ID: 933727218

View in Genome Browser
Species Human (GRCh38)
Location 2:85433787-85433809
Sequence GGTCAGCCTGGACCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 346}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933727218_933727221 -5 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727221 2:85433805-85433827 TGACCCACACTGTGCCAGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 191
933727218_933727236 29 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727236 2:85433839-85433861 CTTAGAGCATGGGCTGGGTGGGG 0: 1
1: 0
2: 0
3: 47
4: 502
933727218_933727229 23 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727229 2:85433833-85433855 GCTCCCCTTAGAGCATGGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 130
933727218_933727227 18 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727227 2:85433828-85433850 GAGGTGCTCCCCTTAGAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 91
933727218_933727233 27 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727233 2:85433837-85433859 CCCTTAGAGCATGGGCTGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 196
933727218_933727235 28 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727235 2:85433838-85433860 CCTTAGAGCATGGGCTGGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 174
933727218_933727228 19 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727228 2:85433829-85433851 AGGTGCTCCCCTTAGAGCATGGG 0: 1
1: 0
2: 0
3: 8
4: 58
933727218_933727225 -1 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727225 2:85433809-85433831 CCACACTGTGCCAGCAAGGGAGG 0: 1
1: 0
2: 4
3: 13
4: 196
933727218_933727222 -4 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727222 2:85433806-85433828 GACCCACACTGTGCCAGCAAGGG 0: 1
1: 0
2: 0
3: 13
4: 139
933727218_933727230 24 Left 933727218 2:85433787-85433809 CCTGCCTGTGGTCCAGGCTGACC 0: 1
1: 0
2: 1
3: 29
4: 346
Right 933727230 2:85433834-85433856 CTCCCCTTAGAGCATGGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933727218 Original CRISPR GGTCAGCCTGGACCACAGGC AGG (reversed) Intronic
900413510 1:2524573-2524595 GCTCAGCCTGGAGAACAGGCTGG + Intronic
901230297 1:7638158-7638180 GGACAGGCAGGACCCCAGGCAGG - Intronic
902357428 1:15915304-15915326 GACCAGCCTGGGCAACAGGCTGG + Intronic
903788375 1:25875866-25875888 GGTCAGCCGGGCCCAGAAGCCGG - Intergenic
904211044 1:28887210-28887232 GGTGAGCCTGGACCACCTGGGGG + Exonic
904669979 1:32156954-32156976 GGTCAGCCTGAGGCACATGCAGG - Intronic
905819594 1:40979509-40979531 AGTAAGCTTGGGCCACAGGCTGG + Exonic
905918135 1:41699886-41699908 GGTCACCCAGGAGCTCAGGCTGG - Intronic
906531856 1:46528276-46528298 GGGGAGCCTGGCCCTCAGGCTGG + Intergenic
909198955 1:72664258-72664280 GAACAGCTGGGACCACAGGCAGG + Intergenic
909633654 1:77792262-77792284 TGTCTGCCTGGAGTACAGGCTGG + Intronic
910474575 1:87593234-87593256 AGTGAGCCTGGGCAACAGGCTGG - Intergenic
912385713 1:109270297-109270319 GGGAAGCCTGGGCCAGAGGCAGG - Intronic
912448699 1:109757016-109757038 GCCCAGCCTGGACCACTAGCCGG - Exonic
912493258 1:110074393-110074415 CCTCAGCCTGCACCACAGGAAGG + Intronic
912801222 1:112720769-112720791 GGTGAGCCTGGACCACTGCTGGG - Intronic
913609939 1:120501218-120501240 GGTCAGACTGCAGCACAAGCTGG - Intergenic
913662772 1:121019460-121019482 GCTAAGCCTGGCCCAGAGGCTGG - Intergenic
913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914014155 1:143802722-143802744 GCTAAGCCTGGCCCAGAGGCTGG - Intergenic
914163666 1:145158474-145158496 GCTAAGCCTGGCCCAGAGGCTGG + Intergenic
