ID: 933728092

View in Genome Browser
Species Human (GRCh38)
Location 2:85437746-85437768
Sequence CGCTGCGCTCGCGGCTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933728092_933728099 18 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 933728099 2:85437787-85437809 CGGCCGCCTCGAGCTCAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 113
933728092_933728097 -2 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 933728097 2:85437767-85437789 CGAAACAAAGGGCGGCTCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 69
933728092_933728098 14 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 933728098 2:85437783-85437805 TCTGCGGCCGCCTCGAGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
933728092_933728096 -10 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 933728096 2:85437759-85437781 GAGCGCAGCGAAACAAAGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 67
933728092_933728102 26 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 933728102 2:85437795-85437817 TCGAGCTCAGGCTGGCACCGAGG 0: 1
1: 0
2: 1
3: 9
4: 131
933728092_933728103 27 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 933728103 2:85437796-85437818 CGAGCTCAGGCTGGCACCGAGGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933728092 Original CRISPR CGCTGCGCTCGCGGCTTCTG CGG (reversed) Intergenic
900147898 1:1166376-1166398 CTCAGCCCTCGCGGCGTCTGAGG + Intergenic
900210970 1:1455728-1455750 CCCTGCCCCCGAGGCTTCTGTGG + Intronic
900598819 1:3494388-3494410 CGCTGCGGCCCCGGCTTCTATGG - Exonic
905585654 1:39115554-39115576 CATTGCGGTCGAGGCTTCTGAGG + Intronic
908951382 1:69567353-69567375 CGCTGAGCTCGTGGCTCCTCAGG - Intergenic
919486962 1:198157424-198157446 CGCTGCGCTCGAGGCGGATGGGG + Intronic
921345227 1:214176778-214176800 CTCTCCTCTCGAGGCTTCTGTGG - Intergenic
922602950 1:226870806-226870828 CGCAGCGCTCCTGGCCTCTGCGG + Intronic
1062791192 10:307714-307736 CCCTTCCCTCCCGGCTTCTGGGG - Intronic
1070800735 10:79243199-79243221 CGCCGCGCTCGCGGACCCTGCGG - Intronic
1077015414 11:397040-397062 CCCTGCGCTCGCTGCGGCTGGGG + Exonic
1080387204 11:31817105-31817127 CGCTGCGCTGGCTGCCTCGGCGG - Intronic
1083933433 11:65858134-65858156 TGCAGCGCTCTCGTCTTCTGCGG - Exonic
1084178615 11:67435844-67435866 CCCTGCGCTCGCTGGTCCTGGGG + Exonic
1089808523 11:121113248-121113270 CGCTGCACTCTCTGCTTCTGTGG + Intronic
1089967566 11:122665941-122665963 CGTTGTGCTCCCGGCCTCTGTGG + Intronic
1092727658 12:11500637-11500659 GGCTGCGCTTGCGGCAGCTGCGG - Intronic
1095976622 12:47944342-47944364 CCCTACTCTCGCAGCTTCTGGGG + Intergenic
1102572573 12:113835978-113836000 GGCTGCGCTCGCAGGTACTGTGG + Intronic
1104896034 12:132164059-132164081 CGCTGGGCTCCCGGCTGCTCAGG + Intergenic
1104949572 12:132433158-132433180 GGCACGGCTCGCGGCTTCTGCGG - Intergenic
1107516299 13:41132766-41132788 CGCTGCAGTAGCGGCTTCTGCGG - Intergenic
1108541538 13:51451849-51451871 CGCTGCGCTCCCAGCCGCTGAGG - Intronic
1110596633 13:77326958-77326980 CGCCGCCCTCGCCGCTACTGGGG + Intronic
1110860869 13:80343002-80343024 CGCTGCGCTCGCGGCCCCTCTGG + Intergenic
1111822048 13:93227088-93227110 CGCAGCGCTCCAGGATTCTGCGG + Exonic
1112402306 13:99087053-99087075 CTCTGCGCCCGGGGCCTCTGCGG + Intergenic
1113857281 13:113454360-113454382 TGCTGGGCTCCCGGCCTCTGCGG - Intergenic
1122715767 14:103696113-103696135 CGCTGCACACACGGCTGCTGTGG - Intergenic
