577961-35577983 AAGCAGGACTGGTGGGGAGACGG + Intronic
905249022 1:36636277-36636299 CAGCAGGGAGGGCGGGGAGGAGG - Intergenic
905276711 1:36823110-36823132 CACCAGGAGTGAAGGGGAGATGG + Intronic
905499633 1:38426339-38426361 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
905628971 1:39508295-39508317 CAGCAGCCATGGTGGGGAAAGGG - Intronic
905656681 1:39690441-39690463 CAGCAGGAAGGTGGGAGAGAGGG + Intronic
905732545 1:40306550-40306572 CAGGAGGTATGGAATGGAGATGG + Intronic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905876558 1:41435454-41435476 GAGCAGGAATGGTGGGGAGCAGG + Intergenic
906075049 1:43045998-43046020 CTGCAGGAATGGAGAGTACAAGG - Intergenic
906080772 1:43086750-43086772 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
906231002 1:44164307-44164329 CAGCAGTAAGGAAGGGAAGATGG + Intergenic
906474360 1:46158121-46158143 CAGCAGGAATGGGGGTGAGAAGG - Intronic
906701318 1:47860178-47860200 CAGCAGGAATGAAGGAGTGCAGG - Intronic
906748430 1:48237795-48237817 CAGCAGGAAGAGAGCGGTGATGG - Exonic
906779474 1:48559790-48559812 AAGCAGGAATGTAGGGGAGGGGG - Intronic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907292478 1:53425533-53425555 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907521101 1:55023862-55023884 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
907639786 1:56176356-56176378 CAGCAGGAAGGAGAGGGAGATGG - Intergenic
907659692 1:56380623-56380645 CAGGAGGAAAATAGGGGAGAAGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907823056 1:57989523-57989545 CAGGAGAAATTGAGGGGTGAGGG - Intronic
908321952 1:62987093-62987115 CAGCAGGAACAGAGGGGAAAAGG - Intergenic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
908461854 1:64354417-64354439 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
908592098 1:65646333-65646355 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
909035322 1:70589573-70589595 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
909156404 1:72083308-72083330 GAGAAGGAAGGGAGGAGAGAGGG - Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909729239 1:78873161-78873183 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
909909817 1:81246698-81246720 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
910758053 1:90711947-90711969 CAGGAGGGAGGGAGGGGGGAGGG - Exonic
911148192 1:94571651-94571673 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
911570259 1:99510898-99510920 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
911607168 1:99919945-99919967 GACCAGAAATGGAGGGGAAAGGG - Intronic
911983706 1:104597224-104597246 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
912815470 1:112824981-112825003 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
912841405 1:113042623-113042645 GAGCAGGAATGAAGGCGGGAGGG + Intergenic
912852750 1:113141163-113141185 CAGAAGGGAAGGAGGGGTGAAGG - Intergenic
912957596 1:114166385-114166407 CAGCAGAAATGGAGGGCTCAGGG - Intergenic
913246153 1:116871660-116871682 AGGCAGAAAGGGAGGGGAGATGG + Intergenic
913375165 1:118143723-118143745 CACCAGGATTGGAGGGGTGCTGG - Intronic
913451333 1:118994572-118994594 CAGAAAGGAGGGAGGGGAGAGGG + Intergenic
915016348 1:152737650-152737672 CAGCAGGAACGGACTGGAGGTGG - Intronic
915294257 1:154909071-154909093 CAGGAGGAAGGGATGGGAGGAGG + Intergenic
915345870 1:155196557-155196579 GAACAGGAAGGGAGGGGAAATGG - Intronic
915729515 1:158043356-158043378 GAGCAGGAATGGAGGAGGGGTGG - Intronic
915733959 1:158072873-158072895 TAGCAGGAAGGAAGGGGAGAGGG + Intronic
916068327 1:161154271-161154293 AAGGAGGGATGGTGGGGAGAGGG + Intronic
916076045 1:161200557-161200579 GAGCAGGAAGGGAGGGGGAAAGG - Intronic
916295371 1:163213435-163213457 CAGAAAGAATGGAGAGGAGGGGG - Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917453614 1:175167462-175167484 CAGCAGCAGTGGTGGGGTGAGGG + Intronic
917562032 1:176168479-176168501 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
917707554 1:177649413-177649435 GGGCAGGGATGGATGGGAGAGGG + Intergenic
918282420 1:183020409-183020431 AAGGAGGGATGGAGGGGGGAGGG - Intergenic
918346969 1:183614908-183614930 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
918473671 1:184900679-184900701 AAGGAGGAATAGAGGGGAAAGGG + Intronic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918734170 1:188037807-188037829 CAGCTGGAATGCAGGGCACAAGG - Intergenic
919476252 1:198036054-198036076 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
919525790 1:198648529-198648551 CAGCAGGACTGAATGGGAGCTGG + Intronic
919612058 1:199757803-199757825 TAGCAGGAATGGTGAGAAGAAGG - Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919838766 1:201594333-201594355 CAGGAGAAAGGGAGGGGAGGAGG + Intergenic
919936104 1:202251834-202251856 CACCTGGAAGGGAGAGGAGATGG + Intronic
920179825 1:204125780-204125802 GAGGAGGCCTGGAGGGGAGATGG + Intronic
920341113 1:205275709-205275731 CAGGAGGAATGGAGATGACATGG + Intergenic
920448169 1:206036060-206036082 GAGCAAGAAAGGATGGGAGAGGG - Intergenic
920708813 1:208275628-208275650 GCACAGGAATGGAGGGAAGAAGG - Intergenic
920736670 1:208539100-208539122 CAGCAGGAATGGTGCTGACAGGG + Intergenic
920901683 1:210115271-210115293 AAGGAGGAATGGAGGGTGGAAGG + Intronic
920907864 1:210188566-210188588 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
921254889 1:213330168-213330190 CAGATGGATGGGAGGGGAGATGG - Intergenic
921459925 1:215414392-215414414 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
921509121 1:216009263-216009285 AAGAAGGAATGGAGGGTGGAAGG - Intronic
921519986 1:216146808-216146830 AAGGAGGAATGGAGGGTGGAAGG - Intronic
921733116 1:218598238-218598260 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922049684 1:221977552-221977574 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922154218 1:223028853-223028875 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922906255 1:229175696-229175718 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
922908711 1:229197499-229197521 CAGCAGGCATGGAGCTGCGAGGG - Intergenic
922934678 1:229413659-229413681 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923075068 1:230602515-230602537 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
923143326 1:231179926-231179948 GAGAAGGGATGGAGGAGAGATGG + Intronic
923146276 1:231200668-231200690 CAGCCTGAATGCAGGAGAGATGG - Intronic
923244606 1:232119439-232119461 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
924077377 1:240354265-240354287 GAACAGGAATGGAGAGGATAGGG + Intronic
924180510 1:241435235-241435257 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1063106557 10:2997468-2997490 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1063854196 10:10228904-10228926 CAACAGAAATGGAGAGGGGAAGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064322615 10:14319995-14320017 CATCAGGATTGGATGGGAGATGG - Intronic
1064436600 10:15316355-15316377 CAGCAGGAATGGCCTGGTGAGGG - Intronic
1064887136 10:20123612-20123634 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1064976517 10:21122441-21122463 AAGCAAGTATGGAGGAGAGAAGG - Intronic
1065198100 10:23286476-23286498 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1065247111 10:23769384-23769406 CAGGAGCAATTGAGGGGAGGGGG + Intronic
1065410519 10:25422273-25422295 CAGCAGGAAGTGAGTGGCGATGG + Intronic
1065443345 10:25773656-25773678 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1065610380 10:27466352-27466374 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1066379752 10:34891145-34891167 CTGCAGGAAGGGAGAGGACAAGG + Intergenic
1067360233 10:45572351-45572373 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1067530208 10:47065523-47065545 TAGCAGGCATGGAGAGGAGGGGG + Intergenic
1067577924 10:47419613-47419635 CAGCAGGAAAGGACAGGACATGG - Intergenic
1067582018 10:47452062-47452084 CTTCAGGCATGGTGGGGAGAGGG + Intergenic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068230827 10:54168016-54168038 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1068592484 10:58865449-58865471 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1069532173 10:69227499-69227521 CAGCAGGACTGAAGCAGAGAGGG - Intronic
1069917343 10:71795756-71795778 CAGCAGGGATGGAGCAGAGCAGG - Exonic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070814453 10:79313996-79314018 CTGCAGGCATGGGGGGGAGGGGG + Exonic
1071316542 10:84406249-84406271 CAGAAGGTATGGATGGGAGGAGG + Intronic
1071702540 10:87955596-87955618 GAGAAGGAGTGGTGGGGAGAAGG + Intronic
1071767388 10:88683158-88683180 AAGCAGGAATGGAGGCAAGAAGG + Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1071960976 10:90808704-90808726 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1072011425 10:91305961-91305983 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072943752 10:99790932-99790954 AAGCATGAGGGGAGGGGAGATGG + Intronic
1073013734 10:100381890-100381912 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1073111528 10:101065795-101065817 CAGCCCCAATGGAGGGCAGACGG - Intronic
1073113142 10:101074510-101074532 CAGCGGGGATGGAAAGGAGAGGG + Intergenic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073480742 10:103784761-103784783 AAGGAGGAAGGAAGGGGAGAAGG + Intronic
1073544337 10:104336261-104336283 CAGCAAGACTGGATGAGAGAAGG + Intronic
1073637065 10:105210088-105210110 CAACAGGAATGAAGGGGAGAGGG - Intronic
1074138587 10:110650350-110650372 CAGCAGATCTGTAGGGGAGATGG + Intronic
1074155001 10:110790304-110790326 GAGCTGGAATGGTGGGGAGGCGG - Intronic
1074280670 10:112048633-112048655 AAGCAGGAAGGGATGGGAAAAGG + Intergenic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1075330262 10:121568948-121568970 AAGCAGGAATGGAGAGGCGTGGG - Intronic
1075761021 10:124856768-124856790 CCTCAGGAAGGGAGGGGAGAGGG - Intergenic
1075778596 10:125003213-125003235 CAGCAGGAAAGCAGGGAACAGGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076034800 10:127190671-127190693 CAGCAGGAACGGGGGGGGGGGGG - Intronic
1076040061 10:127238910-127238932 CATGAGAAATGGAGGGGATAAGG - Intronic
1076136476 10:128048689-128048711 TAGCAGGAACGGAAGGGAGGAGG + Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076324240 10:129609028-129609050 CAGCAGTAAGAGAGGAGAGAAGG - Intronic
1076492480 10:130872053-130872075 CAACATCAAGGGAGGGGAGAGGG - Intergenic
1076558725 10:131347081-131347103 AGGAAGGAAGGGAGGGGAGAAGG - Intergenic
1076716428 10:132366592-132366614 CTGCAGGAAGGGTGGGGACACGG - Intronic
1076766226 10:132635293-132635315 CAGCAGGAATGAGGGGAAAAGGG - Intronic
1076822139 10:132944682-132944704 CAGCGGGAAAGGAGGCGGGAAGG + Intergenic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1078046270 11:7916612-7916634 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1078148444 11:8738590-8738612 CAGCAGGGATGGGGAGGAGGGGG - Intronic
1078291370 11:10013373-10013395 AAGCTGGGATGTAGGGGAGAGGG + Intronic
1078314797 11:10285333-10285355 GAGAAGGAAGAGAGGGGAGAGGG + Intronic
1078358401 11:10649629-10649651 CAGCAGGAATTCAGGGGAGCCGG - Intronic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078567290 11:12427355-12427377 CAACAGGCAGGGAAGGGAGAGGG - Intronic
1078619881 11:12897451-12897473 CAGGTTGAATGAAGGGGAGAGGG + Intronic
1079230375 11:18644267-18644289 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1079321060 11:19451731-19451753 TAGCAGGAAAGAAGGGAAGAGGG + Intronic
1079660912 11:23035563-23035585 CAGCAGGACGGAAGGGGAGGTGG - Intergenic