914203876 1:145509920-145509942 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914482999 1:148083074-148083096 GGTCAGACTGAAGCACAAGCTGG + Intergenic
914581250 1:149021023-149021045 GGTCAGACTGCAGCACAAGCTGG + Exonic
914652775 1:149711280-149711302 GCTAAGCCTGGCCCAGAGGCTGG - Intergenic
915216498 1:154344000-154344022 GGACAGCCGGGAGGACAGGCTGG + Exonic
915721875 1:157992067-157992089 GATGCGTCTGGACCACAGGCTGG + Intergenic
917453180 1:175164039-175164061 GGTGAGCCTGGAGCTCAGGGTGG + Intronic
919742934 1:200991473-200991495 GGAGAGCCAGGGCCACAGGCAGG + Intronic
921127635 1:212191364-212191386 GGACAGCCTGTAGCTCAGGCTGG + Intergenic
921524021 1:216194872-216194894 CATCTGCCTGTACCACAGGCTGG - Intronic
921985261 1:221305759-221305781 GGTCAGCCTTGACCAGATGTGGG + Intergenic
922173830 1:223179317-223179339 GGTCAGCCTGAGCCACAGAGGGG - Intergenic
922609848 1:226918278-226918300 GGTTATCCTGGACCACATGCTGG + Intronic
922817803 1:228463382-228463404 GGACAGCCTGGGCCCCAGTCAGG + Intergenic
923054878 1:230418535-230418557 TGTCAGCTTGTACCACAGTCTGG + Intronic
923189072 1:231603016-231603038 GGTCAGCCTGGCCAACATGGTGG - Intronic
923328980 1:232905224-232905246 GGTCCACCTGGAGCATAGGCTGG - Intergenic
923626397 1:235617164-235617186 GGGCATCCTGGACCTCCGGCTGG + Intronic
1062815635 10:497997-498019 GGGTAGCTGGGACCACAGGCAGG + Intronic
1064093144 10:12402359-12402381 GGGTAGCTGGGACCACAGGCGGG + Intronic
1065599811 10:27356895-27356917 GGACAGCCTCAACCACAAGCTGG - Intergenic
1067070905 10:43131098-43131120 CTTCAGCCTGGACCACGGGCTGG + Intergenic
1067295167 10:44971509-44971531 GGACATCCTGGACCAGACGCAGG + Intronic
1070510727 10:77158418-77158440 GTGCAGCCTGGACCACAAGGAGG + Intronic
1070745618 10:78931958-78931980 AGTGACCCTGGACCACAGGAGGG + Intergenic
1072636622 10:97182526-97182548 GGGCTGCCTGGAGAACAGGCGGG + Intronic
1073254031 10:102139624-102139646 AGTCATCCAGGAGCACAGGCCGG - Exonic
1073323202 10:102628047-102628069 GGTCTGCCTCTGCCACAGGCAGG - Intronic
1073366114 10:102942935-102942957 GGCGCGCCTGGATCACAGGCTGG + Intronic
1073447945 10:103592259-103592281 GGTGTGCCAGGACCTCAGGCTGG + Exonic
1075626651 10:123968820-123968842 GGTGAGTCTGGAGCACAGGAGGG - Intergenic
1076299483 10:129414265-129414287 TGTGACCCTGGAACACAGGCTGG + Intergenic
1076345742 10:129777931-129777953 GGGCAGCCTGGACCACGGGAGGG - Intergenic
1076507440 10:130987432-130987454 GGGCAGCCAGGCCCACTGGCTGG - Intergenic
1076554537 10:131312584-131312606 GCTCCGCCCGGACCACACGCAGG + Intergenic
1076980654 11:202846-202868 GCTCACCCTGGTCCACAGGCTGG - Intronic
1077115021 11:880270-880292 GGTCAGCCTGGGCATCAGGCGGG - Intronic
1077556999 11:3230696-3230718 ATTCAGACTGGACCACGGGCAGG - Intronic
1078167899 11:8905999-8906021 GGTCACCTAGGACCAGAGGCAGG + Intronic
1078210488 11:9265741-9265763 TGTCAGCCTAGACCCCAGACAGG + Intergenic
1078422805 11:11226002-11226024 GGTTAGCCAGGCTCACAGGCTGG - Intergenic
1080828684 11:35870981-35871003 GGTCACCCTGGACCAGAGGTGGG - Intergenic
1080870095 11:36229323-36229345 GGGCAGCCTGGCCCCCAGGAGGG + Exonic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1083372343 11:62192374-62192396 GGTCACCTGGGACCACAGGGTGG + Intronic
1083655179 11:64226062-64226084 GGTCAGCCAGGAGCGCAGGGAGG + Exonic
1083886947 11:65577570-65577592 GCTTAGCCTGGAGCCCAGGCCGG + Intronic
1084662255 11:70552880-70552902 GGGCAGCCTAAACCACAGACAGG + Intronic
1085363912 11:75919796-75919818 GATTTGCCTGGGCCACAGGCTGG + Intronic
1086937796 11:92763714-92763736 GGTCAGCCAGGACCACATCCTGG + Intronic
1089438144 11:118489175-118489197 TGACAGACTGCACCACAGGCTGG - Intronic
