ID: 933729254

View in Genome Browser
Species Human (GRCh38)
Location 2:85444910-85444932
Sequence GTCTGTGAATGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933729247_933729254 -5 Left 933729247 2:85444892-85444914 CCCACGGAGGGGAGAGCAGTCTG No data
Right 933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG No data
933729248_933729254 -6 Left 933729248 2:85444893-85444915 CCACGGAGGGGAGAGCAGTCTGT No data
Right 933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG No data
933729239_933729254 30 Left 933729239 2:85444857-85444879 CCTGTCTCCTCACATTATAGATG No data
Right 933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG No data
933729241_933729254 23 Left 933729241 2:85444864-85444886 CCTCACATTATAGATGAGGAAAT No data
Right 933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933729254 Original CRISPR GTCTGTGAATGGAGGGGAGA GGG Intergenic
No off target data available for this crispr