1080028054 11:27633527-27633549 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1080612919 11:33920579-33920601 CAGCAGGAATGTCGTGGAGCTGG + Intergenic
1080928684 11:36784896-36784918 AGGCAGGGAAGGAGGGGAGAGGG - Intergenic
1081399659 11:42627948-42627970 CAGCAGGCATTTAGCGGAGAAGG + Intergenic
1081549175 11:44096187-44096209 CAGCAGGAAGGGAGGGGTCACGG - Exonic
1081575228 11:44314972-44314994 GAGAAGGAAGGAAGGGGAGAAGG - Intergenic
1081747251 11:45481924-45481946 CAGCTGGAACGCAGGAGAGATGG + Intergenic
1081874921 11:46401958-46401980 CTGCAGGAATGTGGGGGACAGGG - Intronic
1083159348 11:60845202-60845224 CTGCTGGAATGAGGGGGAGAAGG + Intronic
1083560761 11:63671361-63671383 CAGCAGGGGTGCAGAGGAGAGGG + Exonic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1084024220 11:66437914-66437936 GGGCAGGAATAGAGGGGACAGGG - Intronic
1084146470 11:67267518-67267540 GAGGAGAAATGTAGGGGAGAGGG - Intronic
1084165166 11:67372241-67372263 TACCAGGAGAGGAGGGGAGACGG - Intronic
1084421294 11:69061892-69061914 CAGAAGGAAGGCAGGGAAGATGG + Intronic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084613416 11:70218747-70218769 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1084777443 11:71386935-71386957 CGGCTGGAGTGGAGGGGACAAGG + Intergenic
1085095612 11:73758518-73758540 CTTCAGTAATGGAGGGGGGAGGG + Intronic
1085627091 11:78081844-78081866 AAGAAGGAATGGAGGGCTGAAGG - Intergenic
1085719745 11:78902751-78902773 CAGCAGGGAAGGAGGAGAGGTGG + Intronic
1085731377 11:79001980-79002002 CACCAGAAAAGCAGGGGAGATGG - Intronic
1085750324 11:79155688-79155710 AAGGAGGAAAGGAGGGGAGGGGG - Intronic
1085934118 11:81123076-81123098 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1086174553 11:83874262-83874284 AAGAAGGAAGGAAGGGGAGAAGG + Intronic
1086437625 11:86798102-86798124 CAGCTGGAAGGAAGGGAAGAAGG - Intronic
1086550054 11:88044413-88044435 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1086616675 11:88830008-88830030 CAGGAAGAAGGGAGAGGAGAAGG + Intronic
1087168057 11:95023995-95024017 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1087285761 11:96263724-96263746 CAGCAGGTATGGAGGGGGGCTGG + Intronic
1087314534 11:96589187-96589209 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1088018107 11:105084627-105084649 CAGCAGGAGAGGTGGGGAGAAGG - Intronic
1088638942 11:111852406-111852428 CATCAGGGAAGGAGTGGAGATGG + Intronic
1088920798 11:114258518-114258540 CACCAGGAAGGGAGGGGATTGGG + Intronic
1089379756 11:118019807-118019829 CAGCAGCAATGAAGGGGAAAAGG - Intergenic
1089806837 11:121098058-121098080 CAGCAGGAATATACTGGAGAGGG - Intergenic
1089867205 11:121642400-121642422 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1089953105 11:122547823-122547845 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1089987289 11:122825877-122825899 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1090107743 11:123870058-123870080 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090407704 11:126487058-126487080 TAGCAGAAATGGAGGGGCGCAGG + Intronic
1090619403 11:128548283-128548305 CACCAGGCATGGCGTGGAGAAGG - Intronic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1090975622 11:131677823-131677845 TAGGAGGAGTGGAGGGGACAAGG - Intronic
1091297893 11:134486607-134486629 CAGCGGTAATGGAGCGGAGCAGG - Intergenic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091768446 12:3136941-3136963 CAGCAGGACTGGACGGGGCAGGG - Intronic
1091803719 12:3341646-3341668 CACCATGAAGGGAGGGGAAACGG + Intergenic
1091912267 12:4242242-4242264 CAACCTGAAAGGAGGGGAGAGGG - Intergenic
1091998387 12:5013674-5013696 CAGCTTGATTGGAGAGGAGAAGG + Intergenic
1092063448 12:5569422-5569444 AAGGAGGACTGGAGGGGTGAGGG - Intronic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092120750 12:6042173-6042195 GAGCAGGAATGGGGTGCAGAGGG - Intronic
1092121303 12:6045902-6045924 GACCAGGCATGGAAGGGAGAAGG - Intronic
1092140630 12:6180868-6180890 CAGCAGCAGGGGAGGGGATAGGG + Intergenic
1092168058 12:6355126-6355148 GAGCAGGAATGAGGGGCAGAGGG - Intronic
1092187060 12:6488209-6488231 AAGCAGGAATGGGGACGAGAAGG - Intergenic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092626891 12:10337379-10337401 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1092723859 12:11466621-11466643 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1092746338 12:11675864-11675886 GAGAAGGAAAGGAAGGGAGAGGG + Intronic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1093268154 12:17026134-17026156 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1093340897 12:17972903-17972925 CATAAGTAATGGAGAGGAGAGGG - Intergenic
1093560473 12:20533330-20533352 CAATAGGAATGGAGGAGATAGGG - Intronic
1093812995 12:23510491-23510513 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1093965483 12:25320346-25320368 CAGAAGGAATACAGAGGAGACGG + Intergenic
1094123385 12:26997688-26997710 CAACAGGGATGGAGGAGTGAAGG - Intronic
1094174082 12:27524117-27524139 CTGCAGGGAGGGAGGAGAGAAGG + Intronic
1094226114 12:28048110-28048132 CAGCAGTAATGGGGAGGAAAGGG + Intergenic
1094316204 12:29139487-29139509 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095992659 12:48047322-48047344 CAGAAGGAATGGTAGGTAGAAGG - Intronic
1095995972 12:48085054-48085076 CTGCAGGGATGGCGGGGAGAAGG + Intronic
1095999234 12:48114956-48114978 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1096846883 12:54412294-54412316 CAGCAGGTACGTAGAGGAGAGGG - Intronic
1096907335 12:54947401-54947423 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1097181680 12:57175315-57175337 CAGCAGGAATGGAGACGAATGGG + Intronic
1097666001 12:62477751-62477773 GCGCAGGAATGGAGGTGAGGTGG - Intronic
1097676179 12:62603910-62603932 TAGAAGGAATTGAGGGGAGTGGG + Intergenic
1097823101 12:64147365-64147387 CAGCAGGAATTGGGAGGAGGAGG - Exonic
1098055208 12:66497724-66497746 CAGCAAAAATGGAGAGGAGCAGG + Intronic
1098173781 12:67771083-67771105 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1098554208 12:71800199-71800221 AAGCAGGAATGGGAGGGAGAAGG - Exonic
1099188566 12:79541132-79541154 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1099762448 12:86940059-86940081 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1100330211 12:93573959-93573981 AATCAAGAATGCAGGGGAGATGG + Intronic
1100561198 12:95750350-95750372 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1100725586 12:97405300-97405322 AAGCAGCAATGGAGAGGAAAAGG - Intergenic
1101041875 12:100763614-100763636 CAGCAGGACTGGGGGAGATAAGG - Intronic
1101667628 12:106833926-106833948 CAGCAAGAAAGAGGGGGAGAAGG - Intronic
1101700738 12:107171498-107171520 CAGAAGGAGTGGATGGGGGATGG - Intergenic
1102050099 12:109855966-109855988 CACCAGGCCTGGAGGAGAGAAGG - Intronic
1102089827 12:110176380-110176402 AACCAGGAATGGAAGGGAAAAGG + Intronic
1102144983 12:110648318-110648340 AGGCAGGAAGGGAGTGGAGAAGG - Intronic
1102375964 12:112421116-112421138 TACCAGGGCTGGAGGGGAGAAGG - Intronic
1102391550 12:112552968-112552990 CAGCAGGCATGGGGAAGAGAAGG - Intergenic
1102544157 12:113642646-113642668 AAGGAGGGATGGAGGGGAGAAGG - Intergenic
1102604274 12:114056719-114056741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1102744972 12:115242467-115242489 GAGCCGGTAAGGAGGGGAGAAGG - Intergenic
1102764719 12:115422911-115422933 AAGGAGGAAGGGAGGAGAGAAGG + Intergenic
1102825125 12:115942585-115942607 CTGCCAGAAGGGAGGGGAGAGGG + Intergenic
1103048079 12:117755007-117755029 CAGCAGGACTACAGGGGTGAAGG + Intronic
1103848435 12:123915507-123915529 CGGAAGGACTGGAGGGGTGATGG - Intronic
1103918646 12:124388508-124388530 CAGCAGGGAGAGAGAGGAGAGGG + Intronic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1104096808 12:125565591-125565613 CAGCAGGATGGGTGGGGAGCTGG + Intronic
1104558344 12:129822203-129822225 GAGCAGGGCTGGAGGGGAGAAGG + Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105042652 12:132972698-132972720 AAGCAGAAATGGAGAGGAGGAGG - Intergenic
1105578147 13:21671813-21671835 CTGCAGTAAGGGAGGGGAGTTGG + Exonic
1106571944 13:30935073-30935095 CTGCAGGGATGGATGGGTGAAGG - Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1107075436 13:36317705-36317727 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1107432408 13:40351874-40351896 AAGCAATAAGGGAGGGGAGAAGG - Intergenic
1107662336 13:42651529-42651551 CAGAAGGAGGGGAAGGGAGAGGG - Intergenic
1107932072 13:45314951-45314973 AAGAAGGAAAGGAGAGGAGAGGG + Intergenic
1108252131 13:48577919-48577941 AAGGAGGAAGGGAAGGGAGAAGG - Intergenic
1108527307 13:51296857-51296879 CAGCAGAAAGAGAGAGGAGAGGG + Intergenic
1108678552 13:52759813-52759835 AAGCAGGAAGGGAAGAGAGATGG + Intergenic
1108804016 13:54132149-54132171 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1108822357 13:54368723-54368745 AAGAAGGGAGGGAGGGGAGAAGG + Intergenic
1108919691 13:55659425-55659447 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1110765326 13:79275395-79275417 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1110845185 13:80184819-80184841 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1111126183 13:83912717-83912739 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1111630307 13:90840721-90840743 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1111994804 13:95155142-95155164 CTACAGGAATTGAGGGGAGGAGG - Intronic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112637058 13:101226989-101227011 CAGCAGGCATGGGGGAGGGAGGG - Intronic
1112830546 13:103444744-103444766 CTGCAGCAATGAAGTGGAGAGGG - Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113614497 13:111671045-111671067 AAGGAGGAAGGGAGGGGAAAAGG - Intronic
1113619965 13:111755959-111755981 AAGGAGGAAGGGAGGGGAAAAGG - Intergenic
1113938115 13:114005809-114005831 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938127 13:114005845-114005867 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938164 13:114005957-114005979 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938176 13:114005993-114006015 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938202 13:114006067-114006089 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938236 13:114006177-114006199 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938271 13:114006287-114006309 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938332 13:114006473-114006495 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938392 13:114006659-114006681 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938440 13:114006807-114006829 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938475 13:114006917-114006939 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938557 13:114007177-114007199 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938569 13:114007213-114007235 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938604 13:114007306-114007328 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938641 13:114007416-114007438 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1114211485 14:20619332-20619354 CAACAGGAATGGAAAGGGGAAGG - Intergenic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1114598347 14:23933637-23933659 CAGCAGGGGTGGAAAGGAGATGG - Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115333138 14:32219641-32219663 GAGCAAGAGTGGAGGGGACACGG - Intergenic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1116179534 14:41517218-41517240 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1117026997 14:51630978-51631000 CAGAAGGAATGTAGAGGAGTGGG + Intronic