1089559698 11:119337691-119337713 GGGCAGACTGGACTCCAGGCAGG - Intergenic
1089651061 11:119913392-119913414 GGCCAGCCTGGATCAAAGGGAGG - Intergenic
1091413106 12:257297-257319 AGTCACCCAGGACCACTGGCTGG - Intronic
1091832923 12:3563071-3563093 TGCCAGGCTGGACCACAGGTGGG + Intronic
1092836200 12:12491246-12491268 GGTTAGCCTGGACAACATGGTGG - Intronic
1092897525 12:13027555-13027577 GGGTAGCTGGGACCACAGGCAGG - Intergenic
1094058934 12:26293033-26293055 GGGTGGCCTGGACCACAGTCTGG - Intronic
1094611787 12:32001726-32001748 GGGCAGCTTGCACCACAGCCTGG - Intergenic
1095955896 12:47805780-47805802 GGCCTGGCTGGACCACTGGCTGG - Intronic
1096192585 12:49630188-49630210 GCACAGCCTTGCCCACAGGCAGG + Intronic
1096230648 12:49895071-49895093 GGGCAGGCAGGACCCCAGGCAGG + Intronic
1096612603 12:52812877-52812899 GGGCAACCTGGACCAAAGGGAGG + Intronic
1097172771 12:57127007-57127029 GACAAGCCTGGAGCACAGGCTGG + Intronic
1098301708 12:69060874-69060896 CTTCAGCCTGGACAACAGACAGG + Intergenic
1099359336 12:81680525-81680547 GGTAAGGCTAAACCACAGGCTGG + Intronic
1101351779 12:103936442-103936464 GGTCAGCCTGGACAACATAATGG + Intronic
1101949383 12:109162679-109162701 GGTCAGCCTGGAGCCCCGGGGGG - Intronic
1102051234 12:109863573-109863595 GGTCAGTCTGAACCATAGGAGGG - Intronic
1102219246 12:111183274-111183296 GGTCAGGCTGTCCCTCAGGCAGG + Intronic
1103504323 12:121431344-121431366 GGCCAGCCTGGACAACATGGTGG - Intronic
1104013771 12:124949369-124949391 TGTGGGTCTGGACCACAGGCAGG + Intronic
1104144954 12:126024340-126024362 GGGTAGCTGGGACCACAGGCAGG - Intergenic
1104390019 12:128384249-128384271 GGTGAGCATGGGCCACAGGATGG + Intronic
1105777848 13:23679738-23679760 GATCAGCCTGGACAACAATCTGG + Intergenic
1105845033 13:24286700-24286722 GGGCAGCATGGAGCAGAGGCAGG - Intronic
1112172984 13:96993417-96993439 GACCAGCCTGGCCAACAGGCTGG - Intronic
1112451811 13:99518809-99518831 GGACAGCCTGGACAACAGAGTGG - Intronic
1113109906 13:106811993-106812015 GGTCAGCCTGAAGCAGAGCCAGG - Intergenic
1113788568 13:113015627-113015649 AGCCAGCCTGCACCCCAGGCCGG + Intronic
1113807571 13:113118534-113118556 GGTCAGTGAGGACCACGGGCTGG - Exonic
1117305347 14:54468484-54468506 GGTCACCCTAGACCTCAGACTGG + Intergenic
1118875964 14:69785105-69785127 GGTCATCCTGGTCCTCAGGAAGG - Intronic
1119551469 14:75517026-75517048 GGTCAGCCTGTTGCCCAGGCTGG + Intergenic
1120532150 14:85644786-85644808 CAGCAGCCTGGACCACAGCCTGG - Exonic
1121733462 14:96202347-96202369 GTTCAGCAAGGACCACAGGAGGG - Intergenic
1122720051 14:103716540-103716562 GGGCAGCCTGGCCCGCAGACTGG - Intronic
1122893501 14:104743907-104743929 GGCCAGCATGGAGGACAGGCAGG + Intronic
1122919036 14:104872091-104872113 GCACACCCTGGACCACAGCCTGG - Intronic
1126675892 15:51159070-51159092 GGTGAGCCTATACCATAGGCAGG + Intergenic
1127234874 15:57038298-57038320 GAGTAGCTTGGACCACAGGCAGG - Intronic
1128357998 15:66941922-66941944 GGACAGCATGGAGCACAGCCAGG - Intergenic
1128931711 15:71710227-71710249 GGTCATCCTGGAACAGAGGGTGG - Intronic
1129533475 15:76290372-76290394 TGTCACCCTGGAGCACAGGCTGG + Intronic
1131092509 15:89633140-89633162 GGTCAGCCTGGAACAGCAGCAGG - Exonic
1131214873 15:90529059-90529081 GACCAGCTGGGACCACAGGCGGG - Intergenic
1131925577 15:97379716-97379738 GGCCAGCCTGGGGCACAAGCAGG + Intergenic
1132069797 15:98766093-98766115 GGTGAGCCGGGACCCCAGGCAGG + Intronic
1132545981 16:533654-533676 GGCCAGCCAGGACCGCAGACAGG - Intronic
1132583523 16:695834-695856 GCTCAGGCTGGACCACAGCCCGG + Exonic
1132747350 16:1442583-1442605 GGTGAGGCTGACCCACAGGCTGG + Intronic