1126777463 15:52112274-52112296 TGCTGAGCTCGCGGCTCATGGGG - Exonic
1130564023 15:84979930-84979952 CGCTGACCTTGCCGCTTCTGGGG - Intergenic
1143524183 17:7462831-7462853 CGCTGGGCTCTCGGCCGCTGGGG + Exonic
1144704016 17:17355578-17355600 CCCGGCGCTCGGGGCTCCTGGGG + Intergenic
1150802366 17:68291904-68291926 CGCGGCGCTCGCGGCTGCGGCGG + Intronic
1152192386 17:78896699-78896721 TGCTCCGAGCGCGGCTTCTGCGG - Intronic
1152528202 17:80901798-80901820 CGCTGGGGGCGGGGCTTCTGGGG - Intronic
1152902615 17:82952212-82952234 CGCTGGCCTCACGGCTTCTGCGG + Intronic
1160891949 19:1383782-1383804 CGCTGCGCTTTCGGCCTCCGTGG - Exonic
1161385179 19:3987907-3987929 CGCTGCGCATGCGCCTGCTGCGG + Intergenic
1161401478 19:4067617-4067639 CGCTGCGCTAGGGGCGTCAGCGG + Intergenic
1163828632 19:19537396-19537418 CGCTGCGCTGGCCGCTTCTCCGG + Exonic
927787188 2:25982153-25982175 CGCTGCTCCCGCGGCGACTGGGG - Exonic
928013099 2:27629079-27629101 CGCTGAGCTCCAGGCTTCTGGGG + Exonic
931748890 2:65313899-65313921 CGCTGCCCCCGCGGCCTTTGGGG + Exonic
933728092 2:85437746-85437768 CGCTGCGCTCGCGGCTTCTGCGG - Intergenic
937262238 2:120594026-120594048 CCCTGAGCTCATGGCTTCTGCGG - Intergenic
942896780 2:181066573-181066595 TGCTGGGCTCTCAGCTTCTGTGG + Intronic
946404105 2:219483669-219483691 CCCTGCGCCAGCGGCTGCTGCGG + Exonic
947477837 2:230467168-230467190 TGCCCCGCTCGAGGCTTCTGCGG - Exonic
1171394099 20:24819884-24819906 TGCTGTGCTCACGGATTCTGTGG - Intergenic
1173823357 20:46032183-46032205 CGCTGCGCTCTCGGCCTGCGCGG + Intronic
1176167161 20:63680356-63680378 TGCTGCGCTCCCGGGTGCTGGGG + Intronic
1179176668 21:39012552-39012574 CGGTGAGCTCCGGGCTTCTGAGG - Intergenic
1184805562 22:46792956-46792978 CTCTGCGCTCCCGCCTGCTGTGG - Intronic
957086575 3:75684889-75684911 CGCTGCCCTCGCAGAGTCTGGGG - Intergenic
967272303 3:187741633-187741655 CGCTGTGCTCGCGGCGGCAGCGG + Intronic
976793334 4:88905205-88905227 CGCTGCGACCTCTGCTTCTGAGG + Intronic
985084242 4:186296702-186296724 CGCTGTGCTGGCAGCTGCTGGGG - Intergenic
992162514 5:74016717-74016739 CGCTCCTCTCTCTGCTTCTGGGG - Intergenic
997980424 5:138464918-138464940 CGCTGGGCGCGCGGCTGCTCAGG - Intergenic
1005453063 6:25992597-25992619 CGCTGCGGGCGGGGCTCCTGCGG - Intergenic
1006110232 6:31740084-31740106 CGCTGCGATGGCGGCAGCTGGGG + Intronic
1006950839 6:37819994-37820016 CGCTGTCCCTGCGGCTTCTGGGG + Exonic
1011643064 6:89433198-89433220 GGCAGCGCTCTCGGCTCCTGCGG - Intronic
1017146683 6:151240906-151240928 CGCCGCGCTCGCCGCTGCTCTGG - Intronic
1018156681 6:160991798-160991820 CGCGGCGCGCACGGCTCCTGCGG + Exonic
1019526968 7:1484871-1484893 CCCTGGGCTGGCGGCTTCTTGGG - Intronic
1024531995 7:50401047-50401069 GGCTGTGCTCTCTGCTTCTGGGG - Exonic
1025173948 7:56787457-56787479 CGCTGGTCTCGCGGGTGCTGCGG + Intergenic
1025698152 7:63790497-63790519 CGCTGGTCTCGCGGGTGCTGCGG - Intergenic
1026805120 7:73424446-73424468 CGCTGCGATCACGGCCTCAGAGG + Intergenic
1037888008 8:22605082-22605104 CCCGGCGCTGGCGGCTGCTGAGG + Intronic
1040603821 8:48910501-48910523 GGCTGAGAGCGCGGCTTCTGCGG - Intergenic
1041726615 8:61023816-61023838 CGCTGTGCTCACAGCTTCTTTGG + Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1061936669 9:133861648-133861670 TGCTGCACTCCCGGCTCCTGTGG + Intronic
1186200134 X:7148215-7148237 CTCTGCGCACGCGCCTTCCGCGG + Intergenic
1195706732 X:107742889-107742911 CGCTGCTCTCGGGGCTCCCGAGG - Intronic