1117093451 14:52272928-52272950 GAGCAGGGATGGATGAGAGAGGG - Intronic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1118130123 14:62953821-62953843 AAGCAAGAATGGAGGTGGGATGG - Intronic
1118145849 14:63135749-63135771 GAGAAGGAAAGGAGGGGGGAAGG + Intergenic
1118251988 14:64170696-64170718 GAGGAGGCATGGAGTGGAGATGG + Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1118590961 14:67400619-67400641 TAGCTGGAAGGGAGTGGAGAAGG + Intronic
1118600326 14:67467460-67467482 AAGGAGGGAGGGAGGGGAGAGGG + Intronic
1118634966 14:67739971-67739993 CTGCAGGAATGGGGGTGGGAGGG + Intronic
1118647987 14:67858438-67858460 CAGCCGGAATTTAAGGGAGATGG - Intronic
1118937452 14:70300641-70300663 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1119022277 14:71125555-71125577 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119317054 14:73704753-73704775 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119560477 14:75585481-75585503 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1119666558 14:76489199-76489221 CAGACAGACTGGAGGGGAGATGG - Intronic
1119669534 14:76508036-76508058 TAGGAGCATTGGAGGGGAGAGGG - Intergenic
1119971254 14:78973014-78973036 CAGCAGCAATTGTGGGGAGGTGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120576350 14:86186069-86186091 CAGGAGGCAGGGAGGGGGGAGGG - Intergenic
1120660105 14:87239474-87239496 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1120745967 14:88152176-88152198 CAGCAGGAATGGAGGAGGCAGGG + Intergenic
1120913491 14:89689289-89689311 CACCAAGTAGGGAGGGGAGAAGG - Intergenic
1121231890 14:92364506-92364528 CAGCAGCTATGCAGGGCAGAGGG + Intronic
1121289211 14:92760753-92760775 AAGAAGGAATGGAGGGTGGAAGG - Intergenic
1121378778 14:93441730-93441752 CAGGAGGCATGGAGGGCATATGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121637726 14:95465177-95465199 GAGGAGGAAGGGAGGGGAGGAGG + Intronic
1122040850 14:98986465-98986487 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1122060150 14:99131839-99131861 CAGCAGGAATGGGCTGGGGAGGG + Intergenic
1122317584 14:100835176-100835198 CATCAGGAATGGGGCGGGGAAGG - Intergenic
1122381487 14:101310130-101310152 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1123050010 14:105536788-105536810 CACCAGGAATGGCGTGGAGTAGG + Intergenic
1123054405 14:105562257-105562279 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1123078989 14:105682676-105682698 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1123882633 15:24689995-24690017 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1125405733 15:39351129-39351151 CAGCAGGGCAGGAGGGGAAAAGG + Intergenic
1125629018 15:41132384-41132406 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1125724492 15:41861387-41861409 CAGCAGGAATGGGCAGGAGGGGG - Intronic
1125793832 15:42389805-42389827 GAGCACGAATGGAGGAAAGACGG - Intronic
1125800193 15:42439277-42439299 CAGCAGGACTGGTCGGGAGCAGG - Exonic
1125848945 15:42885781-42885803 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1125926139 15:43564731-43564753 CATCAGTAATAGATGGGAGAAGG - Intronic
1125937321 15:43648595-43648617 AAGCGAGAATGGAGGAGAGAAGG - Intronic
1125939283 15:43664282-43664304 CATCAGTAATAGATGGGAGAAGG - Intronic
1125950224 15:43746014-43746036 AAGCGAGAATGGAGGAGAGAAGG - Intergenic
1126843603 15:52739852-52739874 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1126979887 15:54228751-54228773 CTTGAGGAAAGGAGGGGAGAGGG - Intronic
1127357887 15:58218468-58218490 GAGGAGGCAGGGAGGGGAGAAGG - Intronic
1128579539 15:68799256-68799278 CTGCTGGAAGGAAGGGGAGAGGG + Intronic
1128589033 15:68878090-68878112 TAGGAGTATTGGAGGGGAGAAGG + Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1129955835 15:79636015-79636037 CAGCAGCAATAAAGAGGAGATGG + Intergenic
1130042550 15:80417565-80417587 AGGGAGGAAGGGAGGGGAGAAGG - Intronic
1130094011 15:80842844-80842866 CAGCAGGAATGAGGAAGAGATGG + Intronic
1130764933 15:86860348-86860370 CAAAAGGAATGAAGGGGAGCTGG - Intronic
1130847150 15:87758153-87758175 AAGGAGGACAGGAGGGGAGAAGG + Intergenic
1130854971 15:87832534-87832556 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130947622 15:88560925-88560947 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1131072970 15:89477453-89477475 CAGGAAGAAGGGATGGGAGAAGG + Intronic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1131392993 15:92064193-92064215 CAGCAGGCGAGAAGGGGAGAAGG - Intronic
1131684032 15:94752002-94752024 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1132209248 15:100008092-100008114 AAGCAGGGATGGATGGGTGAAGG + Intronic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1132389422 15:101427620-101427642 CAGCAGGACCAGAGGAGAGAGGG + Intronic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132667573 16:1089215-1089237 GAGCAGGGCTGGATGGGAGATGG - Intergenic
1133048443 16:3102375-3102397 CTGCAGGGAAGAAGGGGAGATGG + Intergenic
1133507777 16:6429307-6429329 CAGCAGCAGTGGTGGGGAGCTGG - Intronic
1133651252 16:7815964-7815986 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1133699041 16:8291947-8291969 TAGAAGGTATGGAGGGGAGTGGG + Intergenic
1133740414 16:8647019-8647041 CAGCAGCAAGGCAGGGGAAAGGG - Exonic
1133814160 16:9183802-9183824 CAGCAGGATTGGGGGGGGGGGGG - Intergenic
1133839504 16:9394771-9394793 AAGCAGGAAGGGAGGGAGGAAGG - Intergenic
1133891477 16:9883451-9883473 CTGCAGGAATGAAGTGGAAAAGG + Intronic
1134449511 16:14354475-14354497 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449521 16:14354497-14354519 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449536 16:14354536-14354558 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134691262 16:16192246-16192268 AGGCAGGGAAGGAGGGGAGATGG + Intronic
1134829143 16:17309409-17309431 AGGCAGGGATGGAGGGGAGAGGG + Intronic
1135348300 16:21707797-21707819 CATCAAGAAAGGAGAGGAGAGGG - Intronic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1136025535 16:27465892-27465914 CAGCAGGAAGGGATGGGACCAGG - Intronic
1136054789 16:27680319-27680341 CAGCATGGCTGCAGGGGAGACGG + Intronic
1136106444 16:28033533-28033555 GAGGAGGAAAGGAGGGGAAAGGG + Intronic
1136553554 16:30994803-30994825 GAGCAGGAGATGAGGGGAGAGGG - Intronic
1136994776 16:35182067-35182089 GAGCAGGAAAGGAGGTGAGGAGG - Intergenic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137063061 16:35809785-35809807 CAGGAGAAAAGGAGGGGAGAGGG + Intergenic
1137363288 16:47839759-47839781 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1137375430 16:47948067-47948089 AAGGATGAATGGAGGGGAGCTGG - Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138174755 16:54886596-54886618 GACCTGGACTGGAGGGGAGAGGG + Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1138344460 16:56311618-56311640 CAGCAGGGAGGGAGGAGGGAGGG - Intronic
1138383242 16:56618011-56618033 CAGCACGAGTGGAGAGGACATGG + Intergenic
1138389301 16:56658506-56658528 CAGCATGAAGGGAGAGGACATGG + Intronic
1138390556 16:56667520-56667542 CAGCATGAATGGAGAGGACATGG - Intronic
1138391104 16:56670342-56670364 CAGCATGAATGGAGAGGAGATGG + Intronic
1138588360 16:57985805-57985827 CAGGAGGGATGGCGGGGAGAGGG + Intronic
1138759254 16:59522082-59522104 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1138804797 16:60080095-60080117 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1139102576 16:63786370-63786392 AGGCAGGAATGGAGGTGAGCAGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139210033 16:65068025-65068047 AAGCAGGGAGGGAGGGAAGAAGG + Intronic
1139374177 16:66486623-66486645 TGGCAGGCAGGGAGGGGAGATGG - Intronic
1140137552 16:72220977-72220999 CAGCAGGAAAGGAAGGGAAAGGG - Intergenic
1140496748 16:75396006-75396028 GAGAAGTCATGGAGGGGAGATGG - Intronic
1141289325 16:82703297-82703319 CAGAAGGAATGGTGGGGGGACGG - Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1141921419 16:87138230-87138252 CAGCAGCCATGGATGGGAGTTGG - Intronic
1142135023 16:88447960-88447982 AAGAAGGAAGGGAGGGAAGAGGG + Intergenic
1142487894 17:258639-258661 GAGCAGGAATTGAGTGGAGTGGG - Intronic
1142500917 17:332483-332505 CATCAGGAAGGGAGGGAAGGAGG - Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142608518 17:1095577-1095599 CAGCAGGACTGGGGAGGAGGGGG - Intronic
1142683255 17:1562384-1562406 CAGCGGGGATGGAGGGGATCCGG - Intronic
1142700927 17:1660284-1660306 CAGGTGGAATCGTGGGGAGAGGG - Intronic
1142700934 17:1660325-1660347 CAGGTGGAATCGAGGGGAGAGGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1142700948 17:1660407-1660429 GGGCTGGAATCGAGGGGAGAGGG - Intronic
1142781328 17:2183238-2183260 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
1143282298 17:5764021-5764043 CAGCAGGCATGGAGGGGGCCTGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144213016 17:13031213-13031235 AGGAAGGAGTGGAGGGGAGAAGG - Intergenic
1144249228 17:13399013-13399035 TGGCAGGAATGCAGGGGGGATGG - Intergenic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144678282 17:17175659-17175681 TAGCAGAAATGGAGGGGAGTGGG - Intronic
1144737041 17:17561034-17561056 CTGGAGGAAGGGAGGAGAGAGGG - Intronic
1145041871 17:19582967-19582989 CAGCAGGGAAGGAGGGGTGGTGG + Intergenic
1145042539 17:19587743-19587765 CAGCAGGGAAGGAGGGGTGGTGG - Intergenic
1146052953 17:29567245-29567267 CAGCCGGAAGGGAGTGGGGAGGG + Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1146429079 17:32773604-32773626 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1146457511 17:33018976-33018998 CAACAGAGATGGTGGGGAGAAGG + Intronic
1146561056 17:33871094-33871116 CAGGAGGAAGGGAGAGGAGGAGG - Intronic
1146597749 17:34184537-34184559 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1146684958 17:34835339-34835361 GGGCAAGGATGGAGGGGAGAGGG - Intergenic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1147186485 17:38716058-38716080 CAGCACAAATGTAGGGGATAAGG - Intronic
1147202168 17:38809998-38810020 CAGCATGAAGTGAGAGGAGAAGG - Intronic
1147252253 17:39159982-39160004 TACCAGAAATGGAAGGGAGAAGG - Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148241053 17:45999528-45999550 CAGCAGGAATGGGGCTGAGCAGG + Exonic
1148624057 17:49055395-49055417 CAGCTGGCTGGGAGGGGAGAAGG - Exonic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148806478 17:50266557-50266579 CAGCAGGGATGGGGATGAGATGG - Intergenic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148869236 17:50646319-50646341 AAGCAGGAAAGGCGGGGAGAGGG + Intronic
1148899973 17:50867684-50867706 CTCCAAGAATGGAGAGGAGAGGG - Intronic
1149102942 17:52927998-52928020 CAGCAGGATGGATGGGGAGATGG + Intergenic
1149884994 17:60330893-60330915 TGCCTGGAATGGAGGGGAGAAGG - Intronic
1150739442 17:67767601-67767623 CAAAAGGCATGGAGAGGAGAGGG - Intergenic
1150860644 17:68797068-68797090 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1151175223 17:72282520-72282542 CAGCAGGTGGGAAGGGGAGAGGG - Intergenic
1151336585 17:73443604-73443626 TGGAAGGAATGGAGGAGAGATGG + Intronic
1151416558 17:73969984-73970006 CAGCAGGAAAGGAGTGGGGCAGG - Intergenic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152013606 17:77735595-77735617 CTGCAGGACTGGAGGGGCCAGGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152566683 17:81103467-81103489 CAGCAGGAAGGGAGGGGTCAGGG - Intronic
1152807258 17:82362026-82362048 CGGCAGGGATGAAGGGGACAAGG - Exonic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1154026865 18:10716191-10716213 CAGCAGAGGTGGAGGAGAGAAGG - Intronic