1132806484 16:1777457-1777479 GCCCAGCCTGAACCCCAGGCAGG + Intronic
1132853810 16:2036034-2036056 GGCCAGCGTGGCGCACAGGCAGG - Intronic
1132889130 16:2195732-2195754 GGGCAGGCTGGACTCCAGGCAGG - Intronic
1133164825 16:3939051-3939073 GGAGCGCCTGGACCCCAGGCAGG + Intergenic
1133189362 16:4122109-4122131 GAGCAGCTGGGACCACAGGCAGG + Intergenic
1134100917 16:11450734-11450756 GGACAGCCTGGAACACAGCTCGG + Exonic
1134428470 16:14177391-14177413 GGTTAGCCTAGACCTCAGGTTGG - Intronic
1137566047 16:49533075-49533097 GGTGGGCCTGGACCAGATGCTGG - Intronic
1138511732 16:57512682-57512704 GGTTAGCCTGGACCCTGGGCAGG + Exonic
1139393114 16:66618558-66618580 GGTACGCCTGGGCCACACGCAGG + Intronic
1141470165 16:84232769-84232791 GAGCAGCTGGGACCACAGGCAGG - Intronic
1142364326 16:89641972-89641994 GGTCTGCCTGCACCCCAGGATGG - Intergenic
1143451917 17:7041782-7041804 GGGGAGGCTGGACCACAGGAGGG + Exonic
1143501542 17:7342295-7342317 CGTGAGCCTGAACCACAAGCTGG + Exonic
1144295406 17:13870463-13870485 GGTTAGCGTGGACCACAGCAAGG - Intergenic
1144852829 17:18252569-18252591 GGCCAGCCAGGGCCTCAGGCAGG + Intronic
1145211566 17:21017073-21017095 GGTTAGGCTCGACCAGAGGCTGG + Intronic
1146261633 17:31425870-31425892 GGGGAGCCTGGGCCCCAGGCAGG - Intronic
1146637164 17:34514961-34514983 TGTCAGCCTGCACCCCAGGCAGG + Intergenic
1146758209 17:35451876-35451898 GACCAGCCTGGCCAACAGGCAGG + Intergenic
1148071849 17:44913241-44913263 AGGCAGGCTGGCCCACAGGCAGG + Intronic
1149665996 17:58365036-58365058 GGTAAGCCTGGGCCCTAGGCTGG - Intronic
1152426214 17:80220136-80220158 GGTCAGCATTGACCACGGGTGGG + Intronic
1152717182 17:81905782-81905804 GGTAAGCCAGGGCCACAGGGTGG + Intronic
1152741521 17:82020498-82020520 CGCCAGCGTGGTCCACAGGCTGG + Intronic
1152798015 17:82317417-82317439 GGGCAGCCAGGGCCCCAGGCAGG + Exonic
1152829971 17:82491137-82491159 GGTCAGCCTGGATCACCAGCGGG - Intergenic
1153224113 18:2884844-2884866 GGCCAGCCTGGAGAGCAGGCAGG + Intronic
1154339102 18:13488523-13488545 GGGCTGCCTGGGGCACAGGCAGG - Intronic
1154387755 18:13911049-13911071 GCTCAGCAGGGAACACAGGCAGG + Intronic
1155473273 18:26212834-26212856 AGACAGCCTGGAACACTGGCTGG - Intergenic
1156341195 18:36212074-36212096 GGTCTTTCTGGTCCACAGGCTGG - Intronic
1157187128 18:45550246-45550268 GGTCAGCCTGGAAAGCAGGAGGG - Intronic
1157488861 18:48108347-48108369 GATCAGCAGCGACCACAGGCAGG + Intronic
1161217245 19:3100684-3100706 GGGCAGCCCAGGCCACAGGCAGG - Intronic
1161595703 19:5150111-5150133 GGACAGCCTGGGGCAGAGGCAGG - Intronic
1161936695 19:7376587-7376609 AGGCAGCCTGGACTGCAGGCAGG - Intronic
1162474966 19:10894303-10894325 GCTCTGCCCGGACCACATGCAGG - Intronic
1162565838 19:11445576-11445598 GATCAGCCTGGACCCCACGCCGG - Intronic
1163018163 19:14469517-14469539 TGTGAGCCTGGACCCCAGCCCGG + Exonic
1163381344 19:16970982-16971004 AGTGAGCCTGAACCACCGGCAGG - Exonic
1163578529 19:18124387-18124409 GTTCTGCCTGGACCCCAAGCTGG - Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1163690184 19:18734485-18734507 GGCCAGCCTGGACAACATGGGGG + Intronic
1163918883 19:20269190-20269212 GGGTAGCTGGGACCACAGGCAGG - Intergenic
1164618476 19:29680421-29680443 GGTCTGACTTGATCACAGGCCGG + Intergenic
1164885245 19:31773212-31773234 GGACAGCCTGGAGCAGACGCAGG - Intergenic
1164990470 19:32678942-32678964 GCTCTCTCTGGACCACAGGCAGG - Intergenic
1165248036 19:34509072-34509094 AGCCAGCTGGGACCACAGGCAGG - Exonic
1166500545 19:43337851-43337873 GGTCAGCCTGGAGCAGCAGCAGG - Intergenic
1166509582 19:43395848-43395870 GGTCAGCCTGGAGCAGCAGCAGG + Intergenic
1167586376 19:50377847-50377869 GCTCAGCCTGCAGCACAGACTGG + Exonic
