ID: 933729171

View in Genome Browser
Species Human (GRCh38)
Location 2:85444513-85444535
Sequence AGGGCTGGTGGGGGGCATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933729171_933729186 21 Left 933729171 2:85444513-85444535 CCCCGATGCCCCCCACCAGCCCT No data
Right 933729186 2:85444557-85444579 TGCCCTCCTAAGTGTCCTCTGGG No data
933729171_933729187 22 Left 933729171 2:85444513-85444535 CCCCGATGCCCCCCACCAGCCCT No data
Right 933729187 2:85444558-85444580 GCCCTCCTAAGTGTCCTCTGGGG No data
933729171_933729185 20 Left 933729171 2:85444513-85444535 CCCCGATGCCCCCCACCAGCCCT No data
Right 933729185 2:85444556-85444578 GTGCCCTCCTAAGTGTCCTCTGG No data
933729171_933729181 -4 Left 933729171 2:85444513-85444535 CCCCGATGCCCCCCACCAGCCCT No data
Right 933729181 2:85444532-85444554 CCCTTCTACTTAGCTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933729171 Original CRISPR AGGGCTGGTGGGGGGCATCG GGG (reversed) Intergenic
No off target data available for this crispr