1154197814 18:12279227-12279249 CAGCAGGAGAGGAGGTGAGGAGG + Intergenic
1154342061 18:13511705-13511727 CAGTAGGAAAGGCGGGGACATGG + Intronic
1155156092 18:23158889-23158911 CAGAAGGAAAGGAAGGGAAATGG - Intronic
1155892846 18:31288710-31288732 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1155941398 18:31805037-31805059 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1155961803 18:32001513-32001535 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1156240220 18:35246751-35246773 CAGCAGGAAAGGTGGGGAAATGG + Exonic
1156252079 18:35360774-35360796 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1156302103 18:35845126-35845148 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1156449884 18:37260987-37261009 CAGCATGGTTGGAGGGGACAGGG - Intronic
1156457350 18:37302246-37302268 CAGCAGGAGAGGATAGGAGAAGG - Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157274504 18:46301391-46301413 CAGCAGGTGTGTGGGGGAGATGG + Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1157516688 18:48316336-48316358 GAGGAGGAGTGGTGGGGAGATGG - Intronic
1157906551 18:51574520-51574542 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1158298875 18:56030152-56030174 AGGCAGGAAGGTAGGGGAGAGGG - Intergenic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159390728 18:67789001-67789023 CCACAGGAATGCAGGGGACAGGG + Intergenic
1159929070 18:74293714-74293736 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1160412242 18:78683081-78683103 CGTCAGGAAGGGACGGGAGAAGG - Intergenic
1160678221 19:401552-401574 CAGCAGGCAGGGAGGGTACAGGG + Intergenic
1161003728 19:1924316-1924338 CAGCAGGAATGAAGGGGAGGAGG - Exonic
1161327298 19:3670013-3670035 CAGCAGGTATGGAGGGGGCTGGG + Intronic
1161711062 19:5848314-5848336 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1161849377 19:6730831-6730853 GAGAAGGGATGGAGGGGAGATGG - Intronic
1161955985 19:7495298-7495320 CAGAAGGAAGGAAGGAGAGAGGG - Intronic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162423512 19:10579910-10579932 CGGCAGGAAAGGTGGGGATAGGG - Intronic
1162541105 19:11296487-11296509 CAGGAGGGATGTAGGGCAGACGG + Intronic
1163055099 19:14712029-14712051 TAGCGGGAATGGGTGGGAGAGGG + Intronic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163187978 19:15653005-15653027 CCCCAGGTAGGGAGGGGAGAAGG + Intronic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163669692 19:18620385-18620407 CTGCAGGAAGAGAGGGGAGGAGG - Intronic
1163752458 19:19085828-19085850 CAAGAGGAGAGGAGGGGAGAGGG + Intronic
1163796110 19:19338947-19338969 CAGGAGGGAAGGAGGGGAGTGGG - Intronic
1163831307 19:19548351-19548373 CAGCAGGGATGGGGAGGAGCTGG - Intergenic
1163900431 19:20095444-20095466 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164292458 19:23880442-23880464 GAGGAGGAAAGGAGGAGAGAAGG + Intergenic
1164393560 19:27845518-27845540 GAGCAGGTATGAAGTGGAGATGG + Intergenic
1164459372 19:28434321-28434343 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1164623820 19:29714018-29714040 AAGCAGGAAGGAAGGGGAGAGGG - Intronic
1164849321 19:31468392-31468414 GAGCAGGAAGGGAGGAGGGAGGG + Intergenic
1165037002 19:33041040-33041062 CAGCTGGAATGGATCAGAGAAGG + Intronic
1165362342 19:35344704-35344726 CTGCACGCATGCAGGGGAGAAGG + Intronic
1165510455 19:36263917-36263939 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1165691045 19:37863454-37863476 CAATATGAATGGAGGGGACAAGG - Intergenic
1165814826 19:38635280-38635302 CAGGAGGAATAGCGGGGAGCTGG + Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166301197 19:41913051-41913073 CAGGAGGGATTGCGGGGAGAGGG - Intronic
1166310361 19:41959060-41959082 CAGCAGGCAGGGAGGGGACTAGG + Intronic
1166770084 19:45276489-45276511 CAGCAGGCATGGCTGGGGGAGGG + Intronic
1166905946 19:46108529-46108551 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1166917024 19:46202441-46202463 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1167099261 19:47393940-47393962 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1167560230 19:50222625-50222647 CGCCAGGCATGGAGGGGAGTGGG - Intronic
1167575060 19:50314084-50314106 CAGCAAGAATAGAGGCGAGCAGG + Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167900908 19:52621645-52621667 TAGGAGGAATGGAGGGTGGATGG - Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167908635 19:52683492-52683514 CTTCAGGAAGGGTGGGGAGAAGG - Intronic
1167939781 19:52937371-52937393 CTTCAGGAAGGGTGGGGAGAAGG - Intronic
1167944690 19:52978704-52978726 CTTCAGGAAGGGTGGGGAGAAGG - Intergenic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1167988522 19:53338464-53338486 CTTCAGGAAGGGTGGGGAGAAGG + Intronic
1168212267 19:54899361-54899383 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1168228127 19:55011211-55011233 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
925128057 2:1475935-1475957 CAGAAAGAATGTAGGTGAGAGGG - Intronic
925267296 2:2574941-2574963 CAGCAGGATTGGAGGCCAGCAGG - Intergenic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
925544406 2:5002243-5002265 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
925855184 2:8122661-8122683 CAGCTGGAATGGGAGGCAGAGGG + Intergenic
925898720 2:8493556-8493578 GAGCCGGAATGGAGGTGGGAGGG + Intergenic
926062782 2:9814481-9814503 GGGCAGGACTGGAGAGGAGAAGG + Intergenic
926407632 2:12571036-12571058 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
926413454 2:12627780-12627802 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
926464227 2:13168421-13168443 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
926928270 2:18010309-18010331 CAGCAGCAGTGTTGGGGAGATGG + Intronic
927083439 2:19652607-19652629 CAGCAGGATGGAAGGGGAAATGG - Intergenic
927471836 2:23383558-23383580 GAGCAGGAGTGGGGGGGAGGGGG - Intergenic
927554671 2:24023389-24023411 CAGTAGGAATGGCGGGGGGCCGG + Intronic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927651097 2:24914184-24914206 CAGCCGGAAGGGAGGACAGATGG - Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927712881 2:25336611-25336633 CAGCAGGGAGGGAGGGGAAGGGG - Intronic
927782636 2:25951910-25951932 GAGCAGGAATGAAGGAGTGATGG + Intronic
927940394 2:27099804-27099826 CAGGCTGGATGGAGGGGAGAAGG - Exonic
928228540 2:29476193-29476215 CTGCAGGCATGGGGAGGAGAGGG - Intronic
928394948 2:30936293-30936315 GGGCAGGAATTCAGGGGAGAAGG + Intronic
928424525 2:31167024-31167046 CAGCAAGAAGCAAGGGGAGAGGG + Intergenic
928857020 2:35814333-35814355 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
928921609 2:36533924-36533946 AAGAAGGAATGAAGGAGAGAGGG + Intronic
928921869 2:36535087-36535109 AAGAAGGAATGAAGGAGAGAGGG + Intronic
929164761 2:38870535-38870557 CAGAAACAATGGAGGGCAGAAGG + Intronic
929610143 2:43264949-43264971 CAGCATGGATGGAAGGGCGATGG + Intronic
929684682 2:44023514-44023536 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
929780400 2:44953472-44953494 CTCGAAGAATGGAGGGGAGAGGG + Intergenic
929788898 2:45009886-45009908 CAGGAGGAAGGGGAGGGAGAGGG + Intergenic
929793218 2:45038878-45038900 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
929942935 2:46348544-46348566 CAGCAGGAAAGCAGGGGAGAGGG - Intronic
930277126 2:49324720-49324742 AAGGAGGGAGGGAGGGGAGAAGG + Intergenic
930751935 2:54942941-54942963 TAGGAGGAATGTAGGGGAGAAGG - Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931271900 2:60710993-60711015 CTGCAGGAAAGGAGAAGAGAAGG - Intergenic
931345322 2:61440476-61440498 CAAGAAGAATGGAGGGGAAAAGG - Intronic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
931948116 2:67332856-67332878 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
932340470 2:70960095-70960117 CAGCAGGCATGGCTGGGGGAGGG + Intronic
932606550 2:73169503-73169525 CAGGAGGTCTGGTGGGGAGAGGG + Intergenic
932606786 2:73170601-73170623 GGGCAGGAATGGAGGAGAGAAGG + Intergenic
932886712 2:75555340-75555362 CAGAGGGAAAGAAGGGGAGATGG - Intronic
933012948 2:77089640-77089662 AAGGAGGAATGGAGGGTGGAAGG - Intronic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
933179911 2:79216277-79216299 AAGGAGGAATGGAGGGTGGAAGG + Intronic
933288454 2:80409508-80409530 CAGCAGAAAGTGAGAGGAGATGG + Intronic
933658430 2:84907285-84907307 CAGCAGGAAGGGTGGGGATGTGG + Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933925642 2:87089841-87089863 GGGCAGGAATGGAGGAGAGAAGG - Intergenic
933925876 2:87090932-87090954 CAGGAGGTCTGGTGGGGAGAGGG - Intergenic
934997205 2:98975179-98975201 CAGAAGTAATGGAGGCCAGAAGG + Intergenic
935092150 2:99905429-99905451 CAAGAGGAAGGGAGGGCAGAGGG - Intronic
935550397 2:104446983-104447005 CAGCTGTAAAGGAGGGGAGGGGG + Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936479209 2:112869328-112869350 CACCAGGAAGGAAAGGGAGAGGG - Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
938694344 2:133822017-133822039 CAACAGGAATGGAGATGGGAGGG + Intergenic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
939092184 2:137792109-137792131 CAGAAGGAAAGGAGGGGCAAGGG + Intergenic
939095229 2:137826667-137826689 CATCAGGAAAAAAGGGGAGAGGG - Intergenic
939241118 2:139560775-139560797 CAGCAGGAATGCGGGAGAAAGGG + Intergenic
939460879 2:142494315-142494337 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
940088229 2:149885910-149885932 CTGCAGTAATGGTGTGGAGATGG - Intergenic
940518570 2:154713475-154713497 CAGCAGGAGTGGTGGGGGGAGGG + Intronic
941456342 2:165714942-165714964 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
942033071 2:171982420-171982442 CAGCAGAGATGGAGAGGACAGGG - Intronic
942528262 2:176879669-176879691 CAGCCTGAAGCGAGGGGAGAAGG - Intergenic
942624369 2:177883814-177883836 CAAGAGGGAGGGAGGGGAGAAGG + Intronic
942904765 2:181167061-181167083 CAGCTGGAATGGCTGGGACAAGG + Intergenic
943413074 2:187564925-187564947 AAGGAGGAATGGAGGGTGGAAGG + Intronic
943440528 2:187922514-187922536 AGGCAGGAATGGAGGTGGGAAGG - Intergenic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
943865212 2:192919326-192919348 AAGAAGGAATGGAGGGTGGAAGG - Intergenic
943951442 2:194135356-194135378 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
944080482 2:195782798-195782820 CAGAAGACATGGAGGGCAGATGG - Intronic
944387302 2:199180638-199180660 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
944393987 2:199248189-199248211 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
944687892 2:202134078-202134100 CAGCAGGAACCAATGGGAGAAGG - Intronic
945153249 2:206811288-206811310 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
945188060 2:207159807-207159829 CTGCTCGAATGGAGGGGGGATGG + Intronic
945348256 2:208746172-208746194 CAGCAGGAATGGTGGGGGCGTGG + Intronic
945375963 2:209079339-209079361 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
945512858 2:210724163-210724185 CTGCAGGGAAGGTGGGGAGAAGG + Intergenic
945938166 2:215923635-215923657 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
946449265 2:219765760-219765782 CAGAAGGAGTGGAAGGGAGGTGG - Intergenic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
946519111 2:220446671-220446693 GGGGAGGAAGGGAGGGGAGAAGG - Intergenic
946519122 2:220446694-220446716 GAGGAGGGAGGGAGGGGAGAAGG - Intergenic
946708596 2:222484254-222484276 CAGCAGGAAGGAAGGAGAGAGGG - Intronic
946827701 2:223695726-223695748 AAGAAGGAAGGAAGGGGAGAAGG - Intergenic
946886351 2:224226550-224226572 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