1168206838 19:54856481-54856503 GATCAGCCTGGCCAACATGCGGG + Intronic
1168411687 19:56144179-56144201 GAGCAGCTGGGACCACAGGCAGG - Intronic
926137511 2:10347130-10347152 GTTCAGCCTGACACACAGGCCGG + Intronic
926276159 2:11404805-11404827 CTTCAGCCAGGGCCACAGGCTGG - Intergenic
926554019 2:14335454-14335476 GGTCTGCCTGGACCACAGGAAGG + Intergenic
926754006 2:16221575-16221597 GGACAACATGGACCACAGGATGG - Intergenic
927113992 2:19884286-19884308 GGCCAGCCAGGGCCACAGCCAGG - Intergenic
927571839 2:24166965-24166987 GGTGAGGCTGGAGCAGAGGCAGG + Intronic
927601375 2:24444812-24444834 GACCAGCCTGGCCAACAGGCTGG - Intergenic
927940401 2:27099819-27099841 GGGCAACCTGGACGCCAGGCTGG - Exonic
929783436 2:44972553-44972575 GGTCAGCCCACCCCACAGGCAGG - Intergenic
930103176 2:47618496-47618518 GGTCCGCCAGGAGGACAGGCAGG - Intergenic
931980939 2:67693648-67693670 ATTCTGCCTGGATCACAGGCTGG + Intergenic
933727218 2:85433787-85433809 GGTCAGCCTGGACCACAGGCAGG - Intronic
933804515 2:85988500-85988522 GGTCTGGCTGGAGCACAGGTGGG - Intergenic
934176399 2:89582896-89582918 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934286709 2:91657257-91657279 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
935597183 2:104888381-104888403 GGGCAGCTGGGACCTCAGGCTGG + Intergenic
937031345 2:118743594-118743616 GGTCAGCCTGGGCCATGGTCAGG + Intergenic
937356868 2:121203199-121203221 GGTGAACCTGGAAGACAGGCCGG + Intergenic
937980440 2:127611618-127611640 GGTCAGCCTGGTCCAGGGCCAGG - Intronic
939086829 2:137729787-137729809 GTTCAGCCTGGCCAAAAGGCTGG + Intergenic
941165937 2:162083012-162083034 GTTCAACCTGGAACACAAGCAGG - Intergenic
942311508 2:174661181-174661203 GGTCAGGCTGCCCCTCAGGCAGG - Intronic
942597273 2:177603131-177603153 GTTCAGCCTGGATCCCAGGAAGG - Intergenic
944270994 2:197785487-197785509 GTCCCGCCTGGGCCACAGGCGGG + Intronic
944821740 2:203439685-203439707 GGTCAGCCAGGAATCCAGGCTGG + Exonic
945999794 2:216472155-216472177 GATCAGCCTGGACAACATGGCGG + Intronic
946141369 2:217693737-217693759 TGTCAGCCTGGAAATCAGGCTGG - Intronic
946361925 2:219224084-219224106 GGTGGGCCAGGGCCACAGGCGGG - Exonic
947302664 2:228705737-228705759 TGTCAGCCTGCATCACAGCCCGG + Intergenic
947498980 2:230658728-230658750 GGTCAGGCAGGGCCAGAGGCAGG - Intergenic
947931219 2:233966740-233966762 GGTTTACCTGGACCCCAGGCTGG - Exonic
948297883 2:236876290-236876312 GGTCAGCCCGGACAACTGGCCGG - Intergenic
948627674 2:239279092-239279114 GGGCAGCAGGGCCCACAGGCCGG + Intronic
948653742 2:239464450-239464472 GATGAGCCTGGAGCCCAGGCCGG + Intergenic
948950823 2:241250196-241250218 TCTCAGCCTGGACCAGAAGCTGG + Intronic
949002632 2:241625275-241625297 GACCAGCCTGGGCAACAGGCTGG + Intronic
949022383 2:241748879-241748901 GGGCTCCCAGGACCACAGGCGGG - Intronic
1169448717 20:5693293-5693315 GGTCAAGCTGGATTACAGGCAGG - Intergenic
1172223723 20:33290591-33290613 GTTCTGCCTGCACCACTGGCAGG + Intronic
1172923318 20:38506489-38506511 GGCCAGCCTGGACAACATGGAGG - Intronic
1173469304 20:43310274-43310296 GTTCATCCTGGATCCCAGGCTGG - Intergenic
1173869278 20:46331510-46331532 GGCGAGCCAGGACCACAGTCAGG + Intergenic
1174045143 20:47727984-47728006 GGTCAGCCTGGGTCCCAGGAGGG + Intronic
1174190297 20:48735611-48735633 GGGCAGCCTGTACTACATGCTGG - Intronic
1175369776 20:58480459-58480481 GGTCAGTCTGGACCACGGGATGG + Intronic
1175412200 20:58777723-58777745 GGCCAGGCTGGCCCCCAGGCTGG - Intergenic
1175686420 20:61031608-61031630 GGTGAGCATGGGCCCCAGGCAGG + Intergenic
1176126211 20:63476094-63476116 GGGCAGCTAGGATCACAGGCAGG - Intergenic
