ID: 933739653

View in Genome Browser
Species Human (GRCh38)
Location 2:85523512-85523534
Sequence TGCAACAATCCTAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933739648_933739653 13 Left 933739648 2:85523476-85523498 CCATACAACATGTAGGAATTCAC No data
Right 933739653 2:85523512-85523534 TGCAACAATCCTAATGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933739653 Original CRISPR TGCAACAATCCTAATGAGGT AGG Intergenic
No off target data available for this crispr