946893135 2:224297951-224297973 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
946902196 2:224383461-224383483 CAGGAGGAAGGAAGGAGAGAAGG - Intronic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
948249118 2:236511485-236511507 CTGCAGGAGTGGAGGAGAGGAGG + Intergenic
948311584 2:236991252-236991274 TAGCAGGAAATGAGGGGAAAGGG - Intergenic
948610604 2:239163972-239163994 CAGCAGCAATGCAGGGCAGCGGG + Intronic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
1168739199 20:173772-173794 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1168798523 20:628643-628665 CATCAGGGATGGAGGGGACTGGG - Intergenic
1169041689 20:2500715-2500737 CAGCAGGCAGGGATTGGAGAAGG + Exonic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169065268 20:2691656-2691678 GACCAGGAAAGGAGGTGAGAGGG + Intergenic
1169193042 20:3669773-3669795 GAGCAGGAAGGGAGCTGAGAGGG - Intronic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169811178 20:9610889-9610911 CAGAAGAGATGGAGGGGAAATGG - Intronic
1169945019 20:10978978-10979000 AAGAAGGGAGGGAGGGGAGAGGG - Intergenic
1170069005 20:12344710-12344732 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1170106092 20:12755148-12755170 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1170272068 20:14538344-14538366 CTGGAGCAATGGAGGAGAGATGG + Intronic
1170357363 20:15507307-15507329 AAGCAGGAAGGGAGGGAGGAAGG - Intronic
1170532994 20:17313375-17313397 CAGCAGGAGTGGGAGGGGGAAGG - Intronic
1170579377 20:17686381-17686403 CAGCAGGAGTGAAGGAGAGAGGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171374563 20:24683571-24683593 CCGCAGGGAGGGAGGGGACAGGG + Intergenic
1171947568 20:31392062-31392084 CATCAGGAAAGGAGGAGTGATGG + Intergenic
1172689238 20:36779014-36779036 GGGCAGGAAGGGAGGGGAGCAGG + Exonic
1173096079 20:40029688-40029710 AGGAAGGAATGAAGGGGAGAAGG + Intergenic
1173113548 20:40218558-40218580 AAGCAGAGAGGGAGGGGAGAAGG - Intergenic
1173427901 20:42958444-42958466 GAGGAGGAAAGGAGGGGGGAGGG + Intronic
1173495146 20:43513404-43513426 CAGCAGCAATGGAGATGTGAAGG - Intronic
1174257748 20:49270877-49270899 CTGCAGGAAAAGAGGCGAGAGGG - Exonic
1174421418 20:50401417-50401439 CTTCAGGAATCGAGGGGAGGAGG - Intergenic
1174557898 20:51408883-51408905 CAGCAGGACTGGGGTGGAGGTGG + Intronic
1174589902 20:51636649-51636671 CAGCTGGAATTGAGGGGAGCTGG - Intronic
1174674954 20:52344771-52344793 CAGATGGATTGGAGGGGTGAGGG + Intergenic
1174843443 20:53920998-53921020 GAGGAGGCAGGGAGGGGAGAAGG - Intergenic
1175227197 20:57451459-57451481 CAGCAGCAAAGAAGGGGGGATGG + Intergenic
1175311970 20:58018511-58018533 CAGCAAATATGGAAGGGAGAGGG + Intergenic
1175422094 20:58840939-58840961 CAGGTGGAAAGGAGGTGAGAAGG + Intronic
1175744475 20:61445561-61445583 GAAGAGGAAGGGAGGGGAGAGGG - Intronic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175818697 20:61896913-61896935 TGGCAGGGAGGGAGGGGAGAAGG + Intronic
1175826948 20:61941695-61941717 CAGGAGGCACGGAGGGCAGAGGG - Intergenic
1175909138 20:62396298-62396320 CAGCAGGTATGAAGCGGAGCCGG - Exonic
1176003763 20:62848076-62848098 CCGCAGGAAAGGAGGAGAGAAGG + Intronic
1176129749 20:63491715-63491737 CAGAAGGATGGGTGGGGAGATGG + Intronic
1177031330 21:15984271-15984293 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1177100481 21:16893432-16893454 AAGCAGGAATGGAGGGTGGAAGG - Intergenic
1177119417 21:17122730-17122752 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1178001051 21:28162427-28162449 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1178329845 21:31678633-31678655 CAGCAGGAAGGGAGAGCAAAGGG - Intronic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1178904826 21:36628158-36628180 AAGCAGGATTGGATGGGATAGGG - Intergenic
1179073939 21:38100231-38100253 CAGGTGGAATGGAAGGGTGATGG - Intronic
1179131789 21:38643995-38644017 GAGAAAGAAAGGAGGGGAGAGGG - Intronic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1179340859 21:40507885-40507907 ATGCAGGAGTGGAGGGGCGAGGG - Intronic
1179464061 21:41559789-41559811 CAGAAGAAATGAAGAGGAGAAGG + Intergenic
1179595267 21:42438872-42438894 GGGCAGGAATGGAGGGGCCATGG + Intronic
1179650519 21:42805501-42805523 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1179715141 21:43282493-43282515 CAGCAGGCAGGGTGAGGAGAGGG + Intergenic
1179799530 21:43804484-43804506 CAGCAGGTGTGAAGGGGAGAGGG - Exonic
1179994141 21:44966223-44966245 CAGCGGGATTGGAGAGGAGCTGG + Intronic
1180072870 21:45445554-45445576 CTGCAGGAAGGGACGTGAGATGG - Intronic
1180150394 21:45944222-45944244 GAGCAGGTGAGGAGGGGAGACGG + Intergenic
1180560747 22:16612518-16612540 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181033584 22:20159499-20159521 CAGGAGGAAGGAAGCGGAGATGG - Intergenic
1181359927 22:22326784-22326806 CAGCAGGAGAGGTGAGGAGAGGG - Intergenic
1181369951 22:22408213-22408235 CAGCAGGAGAGGTGAGGAGAGGG - Intergenic
1181438884 22:22925505-22925527 GACCAGGAATGGAGGGGATTGGG - Intergenic
1181776764 22:25165808-25165830 CACCAGGCCTGGAGGTGAGAGGG + Intronic
1181978173 22:26747221-26747243 CAGAAGGAATGCAGGGGTTAGGG - Intergenic
1182474522 22:30569378-30569400 CAGCAGGTATGGAGGAGAGGAGG + Intronic
1182516391 22:30861443-30861465 CAGCAGGAGATGAGGAGAGAGGG + Intronic
1182576815 22:31278488-31278510 CAGCAGGAATGGGGCACAGAGGG - Intronic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1182998459 22:34835609-34835631 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183197603 22:36364257-36364279 CTGCAGGACTAGAGGTGAGATGG - Intronic
1183358030 22:37369819-37369841 CCACAGGGAGGGAGGGGAGATGG - Exonic
1183418417 22:37696253-37696275 CAGCAGGAGTCCAGGAGAGATGG - Intronic
1183635816 22:39061968-39061990 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1183746258 22:39693810-39693832 CAGAAAGAGAGGAGGGGAGATGG - Intergenic
1183848211 22:40561145-40561167 CAGCAGGTATGTAGGGGTGGTGG + Intronic
1184152250 22:42645979-42646001 CAGGAGCAGTGGAGGGGCGAAGG + Intronic
1184251392 22:43262424-43262446 CAGCAGGAATGGTGGGGCCGTGG - Intronic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1184408523 22:44313525-44313547 CAGTAGGAATGGGGTGGGGATGG + Intergenic
1184434394 22:44461401-44461423 GAGATAGAATGGAGGGGAGAGGG + Intergenic
1184562969 22:45274074-45274096 GAGCAGATTTGGAGGGGAGAAGG - Intergenic
1184840346 22:47048800-47048822 CAGGAGCAATGTAGGGGTGAGGG + Intronic
1184859148 22:47163342-47163364 GAGCAGGAATTATGGGGAGAGGG - Intronic
1185197135 22:49478697-49478719 CAGGAGGAAGAGAGGGGAGGGGG + Intronic
949190542 3:1244225-1244247 AAGGAGGAATGGAGGGTGGAAGG + Intronic
949671009 3:6398918-6398940 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
950151980 3:10694838-10694860 CAGCAGAGAGGGAGGGGGGAAGG - Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950555343 3:13692433-13692455 CAGGAGGAAAGGAGGCGACATGG - Intergenic
950933312 3:16812514-16812536 CAGCAGGAATGGAGGTGGGTAGG + Intronic
951298954 3:20971975-20971997 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951728999 3:25790168-25790190 AAGGAGGAAAGGAGGGGCGAAGG - Intronic
951731620 3:25816025-25816047 CAGCAGGATTGATGGGGAGCTGG - Intergenic
951894720 3:27599972-27599994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
951914291 3:27783172-27783194 AAGAAGGAAAGGAGGGGAGAAGG + Intergenic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952217608 3:31293426-31293448 CTGAAGGAATGGAGGTGGGATGG - Intergenic
952296670 3:32068472-32068494 AAGGAGGAATGGAGGGTGGAAGG - Intronic
952379792 3:32795894-32795916 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
952522103 3:34171616-34171638 AAGCAGGAATGGTTGGGGGATGG + Intergenic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
952895409 3:38075487-38075509 AAGGAGGAATGGAGGGTGGAAGG + Intronic
952896202 3:38080707-38080729 AAGGAGGAATGGAGGGTGGAAGG + Intronic
953077276 3:39582247-39582269 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
953273865 3:41475867-41475889 AAACAGGAAGGGAGGAGAGAAGG + Intronic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
953663672 3:44909685-44909707 GAGCTGGAAAGAAGGGGAGATGG + Intronic
953834610 3:46331882-46331904 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
953916399 3:46923515-46923537 GAGAAGGAATGGGGGGCAGAGGG + Intronic
953997166 3:47528874-47528896 CAGCAACAATGGAGGCCAGAAGG + Intergenic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954161948 3:48729217-48729239 AAGGAGGAATGGAGGGTGGAAGG + Intronic
954293083 3:49660036-49660058 CAGGAGGCATGGAGTGGAGAGGG - Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954401748 3:50322813-50322835 CAGCAGGAAGTGAGGAGAAAGGG - Intronic
954430292 3:50467218-50467240 CAGCAGCAGTGGAGAGGAGCTGG - Intronic
954453224 3:50582915-50582937 CAGGAGCAAGGGAGGGGATAGGG - Exonic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955253214 3:57304933-57304955 AAGGAGGAATGGAGGGTGGAAGG - Intronic
955991675 3:64634356-64634378 CAGAATGAATGGAGGTGTGAGGG - Intronic
956233654 3:67043178-67043200 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
956612446 3:71137869-71137891 CAGGAGGAGGGAAGGGGAGAAGG - Intronic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
956733181 3:72215445-72215467 GAGGAGGAAAGGCGGGGAGATGG - Intergenic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957360117 3:79144457-79144479 AAGAAGGAAAGGAGAGGAGAAGG - Intronic
958130345 3:89411458-89411480 AAGCAGGGATGGTGGTGAGAGGG - Intronic
959341492 3:105137040-105137062 AAACAGGGATGGAGGGGTGAGGG + Intergenic
959637756 3:108594413-108594435 GAGCAGGGAGGGAGGGGGGAGGG - Intronic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960310259 3:116109751-116109773 GAGGAGGAATGGAGGGTGGAAGG + Intronic
960345272 3:116522647-116522669 CAGAAGCAAGGGAGGGGAGCAGG - Intronic
960806689 3:121590487-121590509 CAGAAGGAAGGGAGAGGAGGAGG - Intergenic
961046669 3:123713195-123713217 CAGCAAGAAAGAAGGGAAGATGG + Intronic
961224296 3:125225747-125225769 GATTAGGAATGGTGGGGAGAGGG - Exonic
961343862 3:126248289-126248311 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
961427154 3:126857289-126857311 CAGCAGCTATGAAGTGGAGAAGG + Intronic
961532275 3:127547100-127547122 CAAGAGGAGAGGAGGGGAGAGGG + Intergenic
961730434 3:128960991-128961013 GAGGAGGAATGGAGGGTGGAAGG - Intronic
961880911 3:130060535-130060557 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962524174 3:136222724-136222746 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963468463 3:145711626-145711648 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963520295 3:146354808-146354830 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963521475 3:146363309-146363331 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963649673 3:147962892-147962914 CAGCAGGGAAGGAAGGGAAAGGG - Intergenic
963663192 3:148152913-148152935 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963684185 3:148415610-148415632 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
964125611 3:153231165-153231187 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
964176237 3:153828096-153828118 AAGGAGGAATGGAGGGTTGAAGG + Intergenic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
964743467 3:159990068-159990090 AAGCATGAATGGATGGGTGAAGG + Intronic
964791882 3:160460456-160460478 CAGCAGGAATGGAGAGGTGGGGG + Intronic
964983493 3:162713636-162713658 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