1178314497 21:31557876-31557898 CGCCAGCCTGGACCCCAGGCTGG + Intronic
1179400263 21:41076582-41076604 GGTCAGCGTGGGCCAGAGGAAGG - Intergenic
1179582002 21:42350005-42350027 GCTCAGCCTGGAGCACTGGCAGG + Exonic
1181068115 22:20316136-20316158 GAGCCGCCTGAACCACAGGCAGG + Exonic
1181301865 22:21886025-21886047 GGTCAGCCTGGGCAACATGGTGG - Intergenic
1181345246 22:22215212-22215234 AGTCAGCCTCGTCCTCAGGCTGG - Intergenic
1181428449 22:22859468-22859490 TGTCAGCCTAGACAATAGGCTGG + Intronic
1181491723 22:23264374-23264396 GGTCTCCTTGGCCCACAGGCAGG - Intronic
1181587794 22:23863257-23863279 GGACAGCCTGCACCAAGGGCTGG - Intronic
1181974463 22:26719091-26719113 GGTCAGTCTGGTTCACAGGAAGG - Intergenic
1182052387 22:27323537-27323559 TGTGAGGCTGGACCTCAGGCAGG + Intergenic
1182370730 22:29808620-29808642 GATCAGCCTGGGAAACAGGCTGG + Intronic
1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG + Intergenic
1183324366 22:37183481-37183503 AGTCAGCCTGGACTAAGGGCCGG - Intronic
1183662716 22:39230862-39230884 GGCCAGCCTCGCCCACAGGCTGG - Intronic
1183910373 22:41074738-41074760 GGCCAGCCAGGTCCAGAGGCAGG + Intergenic
1184403706 22:44288010-44288032 GGTGTGGCTGGGCCACAGGCTGG + Intronic
1184444316 22:44538577-44538599 GGTCGGCCTGGTGCACAGGAGGG - Intergenic
1184486484 22:44783072-44783094 GGGCAGCCTGGCCCAGAGGGAGG - Intronic
1184513353 22:44945786-44945808 GGTCAGCCTGAACCTGAGTCTGG + Intronic
1184872849 22:47251884-47251906 GCTTATCCTGGAGCACAGGCTGG - Intergenic
1185009997 22:48307485-48307507 GGCCAGCCTGCCCCACAGGAAGG - Intergenic
949507371 3:4740223-4740245 GGTCAGCCAGGCCCCCAAGCTGG + Intronic
950248918 3:11447809-11447831 GGCCAGCCTGGGCCAGGGGCAGG + Intronic
950658629 3:14452851-14452873 GGTCGCCCTGGAGGACAGGCGGG + Intronic
952524200 3:34192987-34193009 TGTCAGCTTGGATGACAGGCTGG + Intergenic
952823200 3:37502764-37502786 GGTGAGCCTGGAGTCCAGGCAGG + Intronic
954460296 3:50622815-50622837 GTGCAGCCTGGACAGCAGGCAGG - Intronic
954655425 3:52191404-52191426 GGTCTGCCTGATCCACATGCAGG - Intergenic
961789672 3:129366549-129366571 GGTCAGCCCTGACCAGGGGCCGG - Intergenic
962695256 3:137941472-137941494 GATCAGCCTGGACAACAAGTTGG - Intergenic
962903633 3:139781807-139781829 TGTCAGCCTTGACCTCTGGCAGG - Intergenic
964124147 3:153218352-153218374 AGCCAGCCTGGGCAACAGGCTGG + Intergenic
966401368 3:179550890-179550912 GGCCAGGCAGGACCCCAGGCAGG + Intergenic
968468315 4:764352-764374 GGACAGCCTGGACCGGAGGTAGG + Intronic
968689331 4:1982594-1982616 GGACACCCTGGCCCACAGGGTGG - Intergenic
968817852 4:2831044-2831066 GCTCAGCCTCACCCACAGGCTGG + Intronic
968935102 4:3605648-3605670 GGTCAGGCCAGACCTCAGGCAGG - Intergenic
969680202 4:8639204-8639226 GGTCAGCAGGGACCCCAGACAGG - Intergenic
969696109 4:8735781-8735803 AGTCAGCCTGGCCCACTTGCAGG - Intergenic
970542255 4:17091992-17092014 GCACAGCCTGGCACACAGGCAGG + Intergenic
973315909 4:48759808-48759830 GGTTAGCCTGGATTACTGGCTGG - Intronic
976473265 4:85454303-85454325 GATCAGCCTGGTCAACAGGCTGG + Intergenic
982086915 4:151844932-151844954 GGCCAGCCAGGACCTAAGGCGGG + Intergenic
982464401 4:155712501-155712523 GATCATCCTGGACCACAAGAAGG - Intronic
984116587 4:175688978-175689000 GAGCAGCTTGGACTACAGGCAGG + Intronic
985575945 5:673574-673596 GGGCAGCCTGGTCGGCAGGCTGG - Intronic
985840139 5:2299908-2299930 CCTCAGCCTGGACAACATGCTGG - Intergenic
985878516 5:2619335-2619357 TGTCAGCCTGGACCACGGAGGGG + Intergenic
986152396 5:5139955-5139977 GCTCAGCATGGACCTCCGGCCGG - Intergenic
986257226 5:6110565-6110587 AGTGTACCTGGACCACAGGCCGG + Intergenic
