ID: 933728092

View in Genome Browser
Species Human (GRCh38)
Location 2:85437746-85437768
Sequence CGCTGCGCTCGCGGCTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933728092_933728098 14 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG No data
Right 933728098 2:85437783-85437805 TCTGCGGCCGCCTCGAGCTCAGG No data
933728092_933728096 -10 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG No data
Right 933728096 2:85437759-85437781 GAGCGCAGCGAAACAAAGGGCGG No data
933728092_933728097 -2 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG No data
Right 933728097 2:85437767-85437789 CGAAACAAAGGGCGGCTCTGCGG No data
933728092_933728103 27 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG No data
Right 933728103 2:85437796-85437818 CGAGCTCAGGCTGGCACCGAGGG No data
933728092_933728102 26 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG No data
Right 933728102 2:85437795-85437817 TCGAGCTCAGGCTGGCACCGAGG No data
933728092_933728099 18 Left 933728092 2:85437746-85437768 CCGCAGAAGCCGCGAGCGCAGCG No data
Right 933728099 2:85437787-85437809 CGGCCGCCTCGAGCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933728092 Original CRISPR CGCTGCGCTCGCGGCTTCTG CGG (reversed) Intergenic