965286876 3:166828539-166828561 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965713254 3:171577681-171577703 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
965862128 3:173160382-173160404 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
966066695 3:175828985-175829007 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
966232987 3:177670279-177670301 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
966415677 3:179687314-179687336 CAGCAGGAATGGAGAAGACAGGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966588212 3:181650984-181651006 AGGAAGGAAGGGAGGGGAGAGGG + Intergenic
966949689 3:184804929-184804951 CAGCAAGAATGTCAGGGAGATGG - Intergenic
967138245 3:186530596-186530618 CAGCAGGAAGTGAGGGGGCAGGG + Intergenic
967212313 3:187179960-187179982 AAGGAGGAATGGAGGGTGGAAGG + Intronic
967232064 3:187348748-187348770 CAGCAGGAGTGGGGTGGTGAAGG + Intergenic
967278005 3:187795401-187795423 AAGAAGGAAGGGAGGGAAGATGG + Intergenic
967294084 3:187948563-187948585 CAGGAGGCATGGAGGTGACAGGG + Intergenic
967658258 3:192075527-192075549 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
967787188 3:193510000-193510022 ATGCATGAATGGAGGGGAGAAGG + Intronic
967789042 3:193527639-193527661 CGGCAGGAAGGCAGGGGAGGGGG - Intronic
967815818 3:193797356-193797378 CAGCAAGAATGGAGAGGAGATGG + Intergenic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
968045974 3:195624162-195624184 CTGCAGGAACGGAGGGGGGGCGG - Intergenic
968308680 3:197665925-197665947 CTGCAGGAACGGAGGGGGGGCGG + Intergenic
968468645 4:765978-766000 TAGCAGGGGTGGAGGCGAGAAGG - Intronic
968591490 4:1462020-1462042 GAGCACGGATGGAGGCGAGAGGG - Intergenic
968993242 4:3928640-3928662 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969269599 4:6090254-6090276 CTGCAGACATGCAGGGGAGAAGG + Intronic
969375436 4:6760579-6760601 CAGCTGGAAAGGAGCAGAGATGG + Intergenic
969494632 4:7519648-7519670 CAGCAGCAATGAAGGGATGAGGG - Intronic
969512941 4:7629987-7630009 TAGGAGAACTGGAGGGGAGAGGG - Intronic
969680313 4:8639685-8639707 CAGCAGGAAGGAAGGTGAAATGG + Intergenic
969896273 4:10307933-10307955 CAGCAGGAAGGTAGGAGAGCAGG + Intergenic
969944111 4:10765247-10765269 CAGAAGGAAAGGCAGGGAGATGG - Intergenic
970041950 4:11807523-11807545 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
970142333 4:12996168-12996190 CTGCAGGGATATAGGGGAGATGG - Intergenic
970159168 4:13171880-13171902 CAGCAAGAATGGAGCTGAGCAGG - Intergenic
970256569 4:14174958-14174980 AAGAAGGAATGGAGGGTGGAAGG + Intergenic
970512238 4:16792912-16792934 CAGCAAGAATGGAGCAGAGCTGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
970963692 4:21902959-21902981 TAGCAGGAATTGGAGGGAGAGGG + Intronic
972071284 4:35021256-35021278 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
972465198 4:39348946-39348968 CAGAAGGGAGGGAGGGGTGATGG - Intronic
973184302 4:47306429-47306451 TAGGAGGAAGGGAGAGGAGAAGG + Intronic
973643046 4:52922058-52922080 CAGGAGGTAGGGAGGTGAGACGG - Intronic
974019019 4:56676721-56676743 CAGCAGCAGTGGGGAGGAGAGGG - Intronic
974160559 4:58132802-58132824 CAGGAGTAATGGAGGTGAAAAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975397907 4:73898901-73898923 CAGCAGGAAGGAAAGGAAGATGG + Intergenic
975570202 4:75808710-75808732 AGACAGGAAGGGAGGGGAGAAGG - Intronic
975788442 4:77920746-77920768 AAGGATGAATGGAAGGGAGAAGG - Intronic
975829723 4:78356643-78356665 CAGATGCAATGGAGGGGAGGAGG + Intronic
975865236 4:78718309-78718331 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
975934038 4:79558429-79558451 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
976496761 4:85739192-85739214 CACCAGGGAGGCAGGGGAGAGGG - Intronic
976558423 4:86475835-86475857 AAGGAGGAATGGAGGGGTGAAGG - Intronic
976582107 4:86749247-86749269 GAGGAGGGAGGGAGGGGAGAAGG - Intronic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
977041868 4:92027105-92027127 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
977062657 4:92275943-92275965 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
977075358 4:92443411-92443433 AAGGAGGAATGGAGGGTGGAAGG + Intronic
977180545 4:93868062-93868084 TGGCAGGAATTGAGGGGAGATGG - Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977294126 4:95192587-95192609 GAGCAGGGAAGGAGGTGAGAAGG - Intronic
977586391 4:98779762-98779784 CTGCACAAATGGAGGGGAGGAGG - Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978191201 4:105914693-105914715 CAGCAGTGATGGAGTGGTGATGG + Intronic
978265664 4:106821490-106821512 CAGCCAGGATGGAGGGGAGATGG + Intergenic
978399125 4:108312399-108312421 AAGAAGGAAGGGAGGGTAGAAGG + Intergenic
979054773 4:115980104-115980126 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
979060123 4:116046753-116046775 CAGCAGCAAAGGAGTAGAGATGG + Intergenic
979361550 4:119771400-119771422 CAGCAAGCATGGTGGAGAGAAGG - Intergenic
979379788 4:119995181-119995203 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
979640823 4:123011760-123011782 AAGGAGGAATGGAGGGTGGAAGG + Intronic
979856525 4:125639525-125639547 AAGCAGTAAGGAAGGGGAGAAGG - Intergenic
980112074 4:128645279-128645301 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
980388778 4:132119462-132119484 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
980903788 4:138929133-138929155 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
981046212 4:140267596-140267618 CGGCTGGGAAGGAGGGGAGAAGG - Intronic
981513491 4:145582834-145582856 CAGCAGGCAAGGAGCAGAGATGG - Intergenic
981525059 4:145700386-145700408 AAGGAGGAATGGAGGGTGGAAGG - Intronic
981539578 4:145834002-145834024 AAGGAGGAATGGAGGGTGGAAGG - Intronic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
982414340 4:155112899-155112921 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
982535299 4:156601557-156601579 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983012538 4:162564875-162564897 AAGAAGGAAGGGAAGGGAGAAGG + Intergenic
983023721 4:162710361-162710383 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983055338 4:163094364-163094386 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983144493 4:164196894-164196916 GGGCAGGATTGGAGGGGGGAGGG + Intronic
983360272 4:166717559-166717581 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
983500982 4:168499343-168499365 CAGAAGGGAGGGAGGGGGGAGGG + Intronic
983536864 4:168867068-168867090 CAGCTGGAAAGAAGTGGAGACGG - Intronic
983566728 4:169160992-169161014 CAGAAGGCTTGGAGGGCAGAGGG - Intronic
983703110 4:170623081-170623103 GACCAGGCAGGGAGGGGAGAGGG + Intergenic
983831963 4:172338951-172338973 GTCCAGGCATGGAGGGGAGAGGG + Intronic
983883917 4:172960860-172960882 AAGGAGGAATGGAGGGTGGAAGG + Intronic
984332819 4:178348393-178348415 AAACATGAATGGAGGAGAGAAGG + Intergenic
984703158 4:182831842-182831864 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703167 4:182831874-182831896 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703325 4:182832327-182832349 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703329 4:182832343-182832365 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703333 4:182832359-182832381 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703340 4:182832375-182832397 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703344 4:182832391-182832413 CAGAAGGAGGGGAGAGGAGAAGG - Intergenic
984703739 4:182833877-182833899 AAGGAGGAGGGGAGGGGAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985390023 4:189483914-189483936 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
985393510 4:189516157-189516179 AAGAAGGAATGGAAGTGAGATGG - Intergenic
985428573 4:189855679-189855701 CAGGAGGAACAGAGGGGAAATGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985582206 5:704050-704072 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985645785 5:1084132-1084154 CAGCAGGAATGCAAGGGCCAGGG + Intronic
985663624 5:1169855-1169877 CAGCAGGGAAGGAGGGGAGGAGG + Intergenic
985907700 5:2853794-2853816 CAGCAGGAACAGAGGAGAGCAGG + Intergenic
986324503 5:6662002-6662024 CAGCAGAGAGGGAGGGCAGAAGG - Intronic
986388734 5:7264860-7264882 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
986763240 5:10899055-10899077 CAGTAGGAATGCTGGAGAGAGGG + Intergenic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
986856663 5:11876262-11876284 GGGCAGGAAAGGCGGGGAGAGGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987281892 5:16421267-16421289 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
987780494 5:22427742-22427764 AAGCAGGAATGGAGGAGAGAAGG + Intronic
988342430 5:29990537-29990559 CAGAAGGAATGGAGAATAGAAGG + Intergenic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
989695171 5:44191651-44191673 CACCAGGAATGCACTGGAGAGGG - Intergenic
990415520 5:55582487-55582509 CAGCAGGAGTGGGTGGGGGAGGG - Intergenic
990565271 5:57021455-57021477 AAGAAGGAATGGAGGGTGGAAGG + Intergenic
990687502 5:58322693-58322715 AAACAGGAAAGGAGGGCAGAAGG + Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991592011 5:68261883-68261905 CAGCAGAAAGGGAAGGGATAGGG - Intronic
992008851 5:72507463-72507485 AGGAAGGAAGGGAGGGGAGAGGG + Exonic
992123266 5:73615797-73615819 CAGGAGGAAGGGACGTGAGATGG + Intergenic
992394517 5:76358614-76358636 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
992434582 5:76743120-76743142 CAGAAGGAATGGAGGAAATAAGG + Intergenic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
993095414 5:83473604-83473626 CAGCAGGGAGGGAGGAGCGAGGG + Intronic
993167971 5:84382611-84382633 TAGCAGGAAGGGAAGGGGGAAGG - Intronic
993836200 5:92823085-92823107 CAGGAGGGAAGGAGGGGACAAGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994093116 5:95825919-95825941 GAGCAGGTATGGAGGAAAGAGGG - Intergenic
994126271 5:96171359-96171381 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
994775541 5:104032885-104032907 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
994779156 5:104068986-104069008 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
994807705 5:104472966-104472988 CAGAAACAATGGAGGTGAGAAGG - Intergenic
994989399 5:106979641-106979663 TAGGAGGAATGGAGGGTGGAAGG - Intergenic
995004593 5:107176222-107176244 CAGCAGGAGAGGAGAGGAAAAGG + Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995397506 5:111702924-111702946 GAAAAGGAAGGGAGGGGAGAAGG + Intronic
995899517 5:117050811-117050833 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
995975322 5:118028766-118028788 GAGAAGGAGCGGAGGGGAGAAGG - Intergenic
996052818 5:118951693-118951715 AAGGAGGAATGGAGGGTGGAAGG + Intronic
996096720 5:119406980-119407002 TAGCAGGGTGGGAGGGGAGAGGG + Intergenic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
996501562 5:124222704-124222726 GACCAGGAATTAAGGGGAGAGGG - Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
996715459 5:126584326-126584348 CAGCAAGATTGGAGGGGAAATGG + Intronic
997281838 5:132653914-132653936 CAGCAGCAAGGGTGGAGAGAGGG - Intergenic
997522890 5:134534633-134534655 CAGCAGGAATGGACTGGGGTTGG + Intronic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
997769821 5:136544065-136544087 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
997772786 5:136569785-136569807 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
997953928 5:138263953-138263975 CAGCGGGTATGGACAGGAGATGG - Intronic
998159664 5:139806271-139806293 CAGCAGGGCTGGAGGTGGGAAGG + Intronic