987039255 5:14046379-14046401 GGGCCACCTGCACCACAGGCTGG + Intergenic
987081334 5:14427746-14427768 GCTCAGCCTGGACCATCGGCAGG - Intronic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989367707 5:40675254-40675276 AGTAAGCCGGGACTACAGGCAGG - Intergenic
992226681 5:74625635-74625657 AGTCATCCTGGGCCACAGGTTGG + Intergenic
992360180 5:76029838-76029860 TGTCAGCTTGGACCTCAGTCTGG + Intergenic
993062054 5:83050330-83050352 GGTTAGTGTGGACCACAGGAGGG + Intergenic
995282390 5:110350752-110350774 GGGCTGCCTGCACCACAGGCAGG + Intronic
996779613 5:127171507-127171529 GAATAGCCTGGATCACAGGCGGG - Intergenic
997228860 5:132228500-132228522 GGACTGCCTGGACCAGAGCCCGG - Intronic
997857265 5:137383510-137383532 GGTCAGCCTTTCACACAGGCTGG - Intronic
999393650 5:151212708-151212730 GGTCAGCCTTGAGAACAGGCAGG + Intronic
999702979 5:154245094-154245116 TGTCAGCCTGGAAAGCAGGCTGG + Intronic
1000171431 5:158706641-158706663 GGTCAGCCTGGAAGTCAGGGAGG - Intronic
1001196515 5:169677962-169677984 GGTCCACCTGGAGCACAGACTGG + Intronic
1001411543 5:171515753-171515775 AGTCCGCAAGGACCACAGGCTGG - Intergenic
1001481332 5:172091149-172091171 GCTAAGCATGGAACACAGGCCGG - Intronic
1001489095 5:172143011-172143033 GGTGAGCCTGGACCACCCACAGG + Intronic
1001534478 5:172488973-172488995 GGTCAGCGTGGGCCCCAGTCTGG + Intergenic
1002564060 5:180100161-180100183 GGTGAGCCAGGACCACAGCAAGG - Intergenic
1002910959 6:1490749-1490771 AGTGAGCCGGGAGCACAGGCAGG + Intergenic
1003013832 6:2451998-2452020 GGTGAGGCTGGAGCACGGGCAGG + Intergenic
1003084126 6:3048010-3048032 GGTCACCCTGTTGCACAGGCTGG + Intergenic
1006722059 6:36161882-36161904 GGTTAGCTGGGACTACAGGCGGG - Intergenic
1010406437 6:75511380-75511402 GGTCAACCTGAAGCAGAGGCAGG - Intergenic
1011712866 6:90072336-90072358 GGTCACTCAGGGCCACAGGCTGG + Intronic
1013308882 6:108874761-108874783 GGAGAGCCAGGACCACAGGGTGG - Intronic
1014498285 6:122155294-122155316 GGTCAGCCCAGAGCACAGGAAGG - Intergenic
1015393212 6:132707027-132707049 GATCAGCCTGGACAACATGGTGG + Intronic
1015673353 6:135717539-135717561 GCTCAGGCTGGAGCTCAGGCTGG + Intergenic
1016810265 6:148254006-148254028 GATCAGCCTGGACAACATGGTGG + Intergenic
1016979777 6:149843555-149843577 GGTTGGCCTGGAACACAGGAGGG - Intronic
1018865690 6:167745588-167745610 GGACTGCCTGGATCAGAGGCTGG + Intergenic
1018908178 6:168087192-168087214 GAGCAGCTGGGACCACAGGCGGG + Intergenic
1018971058 6:168529548-168529570 GGGAAGCCTGGAACACAGCCAGG - Intronic
1019554479 7:1621907-1621929 GGTCAGCCTGGGCAACAGGGCGG + Intergenic
1019563616 7:1669480-1669502 GGGCAGCCTGGACCCCCGGCAGG - Intergenic
1020033759 7:4951391-4951413 GGTGAGGCTGCAACACAGGCTGG - Intronic
1020116362 7:5478546-5478568 GGTGAGCTGGGAGCACAGGCAGG + Intronic
1020259112 7:6520759-6520781 AGTCTGCTGGGACCACAGGCGGG + Exonic
1021558551 7:21945909-21945931 GCTCCGCCCGGAGCACAGGCGGG + Exonic
1022587484 7:31628260-31628282 AGAAAGCCTGGAGCACAGGCAGG + Intronic
1022872184 7:34491216-34491238 GGTCAGCCTGCTCCGAAGGCCGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024125406 7:46289942-46289964 TGTCAACCTGGAGCACAGTCTGG - Intergenic
1026746028 7:73013902-73013924 GGCCAGCCTGGACAACATGGTGG - Intergenic
1026749681 7:73042046-73042068 GGCCAGCCTGGACAACATGGTGG - Intergenic
1026753329 7:73070156-73070178 GGCCAGCCTGGACAACATGGTGG - Intergenic
1026756980 7:73098192-73098214 GGCCAGCCTGGACAACATGGTGG - Intergenic
1027032133 7:74898461-74898483 GGCCAGCCTGGACAACATGGTGG - Intergenic
1027052740 7:75030037-75030059 GAGCAGCCTGGAGCAGAGGCAGG + Intronic
