ID: 933736246

View in Genome Browser
Species Human (GRCh38)
Location 2:85497068-85497090
Sequence ATGCCCATTCAGAAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933736246_933736253 19 Left 933736246 2:85497068-85497090 CCTTCACCCTTCTGAATGGGCAT No data
Right 933736253 2:85497110-85497132 TCCATGATTTGGGGTAAATGAGG No data
933736246_933736250 8 Left 933736246 2:85497068-85497090 CCTTCACCCTTCTGAATGGGCAT No data
Right 933736250 2:85497099-85497121 AGGTTGCTTTTTCCATGATTTGG No data
933736246_933736252 10 Left 933736246 2:85497068-85497090 CCTTCACCCTTCTGAATGGGCAT No data
Right 933736252 2:85497101-85497123 GTTGCTTTTTCCATGATTTGGGG No data
933736246_933736251 9 Left 933736246 2:85497068-85497090 CCTTCACCCTTCTGAATGGGCAT No data
Right 933736251 2:85497100-85497122 GGTTGCTTTTTCCATGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933736246 Original CRISPR ATGCCCATTCAGAAGGGTGA AGG (reversed) Intergenic
No off target data available for this crispr