998381890 5:141731621-141731643 CAGCAAGAATGGCGTGGAGCTGG + Intergenic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998470139 5:142377429-142377451 AACCAGGAAGGGAGGTGAGATGG + Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999236858 5:150103790-150103812 GTGAAGGAATGGAGTGGAGATGG + Intronic
1000606778 5:163335276-163335298 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1000769103 5:165329061-165329083 GAACAGGAAAGGAGGGGACAAGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1000885478 5:166743562-166743584 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1000895406 5:166849055-166849077 CTCAAGGAATGGAGGAGAGAAGG + Intergenic
1000935791 5:167302350-167302372 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001710903 5:173777231-173777253 AAGCAGGAGTGGAGGACAGAGGG + Intergenic
1001771428 5:174300002-174300024 CAGCAGTAAAGGAGGGCAGCTGG + Intergenic
1001860215 5:175047782-175047804 CAGGACGGATGCAGGGGAGAAGG + Intergenic
1002210587 5:177596599-177596621 CAGCTGGAATGGAGGTGGGTGGG + Intergenic
1002931658 6:1639151-1639173 GAGCAGGAGCGGAGGAGAGAGGG + Intronic
1003149980 6:3540325-3540347 CAGCAGAAATGGGGAGGGGAAGG - Intergenic
1003425813 6:5997477-5997499 CAGCTGAAATGGCGAGGAGACGG - Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1003534317 6:6962912-6962934 CAGAAGGAAGGGAGGTGAGATGG - Intergenic
1003706352 6:8535589-8535611 CAACAGGAAATGAGGGAAGAAGG - Intergenic
1003934980 6:10966476-10966498 CAGGACCAATGGATGGGAGATGG + Intronic
1004106112 6:12668644-12668666 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1004283672 6:14301402-14301424 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1004447362 6:15712410-15712432 CTGCAGGAAGTGAGGGGAGCTGG - Intergenic
1004467121 6:15896277-15896299 AAGCAGCCATGGAAGGGAGACGG - Intergenic
1004508143 6:16263444-16263466 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1005802928 6:29445378-29445400 CAGATGGAAGGGAAGGGAGAAGG + Intronic
1006129306 6:31859811-31859833 CAGCATGGATGGAGAGGAGCAGG - Exonic
1006200666 6:32287064-32287086 CTGCATCAATGGAAGGGAGATGG + Intergenic
1006433017 6:34009757-34009779 CAGCAGGAGGGGAGAGGAAAGGG + Intergenic
1006554867 6:34857359-34857381 CTGCAGGAAAGGAGTGTAGATGG - Exonic
1006672829 6:35740279-35740301 CAGCAGGAAAGCAGGGAGGATGG - Intronic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007710105 6:43817461-43817483 CAGCAGCAGTGGAGAGGGGAGGG - Intergenic
1007715940 6:43856229-43856251 GAGCAGGGATGGAGATGAGAGGG + Intergenic
1007808868 6:44472497-44472519 AAGCAGGATGGGAGGGGAGGGGG - Intergenic
1008476374 6:51939410-51939432 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1008664845 6:53706003-53706025 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1008964002 6:57296028-57296050 CAACAGGATGGGTGGGGAGAGGG + Intergenic
1009378999 6:63006538-63006560 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1009395078 6:63190290-63190312 CAGAAGGAAGAAAGGGGAGATGG + Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1009750455 6:67873427-67873449 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1009876438 6:69511534-69511556 CAGCTGGGATGGAGGGGCCAAGG - Intergenic
1009963415 6:70552400-70552422 CAGCAGGAGCGGCGGGGCGAGGG + Intronic
1010071875 6:71753029-71753051 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1010145900 6:72669305-72669327 CGGAAGGAATGAAGGGGTGATGG + Intronic
1010586843 6:77664986-77665008 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1011097116 6:83678684-83678706 GAGCAGGAGTGGAAGGTAGAAGG - Intronic
1011099586 6:83707958-83707980 CTGCAGGAAACAAGGGGAGACGG + Intronic
1011771090 6:90674660-90674682 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1011789165 6:90879416-90879438 CAGCTGGGTTGGAGGGGAGAAGG - Intergenic
1012135352 6:95548828-95548850 CAGAAGGATTTGAGGGGTGATGG - Intergenic
1012315675 6:97780855-97780877 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1013004946 6:106063730-106063752 CAGCTGACATGGAGGGTAGAAGG + Intergenic
1013305444 6:108843479-108843501 GAGCAGGAAGGGAGTGGAGTGGG + Intergenic
1013408029 6:109860194-109860216 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1013757635 6:113480263-113480285 CAATAGGAATAAAGGGGAGATGG + Intergenic
1013808285 6:114017150-114017172 AAGTAGGAATGGAGGGTGGAAGG + Intergenic
1014115493 6:117664168-117664190 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1014395861 6:120926100-120926122 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1014422634 6:121264086-121264108 GAGCAGAAATGAAGGAGAGACGG + Intronic
1014455014 6:121624875-121624897 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1014555697 6:122841098-122841120 GAGGAGGAATGGAGGGTAGAAGG - Intergenic
1014614813 6:123586729-123586751 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1014918769 6:127187102-127187124 CAGCGGGCATGGTGGTGAGATGG + Intronic
1015110350 6:129585860-129585882 AAGCAGGAATTGAGGGGTGTGGG - Intronic
1015288182 6:131508732-131508754 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1016114293 6:140261859-140261881 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1016183313 6:141173080-141173102 AAGAAGGAATGGGGAGGAGACGG + Intergenic
1016214947 6:141588209-141588231 TTCCAGGAATGGTGGGGAGAGGG + Intergenic
1016248712 6:142017073-142017095 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1016402335 6:143694096-143694118 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1016426606 6:143942114-143942136 CAGTTGGAATGAAGGCGAGATGG + Exonic
1016696364 6:147000715-147000737 GAGGAGGAAAGCAGGGGAGAGGG + Intergenic
1017235236 6:152111684-152111706 AGGCTGGAAGGGAGGGGAGAAGG + Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017758649 6:157551207-157551229 CAGGAGGAAGGGAGGGGACACGG - Intronic
1017779479 6:157705121-157705143 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1017923050 6:158887858-158887880 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1018101879 6:160447321-160447343 CAGGAGGAATCGGAGGGAGAGGG + Intronic
1018495555 6:164343191-164343213 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1018521621 6:164656603-164656625 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1018852596 6:167652286-167652308 GAGCAGAAATGAAGTGGAGAGGG + Intergenic
1019186728 6:170224787-170224809 GACCAGGAATGCAGGGCAGAGGG - Intergenic
1019360484 7:602104-602126 AAGCCTGAGTGGAGGGGAGACGG - Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019539332 7:1544719-1544741 CAGGAGGCAGGGAGGAGAGAGGG + Exonic
1019616831 7:1967118-1967140 CAGCAGGAAGGGAGAGGGCAAGG + Intronic
1019891994 7:3954482-3954504 AAGCAGGAGGGGAGGGGGGAGGG - Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020503685 7:8956351-8956373 CAGGAAGAATGGATGGGAGTAGG - Intergenic
1020532857 7:9357855-9357877 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1020541274 7:9462967-9462989 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
1021239905 7:18187673-18187695 TAGGCTGAATGGAGGGGAGAGGG - Intronic
1022493674 7:30839721-30839743 CAGCATTAATGAAGGGGAGGCGG + Intronic
1022745903 7:33172014-33172036 AAGCAGGAAAGCAGGGGAGAAGG + Intronic
1023156462 7:37256769-37256791 GAGGAGGAAGGGAAGGGAGAAGG + Intronic
1023522087 7:41059151-41059173 CAGCAGGAGAGTAGGGGAGGGGG - Intergenic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1023699038 7:42875059-42875081 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1023752445 7:43385294-43385316 ACGCAGGAGGGGAGGGGAGAGGG - Intronic
1024016909 7:45325520-45325542 CAGCAGGACTGGAAGGGGGAGGG + Intergenic
1024097602 7:45996396-45996418 CAGCAAGCATGAAGGGCAGAAGG + Intergenic
1024374646 7:48623066-48623088 CAGCAGGAAGGAAGCGGAAATGG - Intronic
1025789867 7:64679615-64679637 GAGGAGGAATGGAGGGTGGAAGG - Intronic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1026127011 7:67587898-67587920 CAGCAGGAAGGAAGGAAAGAGGG - Intergenic
1026462968 7:70631126-70631148 CATCAGGAATGGCGCGGCGAGGG - Intronic
1026631960 7:72045381-72045403 CACCAGGAAGGGAGAGGAAATGG - Intronic
1026650138 7:72209473-72209495 AAGCAGGGAAGGAAGGGAGAAGG - Intronic
1027195347 7:76026257-76026279 CAGCGGGAATGGGGAGGAAAGGG + Intronic
1028117298 7:87013551-87013573 CAGCAGGGATGGAGTGAGGAAGG + Intronic
1028465359 7:91145500-91145522 GAGAAGGGGTGGAGGGGAGAAGG - Intronic
1028527027 7:91797881-91797903 CAGCTGGAATGCAGAGGACATGG + Intronic
1029084951 7:98004079-98004101 CAGAAGGAAGGAAGGGGGGAGGG - Intergenic
1029205388 7:98866592-98866614 AAGCAGGAATCGAGGGGGCAAGG + Intronic
1029403939 7:100362057-100362079 GAGCAGGAATGGAGAGCAGGGGG + Intronic
1029436817 7:100568305-100568327 CAGCAGGACTGGGAGGGGGAGGG + Intergenic
1029441538 7:100589656-100589678 CAGCAGGAACGGGGGGGCCAAGG + Exonic
1029485406 7:100836849-100836871 CAGCAGGAATGGGGTGGGGGAGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029500065 7:100923397-100923419 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1029926946 7:104328545-104328567 CAGGAGGGAGGGAGGGGAGCCGG + Intergenic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030163768 7:106532885-106532907 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1030189443 7:106795754-106795776 CAGCAGGAATGGAGAGGGCTGGG + Intergenic
1030233813 7:107236752-107236774 TAGCAGCATTGGTGGGGAGAGGG - Intronic
1031004527 7:116456781-116456803 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1031296462 7:120010130-120010152 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031364895 7:120890095-120890117 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031399842 7:121316845-121316867 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031422611 7:121568466-121568488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031448103 7:121879824-121879846 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031525446 7:122818179-122818201 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1031728076 7:125263354-125263376 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031776181 7:125911247-125911269 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031856125 7:126924622-126924644 CAGAAGGAAGGGAGGAAAGAAGG - Intronic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032836886 7:135682916-135682938 CAGTAAGATGGGAGGGGAGAGGG + Intronic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1033676101 7:143541675-143541697 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1033695733 7:143787764-143787786 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1033909606 7:146247811-146247833 AAGGAGGAATGGAGGGTGGATGG + Intronic
1034295862 7:149971962-149971984 AAGCAGGAAAAGAGAGGAGAGGG - Intergenic
1034333927 7:150308244-150308266 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034605330 7:152307383-152307405 AGGGAGGAAGGGAGGGGAGAAGG + Intronic
1034810191 7:154124940-154124962 AAGCAGGAAAAGAGAGGAGAGGG + Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035239966 7:157523177-157523199 CAGCAGGGATGGTGGGGGGCTGG + Intergenic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036149401 8:6283779-6283801 CAGCAGGCAGGGATGGGACATGG - Intergenic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037636616 8:20705875-20705897 CATCATTAATGGAGGGGGGAGGG + Intergenic
1037692369 8:21192921-21192943 CAGCAGGAATGGTGGCCTGAGGG + Intergenic
1037883743 8:22585649-22585671 CAGCAGGATGGGAGGGGAGGGGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1037974069 8:23197085-23197107 CAGCAGAAATGGTGGGAATAGGG - Intronic