1027090426 7:75295294-75295316 GGCCAGCCTGGACAACATGGTGG + Intergenic
1027094071 7:75323222-75323244 GGCCAGCCTGGACAACATGGTGG + Intergenic
1027097714 7:75351189-75351211 GGCCAGCCTGGACAACATGGTGG + Intergenic
1027321633 7:77016480-77016502 GGCCAGCCTGGACAACATGGTGG - Intergenic
1027325268 7:77044403-77044425 GGCCAGCCTGGACAACATGGTGG - Intergenic
1027741428 7:82011345-82011367 AGCCATCCTGGACCACAGGTTGG + Intronic
1029398815 7:100328189-100328211 GGCCAGCCTGGACAACATGGTGG + Intergenic
1029548740 7:101225052-101225074 AGTCATCCTGGGCCACATGCAGG - Intergenic
1031048033 7:116915271-116915293 TCTCAGCCTGTAGCACAGGCTGG - Intronic
1033159732 7:138984539-138984561 GGTTAGGCTGGTTCACAGGCAGG - Intergenic
1033333720 7:140435300-140435322 GGGCGGCCTGGGCCTCAGGCTGG + Intergenic
1033822172 7:145147945-145147967 GGGCACCATGGACCACATGCTGG + Intergenic
1034557669 7:151860263-151860285 GGACAGGCAAGACCACAGGCTGG + Intronic
1035361775 7:158318169-158318191 GGACAGGCCGCACCACAGGCGGG + Intronic
1035372318 7:158387333-158387355 GCTCATCCTGCACCACAGGAGGG + Intronic
1035488629 7:159252604-159252626 TGCTAGCCTGGACCACAGGCTGG + Intergenic
1036638694 8:10568703-10568725 GCTCAGGCTGGAGTACAGGCGGG + Intergenic
1036668803 8:10766102-10766124 GGTCGGCCTGAACTGCAGGCCGG + Intronic
1036701663 8:11017286-11017308 GGACAACCCGGACCCCAGGCTGG + Intronic
1039972010 8:42328142-42328164 GATCAGCCTGACCAACAGGCTGG - Intronic
1042659754 8:71141452-71141474 GACCAGCCTGGCCAACAGGCTGG - Intergenic
1042740172 8:72034720-72034742 GAGTAGCCGGGACCACAGGCAGG + Intronic
1045375478 8:101569499-101569521 GATCAGCCTGAGCGACAGGCTGG - Intronic
1047461222 8:125067213-125067235 GATCAGCCTGGCCAGCAGGCTGG - Intronic
1047935079 8:129768076-129768098 GGTCGGGCTGGATCACTGGCTGG - Intronic
1048307766 8:133295993-133296015 GGACAGCAGGGACAACAGGCGGG + Intronic
1048941494 8:139404274-139404296 GGTCAGCTGGGACCTCAGGGAGG + Intergenic
1049219598 8:141422812-141422834 GGTCAGCGCTGACCACAGGAGGG + Intronic
1053008020 9:34616926-34616948 GGTGAGACTGAACCACATGCAGG + Intronic
1053437276 9:38084399-38084421 GGCCAGCCTGCATCACAGGTAGG + Intergenic
1054336344 9:63813366-63813388 GGTCAACCGGGAGCAGAGGCGGG - Intergenic
1056629115 9:88278116-88278138 GGACAGGCGGGACCACAAGCCGG - Intergenic
1057527524 9:95816149-95816171 GCTCTGCCTGGAGCACAGGTGGG + Intergenic
1057527902 9:95818818-95818840 GGTCACCCAGGACCCCAGCCTGG - Intergenic
1058191313 9:101919472-101919494 AGTCCACCTGGAACACAGGCTGG + Intergenic
1058865410 9:109157512-109157534 GAGCAGCTGGGACCACAGGCAGG + Intronic
1058955256 9:109940917-109940939 GGGCAGGATGGAGCACAGGCTGG + Intronic
1060892363 9:127196944-127196966 GACCAGACTGGACCACAGTCAGG + Intronic
1061304004 9:129722313-129722335 GTTCAGCCTGCACCACAGCCAGG + Exonic
1061377363 9:130234420-130234442 GGCCACCCTGGACCAGAGGTAGG + Exonic
1062045110 9:134421435-134421457 GGTAAGCCTGCACCACTGGGGGG - Intronic
1062349126 9:136130596-136130618 GGCAAGCCTGACCCACAGGCAGG + Intergenic
1062380791 9:136285639-136285661 GGTCAGCCGGGAGCACGGGACGG + Exonic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185806068 X:3058479-3058501 GAGTAGCCGGGACCACAGGCAGG + Intronic
1185925631 X:4142677-4142699 GGTCCACCTGGAGCTCAGGCTGG - Intergenic
1187942061 X:24392002-24392024 GGTCAGGCTGGCTCACAGGCAGG + Intergenic
1189491518 X:41474557-41474579 GGCCGGCCTGGACCTCAGCCAGG + Exonic
1192600112 X:72453247-72453269 GATCAGCCTGGACAACAGCCTGG + Intronic
1200687275 Y:6267741-6267763 GGTCAGCCTGGAGGTGAGGCTGG + Intergenic
1201047998 Y:9906969-9906991 GGTCAGCCTGGAGGTGAGGCTGG - Intergenic