ID: 933731102

View in Genome Browser
Species Human (GRCh38)
Location 2:85456811-85456833
Sequence AAGCTGATCTATGTGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933731102_933731103 -1 Left 933731102 2:85456811-85456833 CCAGCAGTCACATAGATCAGCTT No data
Right 933731103 2:85456833-85456855 TTAATGTGCCCACGAATCCCTGG No data
933731102_933731110 29 Left 933731102 2:85456811-85456833 CCAGCAGTCACATAGATCAGCTT No data
Right 933731110 2:85456863-85456885 GTTTAAATGCACATTCCAGTGGG No data
933731102_933731109 28 Left 933731102 2:85456811-85456833 CCAGCAGTCACATAGATCAGCTT No data
Right 933731109 2:85456862-85456884 TGTTTAAATGCACATTCCAGTGG No data
933731102_933731104 0 Left 933731102 2:85456811-85456833 CCAGCAGTCACATAGATCAGCTT No data
Right 933731104 2:85456834-85456856 TAATGTGCCCACGAATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933731102 Original CRISPR AAGCTGATCTATGTGACTGC TGG (reversed) Intergenic
No off target data available for this crispr