1038420280 8:27430173-27430195 GGACAGGAAGGGAGGGGAGATGG - Intronic
1038464752 8:27751209-27751231 CAGCAGCAATGGAAGGGATAAGG + Intronic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1039393742 8:37204751-37204773 CAGAAAAAATGAAGGGGAGAAGG + Intergenic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1039903878 8:41772430-41772452 GAGAAGAAATGGAGGGGAGGAGG - Intronic
1040639703 8:49319190-49319212 CAGCAGAAATGCATGGGAGGTGG - Intergenic
1040647865 8:49420708-49420730 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1040905926 8:52469890-52469912 CAGGAGGGGAGGAGGGGAGAGGG - Intergenic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1041453791 8:58035862-58035884 AAGCAGGGAAGGAGGGCAGAAGG - Intronic
1041485189 8:58368860-58368882 AAGGAGGAATGGTAGGGAGAAGG + Intergenic
1041652002 8:60310999-60311021 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1041702922 8:60811306-60811328 AAGCAGGAATGGGGTGGAAAGGG - Intronic
1041917686 8:63152786-63152808 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1042705935 8:71665633-71665655 AGGGAGGAATGGAGGGTAGAAGG - Intergenic
1042707214 8:71676171-71676193 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1043009135 8:74859830-74859852 CAGCAGCAATGAAGCAGAGAAGG - Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043718042 8:83509580-83509602 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1044606990 8:94056585-94056607 CAGCAGGCAAGGATTGGAGACGG - Intergenic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1046074748 8:109302071-109302093 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1046439916 8:114242900-114242922 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1046443105 8:114283251-114283273 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1046538451 8:115547749-115547771 TAGAAGGAATGGTGGAGAGATGG - Intronic
1046605349 8:116365535-116365557 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1047215391 8:122872029-122872051 CAGCAGGACTGCAGGGGCCAGGG - Intronic
1047699208 8:127433001-127433023 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1047960871 8:130010790-130010812 CTGAATGAATGAAGGGGAGAGGG + Intronic
1048135331 8:131741972-131741994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1048163310 8:132040141-132040163 AAGGAGGAATTGAGGGGAGGAGG - Intronic
1048514810 8:135096618-135096640 CAACAGAAATGGAGTAGAGATGG + Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1048898572 8:139016491-139016513 TAGCAGGGATGAAGGGGTGAGGG + Intergenic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049056470 8:140241047-140241069 CAGCAGGGATGCAGGTGACAGGG - Intronic
1049069518 8:140345825-140345847 GAGCAGGAAGGGATGGGAAACGG + Intronic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049370342 8:142261310-142261332 AAGGAGGGATGGAGGAGAGAGGG + Intronic
1049370361 8:142261365-142261387 GAGGAGGGATGGAGGAGAGAGGG + Intronic
1049582910 8:143420887-143420909 CAGCAGGAACAGAAGGGTGAGGG + Intronic
1049617896 8:143583883-143583905 CAGGAGCGAGGGAGGGGAGAGGG + Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049867508 8:144948374-144948396 CAGCAGAAATGGAGGAGACATGG + Intronic
1050309739 9:4340567-4340589 CAGCAGGAATGAGGGAGTGAGGG + Intronic
1050474010 9:6021209-6021231 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1050592395 9:7173919-7173941 GAACAGGAGTGGAGAGGAGAAGG + Intergenic
1050834015 9:10052840-10052862 CCATAGGAATGGAGGTGAGATGG - Intronic
1052191681 9:25670174-25670196 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052531281 9:29687581-29687603 CAGAAACAATGGAGGGCAGAAGG + Intergenic
1052837944 9:33265283-33265305 TAACAGGGATGAAGGGGAGAAGG - Intronic
1052923355 9:33991364-33991386 CAGCATAAAAGGAGGGGAGGCGG + Intronic
1053057872 9:35004719-35004741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1053149670 9:35735210-35735232 GAGCAGGTATGAAAGGGAGAGGG + Exonic
1053159947 9:35806962-35806984 GAGCAGGAGTGGAAGAGAGAGGG - Intronic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1055121386 9:72664705-72664727 CAGCAGGATGGGTGGGGAGCTGG - Intronic
1055232914 9:74086926-74086948 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1055809905 9:80138679-80138701 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056044888 9:82705147-82705169 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1056061017 9:82885042-82885064 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056253382 9:84773397-84773419 CAGCAGTGATGGAGGGGTGAGGG + Intronic
1056323737 9:85459905-85459927 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056486032 9:87058988-87059010 CAGCATAAATGGGGGAGAGAGGG + Intergenic
1056713110 9:89007632-89007654 CAGCAGGGAAGGAGGAGAAAGGG - Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057458132 9:95233117-95233139 AGGCGGGAAAGGAGGGGAGATGG + Intronic
1057586752 9:96335319-96335341 GAGGAAGAATGGAGGGGAGTTGG + Intronic
1057812732 9:98270297-98270319 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1058026359 9:100145155-100145177 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058480514 9:105388890-105388912 CTCCAGGAATTCAGGGGAGAAGG + Intronic
1058758864 9:108110136-108110158 TAGCAGGAAGGGAGGAGACAAGG + Intergenic
1059070583 9:111131821-111131843 CAGCAGAAGTGGAGAGGAGGAGG + Intergenic
1059217120 9:112574615-112574637 GAGCTTGAATGGAGGGAAGATGG - Exonic
1059862642 9:118482253-118482275 CAGCAGGAAAAGACAGGAGATGG + Intergenic
1059955504 9:119511617-119511639 CAGCAGGAAAGGAGGCGAGAAGG - Intronic
1060198362 9:121637567-121637589 TTGGAGGAAGGGAGGGGAGAGGG + Intronic
1060225994 9:121791227-121791249 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1060517945 9:124277490-124277512 CAGCAGGAAAGGGTAGGAGAAGG - Intronic
1060791145 9:126486581-126486603 GAGCAGAACGGGAGGGGAGATGG - Intronic
1060797188 9:126520673-126520695 CAGCTGGCATGGAAAGGAGATGG + Intergenic
1061059895 9:128245047-128245069 CGGCAGGAAGGGAGGGGTGGGGG + Intronic
1061237914 9:129352747-129352769 CAGAAGGGATGGAGCGGGGAGGG + Intergenic
1061264434 9:129497131-129497153 GAGCAGGAGAGGAGGGGAGAAGG + Intergenic
1061375292 9:130220411-130220433 CTGCAGGCAAGGAGGAGAGAGGG + Intronic
1061549491 9:131325170-131325192 GGGCAGGAAGGAAGGGGAGATGG - Intergenic
1061613904 9:131766668-131766690 CTGCAGGGATGTGGGGGAGAGGG + Intergenic
1061750459 9:132773382-132773404 CAGCTGGAAGGGAGAGGACAGGG - Intronic
1062051600 9:134450160-134450182 CAGCAGGCAAGGAGGGGTGCAGG - Intergenic
1062092011 9:134683276-134683298 CAGAAGGTTTGGAGGTGAGACGG - Intronic
1062093180 9:134689255-134689277 CAGAAGGTTTGGAGGTGAGATGG - Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062503689 9:136862145-136862167 CAGCAGGAATGGGCTGGGGAGGG + Exonic
1062729809 9:138102631-138102653 CAGCAGGAGGGGAGCGGGGAGGG - Intronic
1185701463 X:2233995-2234017 TAGCAGGGAAGGAGAGGAGAAGG + Intronic
1186388369 X:9133007-9133029 CAGGAGCAAGGTAGGGGAGAAGG + Intronic
1186684119 X:11906548-11906570 CAGAAGTAATGGAGGCTAGATGG - Intergenic
1187086671 X:16049123-16049145 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1187103917 X:16221277-16221299 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1187146689 X:16643894-16643916 CATGAGGAATGGGAGGGAGAAGG - Intronic
1187394492 X:18907745-18907767 CAGCAGGCAGGCAGGAGAGAAGG + Intronic
1187625303 X:21105496-21105518 CAGCAAGAATCCAGAGGAGATGG + Intergenic
1187979463 X:24739910-24739932 TAGCAGGAATGAATGAGAGATGG - Intronic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188201159 X:27293978-27294000 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188301215 X:28506881-28506903 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188515297 X:30979402-30979424 CAGCAGGCTTGGTGAGGAGAGGG - Intergenic
1188552502 X:31378773-31378795 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1188705699 X:33326856-33326878 CAGGAGATATGGAGGGGGGATGG + Intronic
1189321503 X:40090260-40090282 CGGGAGGGACGGAGGGGAGACGG + Intronic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1189431046 X:40947581-40947603 CGGCAGAAATGGATGGGAAAGGG + Intergenic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1189999724 X:46674327-46674349 CAGCAGATATGAACGGGAGATGG - Intronic
1190690322 X:52908185-52908207 CAGCAGGAAGGGAAGAGAGATGG - Exonic
1190695661 X:52947607-52947629 CAGCAGGAAGGGAAGAGAGATGG + Exonic
1190705106 X:53020950-53020972 CAGCAGTGAGGGATGGGAGATGG - Intergenic
1191004799 X:55699905-55699927 GACCAGGCATGGAGTGGAGAAGG - Intergenic
1191014347 X:55792759-55792781 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1191869910 X:65737153-65737175 GAGCAGAAAAGGAGGGGAGAAGG - Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192454439 X:71265434-71265456 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1193885787 X:86983065-86983087 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1194308681 X:92277481-92277503 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1194366957 X:93024193-93024215 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1194503133 X:94703269-94703291 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1194804415 X:98309531-98309553 CATAAGGAATGAAGGGGACAGGG + Intergenic
1195291315 X:103434015-103434037 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1195505624 X:105653498-105653520 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1195589688 X:106610584-106610606 CAGCCGCAGTGGAGGGGCGAGGG - Intergenic
1195667638 X:107445227-107445249 CAGCTGCATTTGAGGGGAGAGGG + Intergenic
1196072936 X:111545177-111545199 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1196221125 X:113113160-113113182 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1196330676 X:114468023-114468045 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1196341865 X:114605752-114605774 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1196657664 X:118235861-118235883 GAGCTGGAAGGGAGGGGAAATGG + Intergenic
1196992850 X:121347466-121347488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197064766 X:122223298-122223320 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1197352206 X:125393301-125393323 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197721543 X:129748011-129748033 GAGCAGGAAGGGAGGAAAGAAGG + Intronic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1197815994 X:130499377-130499399 CAGAAGGAAGGGAGGAGGGAAGG - Intergenic
1197870473 X:131058541-131058563 CAGCAGGAAGGGAGGCAAGGGGG - Intronic
1197932928 X:131713313-131713335 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1198649593 X:138847142-138847164 GAGAAGCCATGGAGGGGAGAAGG + Intronic
1199474348 X:148229296-148229318 CAGGATGAATGGAAGGGGGAGGG - Intergenic
1199576332 X:149316936-149316958 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1199595978 X:149505987-149506009 GAGCAGCAATTGTGGGGAGATGG + Intronic
1200104690 X:153705776-153705798 CAGCTGGAATTGAGGGGTGGGGG + Intronic
1200675177 Y:6140449-6140471 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1200812663 Y:7501619-7501641 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1201365146 Y:13196807-13196829 GAGAAGGAAGGTAGGGGAGAGGG + Intergenic
1201625775 Y:16012580-16012602 AAGAAGGGAGGGAGGGGAGAAGG + Intergenic
1201936941 Y:19419842-19419864 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1202076709 Y:21043904-21043926 AAGGAGGAATGGAGGGTGGAAGG + Intergenic